ID: 1162080724

View in Genome Browser
Species Human (GRCh38)
Location 19:8216076-8216098
Sequence CAGGGCTACAATTTTAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 233}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162080724_1162080732 17 Left 1162080724 19:8216076-8216098 CCCTCTTTAAAATTGTAGCCCTG 0: 1
1: 0
2: 2
3: 24
4: 233
Right 1162080732 19:8216116-8216138 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
1162080724_1162080736 27 Left 1162080724 19:8216076-8216098 CCCTCTTTAAAATTGTAGCCCTG 0: 1
1: 0
2: 2
3: 24
4: 233
Right 1162080736 19:8216126-8216148 CCCAGCACTTTGGGAGCCTGAGG 0: 840
1: 89558
2: 211860
3: 237880
4: 264885
1162080724_1162080738 30 Left 1162080724 19:8216076-8216098 CCCTCTTTAAAATTGTAGCCCTG 0: 1
1: 0
2: 2
3: 24
4: 233
Right 1162080738 19:8216129-8216151 AGCACTTTGGGAGCCTGAGGTGG 0: 544
1: 63912
2: 151557
3: 157317
4: 112664
1162080724_1162080727 -10 Left 1162080724 19:8216076-8216098 CCCTCTTTAAAATTGTAGCCCTG 0: 1
1: 0
2: 2
3: 24
4: 233
Right 1162080727 19:8216089-8216111 TGTAGCCCTGCCAGGCACCGTGG 0: 1
1: 0
2: 1
3: 21
4: 283
1162080724_1162080733 18 Left 1162080724 19:8216076-8216098 CCCTCTTTAAAATTGTAGCCCTG 0: 1
1: 0
2: 2
3: 24
4: 233
Right 1162080733 19:8216117-8216139 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162080724 Original CRISPR CAGGGCTACAATTTTAAAGA GGG (reversed) Intronic
901043951 1:6384329-6384351 CATGGCTAGAATTCAAAAGATGG + Intronic
903007129 1:20306171-20306193 GAGGGGTGCAATTTTAAAGTAGG + Intronic
904727793 1:32563018-32563040 CAAGGGTACATTTTTAAAGTAGG + Intronic
906971842 1:50523433-50523455 GATGGCTATAATTTTAAAAATGG - Intronic
907256516 1:53183246-53183268 CAGGGTTGCAATTTTAGATAAGG + Intergenic
908561971 1:65315118-65315140 AAGGGCTACCATGTGAAAGAAGG - Intronic
908757432 1:67481752-67481774 CTGGGCAACATTTTTACAGAGGG - Intergenic
908901627 1:68963023-68963045 CACGGGTACAATTTCACAGAAGG - Intergenic
911889430 1:103348477-103348499 CATGGCTGCAATTTTAGATAGGG + Intergenic
912677054 1:111692499-111692521 GTGGGCTACATTTTTAGAGAGGG - Intronic
916867159 1:168872577-168872599 GAGGGCTATGATTTTAAAAATGG + Intergenic
917214546 1:172664584-172664606 CAGGTCTCCAATTTAGAAGAGGG - Intronic
917476770 1:175375526-175375548 GAGGGCAACATTTGTAAAGAGGG + Intronic
919506170 1:198400073-198400095 GAGGGTTACAATTTTAAAGCAGG + Intergenic
919694141 1:200556360-200556382 TGGAGCTACAATTTTAAAGCTGG - Intronic
920153562 1:203929558-203929580 CAGGGGTGCAATTTTAGATAGGG + Intergenic
923180046 1:231508851-231508873 CAGGGTTAGAATTTAAAAGCCGG - Intergenic
923434173 1:233952953-233952975 GAAGACTACTATTTTAAAGAGGG - Intronic
924221940 1:241886151-241886173 CAAGAATAAAATTTTAAAGAAGG + Intronic
924410639 1:243801442-243801464 CATGGATAAAGTTTTAAAGACGG + Intronic
