ID: 1162079169

View in Genome Browser
Species Human (GRCh38)
Location 19:8208734-8208756
Sequence CACCCTGGGTACCCCGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162079169_1162079174 -8 Left 1162079169 19:8208734-8208756 CCAGACTCGGGGTACCCAGGGTG 0: 1
1: 0
2: 2
3: 4
4: 100
Right 1162079174 19:8208749-8208771 CCAGGGTGGCCGCTGAGGCCTGG 0: 1
1: 0
2: 4
3: 87
4: 622
1162079169_1162079177 3 Left 1162079169 19:8208734-8208756 CCAGACTCGGGGTACCCAGGGTG 0: 1
1: 0
2: 2
3: 4
4: 100
Right 1162079177 19:8208760-8208782 GCTGAGGCCTGGAGAAATCTGGG 0: 1
1: 2
2: 1
3: 39
4: 303
1162079169_1162079176 2 Left 1162079169 19:8208734-8208756 CCAGACTCGGGGTACCCAGGGTG 0: 1
1: 0
2: 2
3: 4
4: 100
Right 1162079176 19:8208759-8208781 CGCTGAGGCCTGGAGAAATCTGG 0: 1
1: 0
2: 1
3: 16
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162079169 Original CRISPR CACCCTGGGTACCCCGAGTC TGG (reversed) Intronic
900186676 1:1336238-1336260 CACCCGGGGGACCCCCTGTCCGG - Exonic
900208624 1:1442209-1442231 CACCCTGGGTGGACTGAGTCGGG - Exonic
900251021 1:1669752-1669774 CACGCTGGGCCCCCCGTGTCGGG + Intronic
900313702 1:2047046-2047068 CACCCTGGGTCCTCCGGGGCGGG - Intergenic
900393793 1:2444869-2444891 CACCATGGGCTCCCCAAGTCAGG - Intronic
902793468 1:18784771-18784793 CACCCTGGGCACCCCGAGGCTGG - Intergenic
906539177 1:46572001-46572023 CTCCCTTGGTACCCAGAGGCTGG + Intronic
908272511 1:62435453-62435475 GACCCTGGGTAAGCCGAGTAAGG - Intergenic
917783370 1:178424708-178424730 CACCCTGGCCTCCCAGAGTCTGG + Intronic
922696108 1:227731856-227731878 CACTCTGGGTACCCAGAGGAAGG + Exonic
923040019 1:230313100-230313122 CACCGTGGGAACCCTGAGGCTGG + Intergenic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
1067059317 10:43069813-43069835 CACCCTGGGCACCCCCTATCTGG - Intergenic
1074580239 10:114712013-114712035 CACCCTGGAGACCCCCAGGCAGG - Intergenic
1075322356 10:121502044-121502066 CACCCGGGGTACCCTGAGTGTGG - Intronic
1075742095 10:124702106-124702128 CACCCTGGGTCCCCAGAGTCAGG - Intronic
1077198445 11:1293241-1293263 CACCTTGGGCACACGGAGTCCGG + Intronic
1079330706 11:19530318-19530340 CACCCTGGGCATCACGAGGCAGG + Intronic
1083049742 11:59766517-59766539 CTCCCTGAGTACCCTGAGTGGGG + Intronic
1085296112 11:75432721-75432743 CACTCTGGGGATCCCCAGTCTGG + Intergenic
1086181905 11:83962353-83962375 CACCTTGGGTACCCTGGGACAGG + Intronic
1095095366 12:38145008-38145030 GCCAGTGGGTACCCCGAGTCCGG - Intergenic
1095559847 12:43551927-43551949 CACCCTGGGGACCCCGATCGGGG + Intergenic
1097247142 12:57612862-57612884 TTCCCTGGGGACCCTGAGTCTGG + Intronic
1101824555 12:108210065-108210087 CACCATGGAGACCCCGAGGCAGG - Intronic
1102135061 12:110567269-110567291 CACCCTGGCCACACCGATTCAGG - Intronic
1106722123 13:32445907-32445929 CACCCTGGATAATCAGAGTCAGG + Intronic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1111196260 13:84877275-84877297 CACAGTGGGTACCTTGAGTCTGG - Intergenic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1124960578 15:34390458-34390480 CACTTTGGGGAGCCCGAGTCTGG + Intronic
1124977207 15:34536679-34536701 CACTTTGGGGAGCCCGAGTCTGG + Intronic
1125474635 15:40038824-40038846 CTCCCTGGGTTCCCGGTGTCTGG - Intronic
1131675432 15:94666289-94666311 CACCCAGGGTACACTGAGTAGGG + Intergenic
1132567616 16:630628-630650 CAGCCTGGGTCCCCCGGGCCAGG - Intronic
1134740463 16:16538808-16538830 GATCCTGGGTAACCCGAGTCAGG - Intergenic
1134927041 16:18173364-18173386 GATCCTGGGTAACCAGAGTCAGG + Intergenic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1145296915 17:21599538-21599560 CACCCTGAAATCCCCGAGTCAGG + Intergenic
1148612017 17:48970949-48970971 TTCCCTGGGAACCCTGAGTCTGG + Intergenic
1150613731 17:66753272-66753294 CAACCTGGGTACTCAGAGCCTGG + Intronic
1150646967 17:66984851-66984873 AACCCTGGGGACCCTGAGGCAGG - Intronic
1152539637 17:80968505-80968527 CAACCTGGATCCCCCGAGCCAGG + Intergenic
