ID: 1162085113

View in Genome Browser
Species Human (GRCh38)
Location 19:8244032-8244054
Sequence GTGAACCCAGTGTCATCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 861
Summary {0: 1, 1: 6, 2: 47, 3: 191, 4: 616}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162085113 Original CRISPR GTGAACCCAGTGTCATCACA AGG Intronic
900585241 1:3429473-3429495 GAGAGCCCAGGCTCATCACATGG - Intronic
900726920 1:4222604-4222626 GTGGGCTCAATGTCATCACAGGG + Intergenic
902275804 1:15338465-15338487 GTGGACCCAATGTCATCACATGG - Intronic
902562491 1:17286439-17286461 ATGAGCCCAGTGTCATCGCAAGG - Intergenic
902610343 1:17593458-17593480 GTGGGCCCAGTGGCACCACAAGG + Intronic
903033865 1:20481908-20481930 ATGAACACAGTGCCAGCACATGG - Intergenic
903041744 1:20535909-20535931 GTGGGCCTGGTGTCATCACAGGG + Intergenic
903565545 1:24262638-24262660 GTGGACCCAATGTAATCACCAGG - Intergenic
904849769 1:33448502-33448524 GTAGGCCCAGTGTAATCACAAGG + Intergenic
905336106 1:37245605-37245627 GTGGGCCCAAAGTCATCACAAGG + Intergenic
905470806 1:38190333-38190355 GTGGTCCCAATGTAATCACATGG - Intergenic
906646225 1:47477402-47477424 GTGGGCCCAGTGTAATCACAAGG - Intergenic
907548642 1:55285404-55285426 GTGGACCCTATGTAATCACAAGG + Intergenic
908268106 1:62397887-62397909 GTGCCCCCAGTGTCATCACAAGG + Intergenic
908347112 1:63245372-63245394 GTGAACACTGTGTCCTCACATGG + Intergenic
908759379 1:67498012-67498034 GTGGGTCCAGTGTAATCACAGGG + Intergenic
908779015 1:67671467-67671489 GTGGATTCAGTGTCTTCACATGG - Intergenic
909410474 1:75344515-75344537 GTGAGCCCAATGTGATCACAAGG + Intronic
909679572 1:78276948-78276970 GTGGGCCCAATGTAATCACAAGG + Intergenic
910079067 1:83317755-83317777 GTAAGCCCAATGTAATCACAAGG - Intergenic
910107925 1:83651588-83651610 ATGAACACTGTGTCCTCACATGG - Intergenic
910211828 1:84801286-84801308 TTGACTCCATTGTCATCACATGG - Intergenic
911026049 1:93436082-93436104 GGGGGCCCAATGTCATCACAAGG - Intergenic
911536686 1:99108381-99108403 ATGCACTCAGTGTAATCACAAGG + Intergenic
911684935 1:100764840-100764862 GTGATCCCAGTGTCATGATCTGG + Intergenic
911722105 1:101202694-101202716 GTGGGCCCAATGTAATCACAAGG - Intergenic
911724148 1:101224003-101224025 GAGAACACTGTGTCCTCACATGG - Intergenic
911742756 1:101404920-101404942 GTGCGCCCAATGTAATCACAAGG - Intergenic
911844177 1:102728416-102728438 GAGAACACTGTGTCTTCACATGG - Intergenic
912336030 1:108863728-108863750 GTGAGCCCAGTGTAATCACAAGG - Intronic
912708436 1:111932137-111932159 GTGGGCCCAGTGTAATCACAAGG - Intronic
914408466 1:147401510-147401532 ATGAGCCCAGTGTAATCACAAGG - Intergenic
914415703 1:147479517-147479539 GTAGACCCAATGTAATCACAAGG - Intergenic
915647522 1:157284353-157284375 GGGAACACTGTGTCCTCACATGG + Intergenic
915912007 1:159921300-159921322 ATGAGCCCAGTGTAATCACAAGG + Intronic
916267056 1:162901109-162901131 GTGGATCTAGTGTAATCACAGGG - Intergenic
916295974 1:163220771-163220793 GTGGGCCCAATGTCATCACAAGG + Intronic
916378270 1:164179939-164179961 GTGAACCCAATGCAATCACAAGG - Intergenic
916632624 1:166633055-166633077 GTGGGCCCAGTGTAATCACAGGG + Intergenic
917007991 1:170436928-170436950 GTGGGCCCAGTGTAATCATAGGG + Intergenic
917171138 1:172176140-172176162 GTAAACCCAGTGTAATCATAGGG + Intronic
917418105 1:174832657-174832679 GTGTGCCCACTGTCAGCACATGG - Intronic
918057268 1:181032849-181032871 GTGGACCCAGTGTAATCAGAGGG - Intergenic
918370542 1:183857096-183857118 GTGAGCCCAGAGTAATCACAAGG + Intronic
918442048 1:184577177-184577199 GTGGACACAGTATAATCACAAGG + Intronic
918574041 1:186034073-186034095 ATGAACCCAATGTAATCATAAGG + Intronic
919086981 1:192932136-192932158 GTGGGCTCAGTGTCATCAAAGGG - Intergenic
919159123 1:193805766-193805788 ATGAACACTGTGTCCTCACATGG + Intergenic
919160289 1:193821191-193821213 GTGAACCCAATGTAATCACAAGG + Intergenic
919462445 1:197893999-197894021 ATGAACACTGTGTCTTCACAAGG + Intergenic
920258922 1:204675609-204675631 GTGGGCCCAGTGTAATCACATGG - Intronic
921664686 1:217854515-217854537 GTGTTCCCAGTACCATCACAGGG - Intronic
922027412 1:221763697-221763719 GTGAACACTGTGTCCTCACATGG + Intergenic
922519335 1:226234804-226234826 GTGAACCCTGTGGCATTAGATGG - Intronic
922613736 1:226948360-226948382 GTGGGCCCAATGTAATCACAAGG - Intronic
922785760 1:228281565-228281587 GAGAACCCATGGTCATCACAGGG - Intronic
923038181 1:230300282-230300304 GTGGGTGCAGTGTCATCACAAGG - Intergenic
923195689 1:231664509-231664531 GTGAACCCAATGTAATCATAGGG + Intronic
923832842 1:237577444-237577466 GGGAAGCCAATGTCATCACAAGG + Intronic
924718322 1:246599562-246599584 GTGGACCCAGTGTAATCACAAGG - Intronic
1062959251 10:1560409-1560431 GTGCACCCTGGGTCATCACGAGG + Intronic
1063041129 10:2338367-2338389 AGGAACCCTGTGTCCTCACATGG + Intergenic
1063600052 10:7473002-7473024 TGGGACCCAGTGTAATCACAAGG - Intergenic
1064210657 10:13358172-13358194 GTGAGCTCAATGTCATCACAAGG + Intergenic
1064532160 10:16321703-16321725 GTGAGCCCAGTGTCATCAGAAGG + Intergenic
1064561386 10:16598209-16598231 GTGGGCTCAGTGTCATCAAAAGG + Intronic
1064576184 10:16748418-16748440 GTGAGCCCGGTGTAATCACAAGG - Intronic
1064722565 10:18244855-18244877 GTGGGCACAGTGTAATCACAAGG + Intronic
1064864680 10:19866472-19866494 GTGGGCCTAGTGTAATCACAAGG - Intronic
1064897097 10:20249604-20249626 GTGAGCCCAATGTAGTCACAAGG - Intronic
1064982534 10:21179064-21179086 GAGGATCCAGTGTAATCACAAGG + Intergenic
1065193845 10:23241649-23241671 GTGGGCCCAATGTAATCACAAGG + Intergenic
1066317171 10:34259525-34259547 TTGGGCCCAGTGTAATCACAAGG - Intronic
1067309846 10:45102474-45102496 GTGAGCCCAATGTAATCACAGGG - Intergenic
1067455315 10:46414987-46415009 GTGTACCCAGTGTAACCACAGGG + Intergenic
1067631889 10:47969648-47969670 GTGTACCCAGTGTAACCACAGGG - Intergenic
1068112325 10:52694574-52694596 GTGAACCCAGTGTAATCAAAAGG - Intergenic
1068554241 10:58440185-58440207 CTGGGCCCAATGTCATCACAGGG - Intergenic
1070342874 10:75513774-75513796 GTGGGCCTAGTGTAATCACAAGG - Intronic
1070471209 10:76781439-76781461 ATGGACCCAGTGTAATCATAGGG - Intergenic
1071398889 10:85250135-85250157 GTGAACACAGCGTCCTCACATGG + Intergenic
1071533292 10:86405633-86405655 GTGATCCCAGTATAATCAGAAGG - Intergenic
1071724308 10:88181123-88181145 ATGGGCCCAGTGTAATCACATGG + Intergenic
1071737025 10:88312209-88312231 GTGGGCCCAATGTCATCACAAGG + Intronic
1071919057 10:90329041-90329063 GAGAACACAATGTCACCACAGGG + Intergenic
1072257308 10:93632184-93632206 GTGGACCCAATGTAATTACAAGG - Intronic
1072863575 10:99032908-99032930 GTAGATCCAGTGTAATCACAAGG - Intronic
1073298489 10:102455999-102456021 GTGGACCCAATGTAATCACAAGG + Intergenic
1073629718 10:105136269-105136291 TTGAACACTGTGTCCTCACATGG + Intronic
1073719287 10:106148343-106148365 GAGAACCCAGTGTCATCAAGAGG - Intergenic
1073888698 10:108071523-108071545 GTGGGCCCATTGTAATCACAGGG - Intergenic
1073960311 10:108919249-108919271 GTGAACCTAGTGAGCTCACAGGG - Intergenic
1073975891 10:109100739-109100761 ATGAGCCCAGAGTAATCACAAGG + Intergenic
1074498456 10:114000771-114000793 GTGGACCCCATGTAATCACAAGG - Intergenic
1074806935 10:117063331-117063353 GTGATCCCAGTTTCAGCACCAGG + Intronic
1074851817 10:117445209-117445231 GGGGACCCTGTGTAATCACAAGG - Intergenic
1075015914 10:118909916-118909938 GTGAGCCCAGTGTAATCCCAGGG + Intergenic
1075030465 10:119021311-119021333 GTGAACCCAGTGGGACCACCAGG + Intergenic
1075173550 10:120138355-120138377 GCGAGCCCTGTGTAATCACAGGG + Intergenic
1075350957 10:121724974-121724996 TTGAACACTGTGTCCTCACATGG + Intergenic
1075476628 10:122740954-122740976 GTGGGCCCAATGGCATCACAAGG - Intergenic
1075607237 10:123820840-123820862 GTGAGTCCAATCTCATCACATGG - Intronic
1075682823 10:124344418-124344440 GTGGGCTCAATGTCATCACAAGG - Intergenic
1075849286 10:125574212-125574234 GTGCTCCCAAAGTCATCACAGGG - Intergenic
1076071343 10:127492434-127492456 GTAGACCCAATGTAATCACAAGG - Intergenic
1076207284 10:128613260-128613282 ATGGGCCCAATGTCATCACAAGG - Intergenic
1076408797 10:130231418-130231440 GGGAGCCCAGTGGTATCACAAGG - Intergenic
1076563541 10:131382635-131382657 GTGGGCCCAGTGTAATCACCAGG - Intergenic
1077012025 11:383276-383298 GAGGGCCCAGTGTCATCGCAGGG - Intergenic
1077928089 11:6702454-6702476 GTGGGCCCAATGTAATCACAAGG + Intergenic
1078178090 11:8985741-8985763 GGGAGCCCAGTGTGATCACTAGG + Exonic
1078578611 11:12521680-12521702 GTGGTCCCAATGTCATCACAGGG + Intronic
1078821049 11:14882536-14882558 GTGAGCCCAGTGTCATGCCCAGG - Intronic