1063194658 10:3730147-3730169 CAGGGCTGCGATTTTAAGTAGGG + Intergenic
1063438313 10:6052331-6052353 CTGAGATACAAGTTTAAAGAAGG - Intronic
1063943621 10:11156429-11156451 GAGGGCTGCAATATTAAATAAGG - Intronic
1064828189 10:19429884-19429906 CAGGGCAGGAATCTTAAAGATGG - Intronic
1066708948 10:38212265-38212287 AAGAGGTACAATTTTAAAAAGGG - Intergenic
1069416193 10:68203002-68203024 AGGGTCTACAATTTTAAATATGG + Intronic
1070266074 10:74904503-74904525 CAGGGCTAGGCTTTTAAAGGGGG - Intronic
1070501444 10:77076384-77076406 CAGGGCCAGCATTTAAAAGATGG + Intronic
1071141566 10:82515661-82515683 CAGGTCAACAATTTGGAAGAAGG - Intronic
1074406786 10:113186822-113186844 AATGGCTAAAATTTTAAAAATGG - Intergenic
1074777206 10:116775231-116775253 CAGGACTCCCATTTTACAGATGG + Intergenic
1075425445 10:122338513-122338535 CAGAGCTTCAGTTTTAAAGGTGG - Intergenic
1076313630 10:129525751-129525773 CAGGCCTGCAAATTGAAAGAAGG - Intronic
1077145856 11:1044031-1044053 AATGGCTAAAATTTTAAAAACGG - Intergenic
1078585534 11:12584073-12584095 CAGTGGTACATTTTTAATGATGG + Intergenic
1079054857 11:17196877-17196899 CAAGGATACAATTTTCAATAGGG + Intronic
1079108666 11:17590896-17590918 GTGGGTTACAATTTTAAATAGGG - Intronic
1079825211 11:25182182-25182204 CAGGGCTGCAATTTCATAGTAGG + Intergenic
1080661367 11:34298933-34298955 AAGGGCTGGAATTTGAAAGAGGG - Intronic
1085304696 11:75478481-75478503 AGGGGCTACAGTTTTACAGAAGG - Intronic
1085745711 11:79112601-79112623 CAGAGCTTCTATTTAAAAGAAGG - Intronic
1086553591 11:88083189-88083211 GAGGGGTGCAATTTTAAATAGGG - Intergenic
1086926723 11:92648728-92648750 CTGGGACACAATTTTATAGATGG - Intronic
1087511867 11:99104786-99104808 CATGGGCACAAATTTAAAGAAGG + Intronic
1088891423 11:114047702-114047724 GAGGGCAACTATTTTGAAGAGGG + Intergenic
1089162291 11:116447911-116447933 GAGGGCAACAATTTTGATGATGG + Intergenic
1091099325 11:132855592-132855614 CATGGCTAAAATGTTAAACATGG - Intronic
1092597626 12:10024579-10024601 GGGGCCTACAATTTTTAAGATGG + Intergenic
1093566959 12:20618303-20618325 CAGGGCTAAAACTCAAAAGAAGG - Intronic
1095290796 12:40478100-40478122 AGGGGCTATAATTTTAAAGAGGG - Intronic
1097267317 12:57753836-57753858 CAGGGCTACAAGTATCAGGATGG - Intronic
1097745027 12:63292034-63292056 TAGGGCTTAATTTTTAAAGAGGG + Intergenic
1100568864 12:95826588-95826610 AAGGACTACAATTCAAAAGAGGG + Intergenic
1102128997 12:110510240-110510262 CAGGGCTAACATTTTACAGAGGG - Intronic
1104176967 12:126342396-126342418 CAGGGTTACATTGTTACAGAGGG + Intergenic
1106763380 13:32890296-32890318 TAGCACTACACTTTTAAAGATGG - Intergenic
1109095675 13:58112500-58112522 CAAAGCAACAATTTTAAAAACGG + Intergenic
1109487491 13:63046425-63046447 AAGGACTTCAATTTTAAATAGGG - Intergenic
1110095183 13:71509492-71509514 CAGGGCTTAAATTGTAATGAAGG + Intronic
1111118917 13:83821133-83821155 CAGGGCTACAATCTTATAACAGG - Intergenic