1152566393 17:81102243-81102265 CACCCTGAGAGCCCCGAGGCAGG - Intronic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1154072873 18:11169364-11169386 CATCCTCAGTACCCAGAGTCAGG + Intergenic
1159696026 18:71557140-71557162 CACTTTGGGAACCCCGAGGCAGG - Intergenic
1160383589 18:78479471-78479493 CACCCGGGTTAACCAGAGTCCGG + Intergenic
1161976692 19:7611464-7611486 GACCCTGGGAACCCTGAGTGGGG - Intronic
1162079169 19:8208734-8208756 CACCCTGGGTACCCCGAGTCTGG - Intronic
1163634448 19:18431685-18431707 CACCCTGCGGATGCCGAGTCAGG + Exonic
1164136505 19:22421856-22421878 CACCCCCAGCACCCCGAGTCAGG + Intronic
1165895625 19:39139354-39139376 CCCGCTGGGTACCCCGACACTGG - Intronic
1166944147 19:46386934-46386956 CCCCCTTGGTACCTCCAGTCTGG + Intronic
1167774699 19:51547231-51547253 ATCCCTGGGTCACCCGAGTCAGG - Intergenic
925971529 2:9109983-9110005 CACCCTCTGTACCAGGAGTCCGG - Intergenic
928886292 2:36152274-36152296 CACCCTGGATACCCTTCGTCAGG - Intergenic
932086200 2:68764611-68764633 TACCCTGGGTGCCCAAAGTCAGG - Intronic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933697208 2:85228589-85228611 CTCCTTGGGAACCCCAAGTCAGG - Intronic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
937983852 2:127629851-127629873 CAGCCTGGGTACCCGAGGTCAGG + Intronic
941666540 2:168247906-168247928 CCCCCTGGGGACCCCGAGGGCGG + Exonic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
944340656 2:198594141-198594163 CACCCTGGTTACCCCCATCCTGG + Intergenic
1180209712 21:46287444-46287466 CACTCTGGGAAGCCCGAGGCAGG - Intronic
1180995835 22:19964771-19964793 GACCCTGAGTGCCCCGAGTGAGG + Intronic
1182748974 22:32626749-32626771 GACACTGGGTGCCCCGAGTGTGG + Intronic
951999786 3:28772315-28772337 CCCACTGGGTACTCCTAGTCAGG - Intergenic
952784962 3:37144060-37144082 TACCCTGGGCACCCCAAGACAGG + Intronic
953384840 3:42500674-42500696 GACCCTGTGTACCCCGTCTCGGG - Intronic
961320421 3:126069279-126069301 CACACTGGGTACATCCAGTCCGG - Intronic
962748828 3:138417924-138417946 CACCCTGGGGGCCCAGGGTCTGG + Intergenic
968795046 4:2697840-2697862 CATCGTGGGTACCCCGATGCTGG - Intronic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
985685707 5:1280557-1280579 AACCCTGGGGACGCCCAGTCCGG + Intronic
991350601 5:65716914-65716936 GACCCTGGGTACACCAGGTCAGG + Intronic
997367792 5:133336879-133336901 CACACTGTGTACCCCGGGGCAGG + Intronic
1000328135 5:160187599-160187621 CACCCTTGTTCCCCCAAGTCAGG - Intronic
1006372260 6:33652377-33652399 CAGCCTGCCCACCCCGAGTCTGG + Intronic
1011820201 6:91244577-91244599 CCCTCTGGGAACCCCCAGTCTGG - Intergenic
1015112621 6:129610477-129610499 CATCCAGGGTAGCCTGAGTCTGG - Intronic
1018920369 6:168168195-168168217 CCCCCTGGGTCCCCTGAGGCTGG - Intergenic
1021483535 7:21144162-21144184 CACTCTGGGTAACCTGAGGCTGG + Intergenic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1030695675 7:112582297-112582319 CACCCTGGTTTCCTCAAGTCAGG + Intergenic
1036205862 8:6805384-6805406 CGCCCTTGGTCCCCCGGGTCTGG - Intergenic
1040138433 8:43882515-43882537 CCCCGTGGGTGCCCCTAGTCTGG + Intergenic
1045503404 8:102760616-102760638 CATCCTGTCTACCCCAAGTCTGG + Intergenic
1049751146 8:144284880-144284902 CACCCTGGGTCCACCCAGGCAGG + Intronic
1056993888 9:91436691-91436713 GACCCTGGCTACCAAGAGTCTGG + Intergenic
1057604890 9:96492123-96492145 CACCCTGGGCACCACGTTTCTGG + Intronic
1057694725 9:97315001-97315023 AACCCAGGGCACCCCGAGCCTGG + Intronic
1058593043 9:106585410-106585432 AACCCTGGGTTCCCTGAGGCTGG - Intergenic
1061720810 9:132550156-132550178 CAACCTGGGAACCCCCAGCCTGG + Intronic
1061917383 9:133762546-133762568 CACCCTGGGGCCTCCGTGTCGGG - Exonic
1061996478 9:134188736-134188758 CACCCAGCGTATCCCGAGTTTGG - Intergenic
1062464213 9:136674025-136674047 CTCCCTGGGAAGCCCGAGGCCGG + Intronic
1062637591 9:137499711-137499733 CAGCCTGGGGACCCCGAGCCGGG - Intronic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic