ID: 1162079233

View in Genome Browser
Species Human (GRCh38)
Location 19:8208959-8208981
Sequence GGACAATACTGGGTTCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162079228_1162079233 -5 Left 1162079228 19:8208941-8208963 CCGGACGGAGCGCGCAGCGGACA 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1162079233 19:8208959-8208981 GGACAATACTGGGTTCAAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 114
1162079226_1162079233 1 Left 1162079226 19:8208935-8208957 CCGGGGCCGGACGGAGCGCGCAG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1162079233 19:8208959-8208981 GGACAATACTGGGTTCAAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162079233 Original CRISPR GGACAATACTGGGTTCAAAG GGG Intronic
903188637 1:21643786-21643808 GGACAATCTGGGGTTCAGAGAGG + Intronic
907506205 1:54920372-54920394 GGACAATAGTGGGGACAAGGTGG - Intergenic
909339171 1:74512298-74512320 GGCCAATCTTGGGTTCAAGGTGG - Intronic
912467050 1:109881564-109881586 GGACAAAACTAAGTTCAGAGAGG + Intergenic
912788917 1:112631761-112631783 GGACCAGAATAGGTTCAAAGAGG + Intronic
924368223 1:243319280-243319302 AGACAACACTGATTTCAAAGAGG - Intronic
1063131825 10:3185148-3185170 GGAAAATACTGGGTGGAAAAGGG + Intergenic
1064887398 10:20125104-20125126 GGACATTACTGGGATCAAGCTGG - Intronic
1067770919 10:49124343-49124365 GGAAAATAAAGGGTTTAAAGTGG + Intergenic
1068133793 10:52929748-52929770 TTACAATACAGTGTTCAAAGTGG - Intergenic
1070465774 10:76722182-76722204 GGAGAATAATGTTTTCAAAGTGG - Intergenic
1071129094 10:82370592-82370614 GGAAAATACTGGGTTGAAGAGGG - Intronic
1072784603 10:98270999-98271021 GGTCACTACTGGGTTCAACCAGG - Intergenic
1077861237 11:6182043-6182065 TGACAATACTGGAATCAAACTGG + Intergenic
1078276597 11:9854276-9854298 GAAGAATGCTGGCTTCAAAGTGG - Intronic
1080487578 11:32727303-32727325 GGAAAATACTAGGTTTACAGTGG - Intronic
1081851664 11:46278536-46278558 GGACCAGACTGGGCGCAAAGTGG + Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1089425583 11:118371680-118371702 GGACAATACAGTATTCAATGGGG - Intronic
1090609141 11:128454640-128454662 GGCCATTACTGGGTTTAATGAGG + Intergenic
1093061714 12:14614093-14614115 GGAGCATACTGGGGGCAAAGAGG - Intronic
1094104779 12:26799716-26799738 CAATAACACTGGGTTCAAAGAGG - Intronic
1095146818 12:38739995-38740017 AGATAATAATGGCTTCAAAGGGG + Intronic
1095585078 12:43840635-43840657 GCACAATACTGGGCTCATACTGG - Intronic
1096842559 12:54388660-54388682 GGCCAGTACTGGGTTAAAATGGG + Intronic
1112132350 13:96537915-96537937 GGACAGTGATGGTTTCAAAGGGG + Intronic
1114513958 14:23285804-23285826 GGATAATTCTAGGTTCGAAGTGG - Intronic
1119211168 14:72833228-72833250 GGACAAAACTGGGTGGGAAGAGG + Intronic
1120190041 14:81432357-81432379 GGACAATCTTGGGTTCTCAGGGG + Intronic
1120330294 14:83084073-83084095 GTTCAATACTAGGTTCAAAGTGG - Intergenic
1121943319 14:98093874-98093896 GGACAATGCTGGATTGAAAAGGG + Intergenic
1124200953 15:27678117-27678139 GGAGGATCCTGGGTTCACAGTGG - Intergenic
1124363780 15:29057081-29057103 GGACAGCACTGGGATCAGAGAGG - Intronic
1125199849 15:37093989-37094011 GGAAATAACTGGGTTCAGAGTGG + Intronic
1125753534 15:42046704-42046726 GAACAATACTAGGTGCATAGTGG + Intronic
1126277042 15:46895437-46895459 GGAAAATACTGGGTTGAAGAGGG - Intergenic
1127133957 15:55899519-55899541 AGAAAATACTGGTTTTAAAGGGG - Intronic
1131025454 15:89137726-89137748 GGAAAATGCTGTGTTCAAAGTGG + Intronic
1137607413 16:49795924-49795946 GGACAAGAAGGGGCTCAAAGAGG + Intronic
1138909987 16:61384747-61384769 GGGCAAGAGTGGGTACAAAGAGG + Intergenic
1140146506 16:72316138-72316160 GGACAAAAGTGGGGTCAGAGAGG - Intergenic
1140642496 16:76992776-76992798 GGACAATACTGCCTTCCAATAGG - Intergenic
1142591498 17:1008097-1008119 GGACAATCCTGGGTCCCACGAGG - Intronic
1142720133 17:1770401-1770423 GGACACAGCTGGGTTCACAGGGG + Intronic
1147655904 17:42090907-42090929 GAACAAGACAGGGTTCCAAGAGG - Intergenic
1153850757 18:9092009-9092031 GTACATGACTGGGTTCATAGTGG - Intergenic
1155523164 18:26689590-26689612 AGACAATCCTGGTTTCAAATCGG + Intergenic
1157680372 18:49600878-49600900 GGAGAATGCTGAGTTCAAGGAGG + Intergenic
1159055767 18:63462316-63462338 GGACAAAAAAGAGTTCAAAGGGG - Intergenic
1162079233 19:8208959-8208981 GGACAATACTGGGTTCAAAGGGG + Intronic
1162416182 19:10539279-10539301 GGCCTACACTGGGCTCAAAGTGG + Intergenic
1168484354 19:56748236-56748258 GGAAAATACTGGGCTCAGAGAGG - Intergenic
927138441 2:20114001-20114023 AGACAGTTCTGGGTTCAATGAGG - Intergenic
929682345 2:44004341-44004363 GGAGATTACTGGGTTCCAAGAGG + Intergenic
930337191 2:50063467-50063489 GGAGAATGTCGGGTTCAAAGTGG - Intronic
931161484 2:59696534-59696556 GGATAATTCATGGTTCAAAGAGG + Intergenic
932559719 2:72856444-72856466 GGACAATGCTGGAGTCAAGGAGG - Intergenic
938587096 2:132701861-132701883 GGACAGCACTGGGTTCCCAGAGG + Intronic
939258583 2:139777645-139777667 GTACATTACTGTGTTCATAGTGG - Intergenic
941009557 2:160284129-160284151 GTACACTACTGGGTTCATGGCGG + Intronic
943941126 2:193999113-193999135 GGACAATATTGGGATCATATTGG + Intergenic
944013086 2:194998357-194998379 AAACAGTACTGGGTTCAGAGTGG + Intergenic
945348115 2:208743862-208743884 GAATAAAACTGTGTTCAAAGGGG + Intronic
1172329275 20:34063722-34063744 GGAGAATAAGGGGATCAAAGAGG + Intronic
1174761039 20:53207546-53207568 GGACAAAACTGGGGTCAGATAGG - Intronic
1175275320 20:57764641-57764663 GGAGAAAACTGGTCTCAAAGTGG - Intergenic
1175356463 20:58372901-58372923 GGAGAATAATAGGTTCAAAGGGG + Intergenic
1175763223 20:61575083-61575105 TGACAACACTGAATTCAAAGCGG + Intronic
1175870110 20:62205229-62205251 GGACCATCCTGGGTTTAGAGAGG - Intergenic
1177268636 21:18816322-18816344 GTACAATACCGGGAACAAAGGGG + Intergenic
1180953200 22:19730043-19730065 GGACAATGCTGGGATCAAGGTGG - Intergenic
1181954948 22:26581363-26581385 GGACCATGCTGGGTTCTGAGAGG - Intronic
1182046449 22:27278012-27278034 GGAAAATAGAGGTTTCAAAGGGG + Intergenic
956280299 3:67548972-67548994 GCAAAATACTGAGTTCAAATGGG + Intronic
959588225 3:108046554-108046576 GGACAAGACAGGGTTTCAAGGGG + Intronic
959839618 3:110959178-110959200 GGACAATACTGGGTAGAAGAGGG - Intergenic
962682130 3:137811171-137811193 GGACCATACTGGGTCCACACTGG + Intergenic
964890737 3:161531705-161531727 TGACAAGACTGGTGTCAAAGTGG - Intergenic
964998005 3:162911624-162911646 GGAAAATAGTGGTTTCAAAATGG - Intergenic
965208773 3:165757456-165757478 GGAAAATACTGGGGTGAAAAAGG - Intergenic
968586924 4:1422710-1422732 TGACAATAGTGGGTTTAAACTGG - Intergenic
971549825 4:27938880-27938902 AGACCATCCTGGGTTAAAAGTGG - Intergenic
972682386 4:41318852-41318874 GGACAAGAAAGCGTTCAAAGAGG - Intergenic
974009529 4:56594241-56594263 GGACAATATTTGTTTCAGAGTGG - Intronic
974455509 4:62125027-62125049 GGAGAATACAGTTTTCAAAGAGG + Intergenic
974995426 4:69152092-69152114 GGCCAACACAGAGTTCAAAGTGG - Intronic
975394635 4:73860871-73860893 GAACAATACTGATTTCAAAGAGG - Intergenic
980170646 4:129285778-129285800 GGACAAAACTGGGTTCAGTAGGG + Intergenic
981008557 4:139900915-139900937 GGACAGGAATGGGTTCAGAGAGG + Intronic
982502664 4:156176721-156176743 GGAAGAAACTGGATTCAAAGAGG + Intergenic
987062425 5:14255168-14255190 GGACAATACAAGCTTTAAAGAGG + Intronic
990223167 5:53618481-53618503 GCACAATATTGGCTTCACAGTGG + Intronic
998791094 5:145766992-145767014 GGAAAATACTGGGTAGAAAAGGG + Intronic
1000703695 5:164485365-164485387 TGAAATTACTGAGTTCAAAGTGG + Intergenic
1001030843 5:168261649-168261671 GGACATTCCTGGGTCTAAAGCGG + Intronic
1003066498 6:2908396-2908418 GGAGAATACTGGGGACACAGGGG - Intergenic
1003802865 6:9691000-9691022 GGACCATGCTGGCTTCATAGAGG + Intronic
1006494954 6:34415981-34416003 GGACAATAATTGGTTAAATGGGG - Intronic
1009545378 6:65013426-65013448 GAACAATGATGGGTTCAAATAGG + Intronic
1013630382 6:111980551-111980573 TGACAATGCTGGGATGAAAGGGG + Intergenic
1013981418 6:116134156-116134178 TGACCATACTGGTGTCAAAGAGG + Intronic
1026078417 7:67194776-67194798 GGACAATAATGGGGGCATAGTGG - Intronic
1026698405 7:72617208-72617230 GGACAATAATGGGGGCATAGTGG + Intronic
1027219937 7:76207428-76207450 ATACCATACTGTGTTCAAAGTGG - Intronic
1028283375 7:88962435-88962457 GAGCAATACTGAGTTCAATGAGG - Intronic
1031420814 7:121549824-121549846 GGATACTACTGGGTGCATAGAGG + Intergenic
1032081559 7:128861077-128861099 GGACAAAACTGGTTTCAGAGTGG - Intergenic
1033219421 7:139518476-139518498 GGACAAAACTGGGTTCTGAAAGG + Intergenic
1033881049 7:145884414-145884436 AGACAATACTGGGCACAAATGGG - Intergenic
1034644676 7:152634383-152634405 GGAAAATACTGTGTGCAAAGAGG + Intergenic
1039255156 8:35710827-35710849 GGGCAAGACTGGCTACAAAGAGG - Intronic
1041411194 8:57557840-57557862 GGTCATTACTGATTTCAAAGAGG + Intergenic
1056117704 9:83457412-83457434 GGACAATCATGGGGTCAATGAGG - Intronic
1056465939 9:86854803-86854825 AAACAAAACTGAGTTCAAAGGGG - Intergenic
1059506400 9:114803493-114803515 GGAAAAGACTGGATTCAAGGAGG - Intronic
1185779242 X:2830277-2830299 GGGCAATCCTGCGGTCAAAGTGG - Intronic
1187771517 X:22703684-22703706 ACACACTACTGGGTTTAAAGGGG - Intergenic
1187993310 X:24898979-24899001 GGACAATACTGAGTTCCCAGAGG + Intronic
1189415153 X:40806281-40806303 GGAAAATACTGGGTAGAAAAGGG - Intergenic
1190092800 X:47454367-47454389 GGTCAATAGTGGGTATAAAGGGG - Intronic
1194025163 X:88742536-88742558 GAACAAAACTGGATTCAGAGTGG - Intergenic
1197869652 X:131053000-131053022 GGAGAATAGTGGGAACAAAGGGG - Intergenic
1198963167 X:142203835-142203857 GGAAAATACTAAGTACAAAGTGG + Exonic
1201290806 Y:12420212-12420234 GGGCAATCCTGCGGTCAAAGTGG + Intergenic
1201751548 Y:17436960-17436982 GGGAAATACTGGGTTCAAGAGGG - Intergenic