1111132217 13:83992066-83992088 TAGGGCTAGAATGTTCAAGATGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1114396935 14:22372387-22372409 CAGAGATAGAATTTTAAGGATGG - Intergenic
1115190389 14:30741819-30741841 GAGGGCTATAGTTTTCAAGATGG + Intergenic
1115433618 14:33348849-33348871 CAGGGTTAGAATTTTATTGAGGG + Intronic
1115541599 14:34426383-34426405 AAGGGCTACAATATTATAGCTGG + Intronic
1116050097 14:39791676-39791698 CAATGCAACAATTTTAAATAAGG + Intergenic
1117018386 14:51542786-51542808 AATGGCTATAATTTTAAACATGG - Intronic
1118542228 14:66841249-66841271 GAGGGTTATAATTTTAAATAGGG + Intronic
1120007724 14:79379086-79379108 AAGAGGTACATTTTTAAAGAAGG - Intronic
1123103386 14:105821184-105821206 CAGAGCTACAATCTAAAAGCAGG + Intergenic
1124827556 15:33113848-33113870 CAGGGTTTCATTGTTAAAGAAGG - Intronic
1125582449 15:40795972-40795994 CAGGGCTGCAAGTGGAAAGATGG + Intronic
1126730029 15:51673206-51673228 AGGGGTTACAATTTTAAATAGGG + Intergenic
1129316974 15:74750946-74750968 CAGGGGTCCAATTTCAAAGAAGG - Intronic
1129703553 15:77781888-77781910 CAGGGCTACCATTTTGCAGATGG - Intronic
1131380270 15:91957683-91957705 CAGGGATACAACTTTACATAAGG - Intronic
1132191982 15:99872456-99872478 CAGGTGTCCAACTTTAAAGACGG - Intergenic
1134371662 16:13631687-13631709 GAGGGCTCCAAATTTAAAGGGGG - Intergenic
1135381165 16:21997307-21997329 CAGGGCTAAAATTTGAATTAAGG + Intronic
1135738613 16:24954421-24954443 CAGGGTTGCAATTTAAAATATGG + Intronic
1135817735 16:25651167-25651189 CAGGGCTGCAATTTAAATAAGGG - Intergenic
1136188156 16:28600346-28600368 CAGAGCTGCAATTTTAAATCGGG + Intergenic
1136190628 16:28613340-28613362 CAGAGCTGCAATTTTAAATCGGG + Intronic
1136318479 16:29467380-29467402 CAGAGCTGCAATTTTAAATTGGG - Exonic
1136433054 16:30206729-30206751 CAGAGCTGCAATTTTAAATTGGG - Exonic
1137342430 16:47622058-47622080 CATGGCTAAAATGTAAAAGAAGG + Intronic
1137468052 16:48729161-48729183 AAGGGCTGCATTTTTAAATAGGG - Intergenic
1137697124 16:50468817-50468839 CAGAGCCACAGTTTTAAATAGGG + Intergenic
1140979385 16:80092283-80092305 CAAGGCTACAATATGAAAGGGGG - Intergenic
1141261317 16:82456283-82456305 GAGGGCAACAATTTTAGATAAGG - Intergenic
1143060269 17:4194683-4194705 CTGGGGTACAATTTTTAAGACGG + Intronic
1143424729 17:6826122-6826144 AATGGCTACAATTAAAAAGAAGG - Intronic
1144442968 17:15300635-15300657 CAGGGCTAAAATGCCAAAGACGG + Intergenic
1144664439 17:17092306-17092328 CAGCGCTAGAATTTTAGGGAAGG + Intronic
1145242229 17:21246778-21246800 CAGGGCTGCCACTGTAAAGAGGG + Intronic
1145247747 17:21280625-21280647 GGGGGCTATAATTTTAAGGAGGG - Intergenic
1145324374 17:21788693-21788715 CAGTACAACAATTTTAAGGAGGG + Intergenic
1145355320 17:22140628-22140650 AAGGGCTTCAATTTTAAATAGGG + Intergenic
1145867811 17:28251869-28251891 CCGGGTTGCAATTTTAAACAGGG - Intergenic
1147032308 17:37649287-37649309 CAGCGCAACAAATGTAAAGAGGG + Intergenic
1149277300 17:55056143-55056165 AAGAGCTACATTTTTAAAAAAGG + Intronic
1151677756 17:75607960-75607982 CAGGGCTATGATTTTAAAAATGG - Intergenic
1155045517 18:22099956-22099978 AGGGGCTGCAATTTTAAATATGG + Intergenic
1155249907 18:23944579-23944601 CAGGGAGACTATTTTAAATAAGG + Intronic
1159485488 18:69050646-69050668 AAGTGCAACCATTTTAAAGATGG + Intronic
1161910158 19:7187418-7187440 CAGGGCTCCAATTTTTACCAAGG + Intronic
1162080724 19:8216076-8216098 CAGGGCTACAATTTTAAAGAGGG - Intronic
1162854192 19:13455695-13455717 CAGGGCTGCAATTTCAAATATGG + Intronic
1163260746 19:16188410-16188432 CAAAGCTATAGTTTTAAAGAAGG + Intronic
1164409216 19:27984596-27984618 AAGAGGTACAATTTTAAAAAGGG - Intergenic
1165078028 19:33291530-33291552 GAGGGCCACAATTATGAAGAGGG - Intergenic
1166889159 19:45979784-45979806 CTGGCCTGCAATTTTAAATAGGG + Intergenic
926293704 2:11551879-11551901 AAGTGCTACAACTTAAAAGAGGG - Intronic
926419323 2:12681530-12681552 CAGAGCTGCAATTTTAATGGAGG + Intergenic
926457427 2:13084016-13084038 AAGGGCTACAATTTTAGGGGTGG + Intergenic
927750222 2:25662360-25662382 CAGGGCTACATTTATCGAGATGG + Intronic
928343595 2:30468923-30468945 CATGGGCACAATTTTAAAAATGG - Intronic
930101090 2:47603850-47603872 AATGGTTACAATTTAAAAGATGG - Intergenic
932176055 2:69603679-69603701 TAGGTATACAATTTAAAAGATGG + Intronic
935790918 2:106589471-106589493 TGGGGCTGCAATTTTAAATAAGG + Intergenic
936754724 2:115693827-115693849 AAGCACTACCATTTTAAAGATGG - Intronic
939430210 2:142094848-142094870 CAGGGCTACAATTTTATAATTGG + Intronic
941017194 2:160370625-160370647 CAGGGCTAGAATTTGAACGCAGG + Intronic
941275498 2:163485669-163485691 CAGGGTTTAAATTCTAAAGAAGG - Intergenic
941538435 2:166751912-166751934 CATGGCCACAATTTCTAAGATGG + Intergenic
942570842 2:177312492-177312514 AATGGCTAAAATTTAAAAGATGG + Intronic
943296851 2:186151136-186151158 GATGGGTACAATTTTAAAGATGG - Intergenic
943633973 2:190285197-190285219 AAGGGCTACAAGTTGAAAAAGGG - Intronic
944089988 2:195896205-195896227 CATGGCTAAAATTTAAAAGATGG - Intronic
945636232 2:212354937-212354959 GAGTGCTACAATGTTAAATAAGG + Intronic
945856382 2:215074060-215074082 CAGGGAGAAAAATTTAAAGAAGG - Intronic
946476623 2:220012132-220012154 CAGGGCTTAAATATTAAAGATGG - Intergenic
946778125 2:223165221-223165243 CAGGGATCCAGTTTTAAATAGGG + Intronic
1169625554 20:7564469-7564491 CAAGTCAACAAATTTAAAGATGG - Intergenic
1172022016 20:31921181-31921203 CCGGCCCACAATTTTTAAGAAGG - Intronic
1172454271 20:35054912-35054934 CAGGTCTGCAATGTTTAAGATGG - Intronic
1174164767 20:48576810-48576832 CAGGTCTCAAATTGTAAAGATGG - Intergenic
1175322109 20:58095737-58095759 CAGGGCTTCAATTCTAGTGAGGG - Intergenic
1175677882 20:60962385-60962407 CAGGGTTAGAATATGAAAGATGG - Intergenic
1179978446 21:44884145-44884167 CACAGTTACAATTTTAAAGTAGG + Intergenic
1183322148 22:37171517-37171539 CAGGAGCACAATTTTAAACAAGG + Intronic
1184828524 22:46969479-46969501 CAGGGCAGCATTTTCAAAGAAGG + Intronic
949937255 3:9125627-9125649 CAGGGCAACAATTCAAAAGCTGG + Intronic
950734841 3:14998436-14998458 GATGGCTACAATGTTAAACATGG - Intronic
950936082 3:16840792-16840814 CAGTGCTACAATTTTTAATGGGG + Intronic
951241878 3:20295544-20295566 CAGCGCTACAATCATCAAGATGG - Intergenic
951843604 3:27061709-27061731 CAAAGCTGCAATTCTAAAGAAGG - Intergenic
952995254 3:38874236-38874258 CATGGCAAAAATTTTAAAGTTGG - Intronic
952995259 3:38874294-38874316 CATGGCAAAAATTTTAAAGTTGG - Intronic
959578364 3:107959538-107959560 CAGTGCAACAGTTTTAAAGGTGG - Intergenic
959589015 3:108055177-108055199 TAAGGCTACAAATTTAAAGTTGG + Intronic
960722945 3:120642455-120642477 AAGAGCTAGAATTATAAAGAAGG + Intronic
962509257 3:136082538-136082560 CAGGCCAATAATTTTTAAGAGGG + Intronic
963408620 3:144902131-144902153 CAGGAAGACAATATTAAAGAGGG - Intergenic
966982534 3:185152159-185152181 CTGGGCTGCTATTTAAAAGAAGG - Intronic
969970524 4:11042807-11042829 CTGGGTTGCAATTTTAATGAAGG + Intergenic
970159474 4:13174590-13174612 CAGTCCTACAATTTAAAAGCTGG + Intergenic
970424722 4:15935418-15935440 AATGGATACAATTATAAAGAAGG + Intergenic
970986392 4:22163824-22163846 GAGGGCTGCACTTTTAAATATGG - Intergenic
971523044 4:27579394-27579416 TCAGGCTACATTTTTAAAGAGGG - Intergenic
971734711 4:30432053-30432075 CATGGCTAAACTTTAAAAGATGG - Intergenic
973177534 4:47226285-47226307 GAGGGCTATAATTTAAAATAAGG + Intronic
975073835 4:70179443-70179465 CAGAAGTAAAATTTTAAAGAGGG - Intergenic
975593376 4:76022436-76022458 CAGTGCTACAATGAAAAAGAAGG - Exonic
976081676 4:81361733-81361755 CAGGGGTACATTTTTATTGAGGG + Intergenic
977364521 4:96050916-96050938 CAGGGCTACGATTTGAATGAAGG + Intergenic
978526449 4:109672000-109672022 CAGGGCTCCAGTTTTATACAAGG - Intronic
978859691 4:113433441-113433463 CAGAGCCACAATTTAAAAGAAGG + Intergenic
979609666 4:122675770-122675792 CAGGGTTAGAATTTTAAAATTGG - Intergenic
979870171 4:125809607-125809629 CAGGGTAAAAATATTAAAGAAGG - Intergenic
980094014 4:128471276-128471298 CAGGGCATAAAATTTAAAGAAGG - Intergenic
980499430 4:133629272-133629294 GAGGAATACAATTTTAAACAAGG + Intergenic
983518155 4:168678637-168678659 GGGGGCTGCAATTTTAAGGATGG - Intronic
984000764 4:174240451-174240473 GAGAGCTATAATTTTAAAAATGG + Intronic
984204790 4:176773543-176773565 CAGGGGAAAAATTTTAGAGAAGG + Intronic
985105309 4:186493683-186493705 CAAGGCAACAATTCTAAAGGTGG - Intronic
987009014 5:13740804-13740826 GTGGGCTAGCATTTTAAAGAGGG - Intronic
991219995 5:64202643-64202665 AATGGCTAAAATTATAAAGACGG - Intronic
991248662 5:64534775-64534797 CAGGGCTATAAATTTAAATATGG + Intronic
991406783 5:66307802-66307824 CATGGCTACTATTTTCAGGATGG - Intergenic
993098634 5:83509722-83509744 AAGGGCTGCAAGTGTAAAGAAGG - Intronic
993597798 5:89881373-89881395 CAGTCTTACAATCTTAAAGATGG - Intergenic
993693473 5:91032029-91032051 GCGGGCTGCAATTTTAAAGAAGG + Intronic
994314943 5:98322188-98322210 AAGGGATATAATTTTAAAGAAGG - Intergenic
994865622 5:105265435-105265457 TTGGGCTACAATTGAAAAGAGGG + Intergenic
996803691 5:127430866-127430888 AAGGGCTTGAATTTTTAAGAGGG + Intronic
997021264 5:130005151-130005173 AAGTGCTGGAATTTTAAAGAAGG - Intronic
997337090 5:133116014-133116036 CAGGGCTACAGTTCTTAGGAAGG + Intergenic
999847201 5:155496780-155496802 CAGAAATACAAGTTTAAAGAAGG - Intergenic
1000242958 5:159425655-159425677 GAGGGCTAGAATTATTAAGAGGG + Intergenic
1000873053 5:166601335-166601357 CAGGGCTCCTATTTGGAAGAGGG + Intergenic
1001067128 5:168544723-168544745 AATGGCCACAATTTAAAAGACGG + Intergenic
1002545153 5:179937520-179937542 AATGGCTATAATTTTAAAAAAGG + Intronic
1004504575 6:16237952-16237974 CCGGGCTTGAATTTTAAAAAAGG + Intergenic
1008166751 6:48148840-48148862 GAGGGCTACAGTTCTTAAGAGGG - Intergenic
1009304312 6:62068881-62068903 CAAAGCTACAATATTCAAGATGG - Intronic
1010838592 6:80620202-80620224 TATGGGTACAATTTTAAATAAGG + Intergenic
1010989724 6:82467299-82467321 CAGGACTTCAAATTTAAAGGTGG + Intergenic
1011548503 6:88506538-88506560 CAGGGCTAGAATTATATATAAGG + Intergenic
1012227562 6:96722150-96722172 AAGGGTTGCAATTTTAAATAGGG + Intergenic
1012643469 6:101651580-101651602 GAGGGCTACAATTTTAAATAGGG + Intronic
1012669568 6:102025594-102025616 TAGGGGTACAATTTAATAGAGGG - Intronic
1013518668 6:110912786-110912808 AAGGGCTACAATTTAAAAGATGG + Intergenic
1014117152 6:117678538-117678560 AAGGGGTACAGTTTTAAATAGGG + Intronic
1016897910 6:149072016-149072038 GATGGCTACAATTTTAAAAAGGG + Intronic
1018482675 6:164207472-164207494 TAGGTTTACAATTTAAAAGATGG - Intergenic
1018625936 6:165778710-165778732 CAGTGATACAATTTAAAAGTTGG - Intronic
1020377013 7:7499327-7499349 CAGGACAACAATTTTGAACAAGG - Intronic
1020722646 7:11767511-11767533 CAGGGTTACAGTTTTAAACAAGG - Intronic
1020865007 7:13549128-13549150 CAGAGCTACAATATCAAAAAAGG + Intergenic
1020865540 7:13556596-13556618 CAGGGCTAAAGACTTAAAGAAGG - Intergenic
1024743379 7:52379484-52379506 CATTGTTACTATTTTAAAGATGG + Intergenic
1025167233 7:56723084-56723106 GAGGGATAAAATTTTTAAGATGG + Intergenic
1027372383 7:77519743-77519765 CAGAGGTACAATTTTAAATTGGG + Intergenic
1027608585 7:80331097-80331119 CAGGGCTTCAATGTAAAAGTTGG + Intergenic
1028650455 7:93145020-93145042 CATGGCTACAATTTTCTACATGG + Intronic
1030977760 7:116148024-116148046 GAGGTCTACAAATTTAAATAGGG + Intronic
1031865335 7:127032529-127032551 CAGGGCTTCAATTTTCTATAAGG - Intronic
1031875787 7:127139403-127139425 CATGGCTCCATTTTTCAAGATGG - Intronic
1031876195 7:127143647-127143669 CAGAGCTAAAATTTTAACAAAGG + Intronic
1032406984 7:131663523-131663545 CAGGGCTCAATTTCTAAAGAAGG + Intergenic
1034165848 7:149024480-149024502 CTGGGCTTCATTTTTAAAGGTGG + Intronic
1036694067 8:10963322-10963344 CAGGGCTGCTCTTTTAAACAGGG - Intronic
1040353851 8:46596176-46596198 AAGGGCTCCACTTTTAAAAAGGG + Intergenic
1041476896 8:58277337-58277359 CAGGGCTAAAATAGCAAAGATGG + Intergenic
1041568606 8:59309867-59309889 CAGGGCTACACTTATGAAAATGG + Intergenic
1041699421 8:60771881-60771903 CTGGGGGACACTTTTAAAGAGGG - Intronic
1041985545 8:63918262-63918284 CTGGGCTGCAATTTTAGATAAGG - Intergenic
1046263853 8:111805835-111805857 GAGGGCTCCAAATTTAAAGGGGG + Intergenic
1047167081 8:122451398-122451420 AATGGTTTCAATTTTAAAGAGGG + Intergenic
1047976211 8:130133293-130133315 CAGGGCTAGCATTTTAAAAAAGG + Intronic
1048242404 8:132756029-132756051 GAGGCCTACAATTTACAAGAAGG + Intronic
1049124339 8:140773452-140773474 TGGGGCTACCATTTTAAATATGG + Intronic
1049126702 8:140795503-140795525 AAGGGATACAATTTTAAGTAAGG - Intronic
1052050594 9:23843669-23843691 CTGGGCTACAATTAGAAAGGGGG - Intergenic
1053042635 9:34887669-34887691 AAGGGATACAGTTTTAAATAAGG - Intergenic
1055501659 9:76907482-76907504 TAGGGCTAAAATTCTAAGGATGG - Intergenic
1056994991 9:91447503-91447525 GATGGCTATAATTTTAAAAATGG - Intergenic
1057177692 9:93011502-93011524 CGGGGCTCCCATTTTATAGATGG - Intronic
1057635443 9:96761268-96761290 GAGGGGTACAATTTTAAATAGGG + Intronic
1058067693 9:100567343-100567365 GAGGGTTGCAATTTTAAATAAGG - Intronic
1058321825 9:103641632-103641654 CAGAGAGACAATTTTTAAGAAGG + Intergenic
1058474276 9:105315460-105315482 CAGGACTATGACTTTAAAGAAGG - Intronic
1059103281 9:111489951-111489973 TAGGGCTACATTTTTAAAAGGGG - Intergenic
1059905177 9:118975680-118975702 AAACCCTACAATTTTAAAGAAGG - Intergenic
1187704333 X:21994220-21994242 CTGGCCTACAAATTGAAAGATGG - Intronic
1187874002 X:23788549-23788571 CAGGGCTACATTTTTATATGTGG - Intergenic
1188627442 X:32303439-32303461 CAGTGCTACATTTTTCAAGAAGG - Intronic
1190120168 X:47652509-47652531 GGGGGCTGCAATTTTAAAGAGGG + Intronic
1190801749 X:53795469-53795491 CAGGACTAGACTTTTAAAAAAGG - Intergenic
1194796978 X:98223808-98223830 TATGGCTAGAATTTTAAAAATGG - Intergenic
1196197494 X:112851514-112851536 CAGGGCTAGAGTGTTTAAGAAGG - Intergenic
1196365800 X:114922281-114922303 AAGGGGTACAATTTTAAGTAGGG + Intergenic
1196518025 X:116636640-116636662 CATGGATAGAATTTTAAAAATGG + Intergenic
1197605777 X:128583480-128583502 CAGAGCTACAATTTGAACCAAGG + Intergenic
1197828148 X:130612745-130612767 CTGGGCTACAATTTTTATCAAGG + Intergenic
1198576860 X:138020073-138020095 GATGGCTACAATTTAAAAAATGG - Intergenic
1198613096 X:138423876-138423898 AAGGGCTACAATTATAAATGTGG + Intergenic
1199685870 X:150264873-150264895 GATGGCTATAATTTTAAAAAAGG + Intergenic