1079340652 11:19609014-19609036 GTGGGCCCAGTGTAATCACAAGG - Intronic
1079429408 11:20374621-20374643 GTGGGCCCAATGTAATCACAAGG - Intronic
1080403882 11:31961415-31961437 GTGAACTCAGTGTAATCACAAGG - Intronic
1080728317 11:34918943-34918965 ATGAGCCCAATGTAATCACAAGG - Intronic
1080788709 11:35499893-35499915 GTGGAACCAATGTAATCACAAGG + Intronic
1081286509 11:41276739-41276761 GTACACCCAATGTAATCACAAGG + Intronic
1081314788 11:41618870-41618892 ATGAACACTGTGTCCTCACATGG - Intergenic
1081337086 11:41880082-41880104 GTGAACACTATGTCCTCACATGG - Intergenic
1081407940 11:42719655-42719677 ATGAACTCTGTGTCCTCACATGG + Intergenic
1081598006 11:44472604-44472626 GTGGATCCATTGTAATCACAAGG + Intergenic
1081844835 11:46232873-46232895 GTAAGCCCAGTGCAATCACAAGG + Intergenic
1082627645 11:55503449-55503471 GTGAACCAAGTGTCATCAGCAGG - Intergenic
1082941354 11:58708626-58708648 ATGAACACTGTGTCCTCACATGG - Intronic
1083389285 11:62336307-62336329 GTGGGCCCAATGTCATCCCAAGG + Intergenic
1084158347 11:67328974-67328996 ATGAACTCTGTGTCTTCACATGG + Intronic
1084443312 11:69188551-69188573 CTTGGCCCAGTGTCATCACAGGG + Intergenic
1084641773 11:70430523-70430545 GTGGACCCAATGTAATCACAAGG - Intronic
1084683506 11:70680540-70680562 GTGGGCCCTGTGCCATCACAGGG - Intronic
1085168132 11:74423261-74423283 GTGGCACCAGTGTAATCACAAGG + Intergenic
1085278077 11:75312667-75312689 GTGGGCCCAATGTCATCACAAGG + Intronic
1085772952 11:79340957-79340979 GTGGGCCCAGTGTAATTACAAGG + Intronic
1086255640 11:84873164-84873186 GTAAGCCCAATGTAATCACAAGG + Intronic
1087110350 11:94459984-94460006 GTGGGCCCAGTGTAATCATAAGG + Intronic
1087489919 11:98812244-98812266 TTGAACCCTGTATCCTCACATGG + Intergenic
1088129379 11:106468674-106468696 GGGAACCCAGTGGCATCCTAGGG + Intergenic
1088252918 11:107877218-107877240 GGGATCCCTGTGTCCTCACAGGG + Intronic
1089121755 11:116140938-116140960 GTGGACCCAGTGTAATCACAAGG - Intergenic
1089162705 11:116451845-116451867 GTGAACCCTATATAATCACAGGG - Intergenic
1089216851 11:116839350-116839372 GTGGGCCCATTGTCATCACAGGG + Intergenic
1089635602 11:119809662-119809684 GTGGACCCAGGGTAGTCACAAGG - Intergenic
1090229714 11:125092787-125092809 GTGGACCCAGTGGAATCAAAGGG + Intergenic
1090693799 11:129215686-129215708 GTGAGCCCAAGGTAATCACACGG - Intronic
1092519974 12:9260581-9260603 GTGGGCCCAATGTAATCACAAGG + Intergenic
1092845371 12:12579994-12580016 GTGGACCCAATATAATCACAAGG - Intergenic
1092863950 12:12743742-12743764 GTGGACCCAATGTAATCACAAGG + Intronic
1093364671 12:18278411-18278433 TTGGACCCAGGGTAATCACAAGG - Intronic
1093558241 12:20504807-20504829 GTGGGCCCAATGTTATCACAAGG - Intronic
1093585708 12:20833176-20833198 GTGAATCCATTGTAATCACAAGG - Intronic
1093695476 12:22155400-22155422 GTGGGCTCAGTGTAATCACAGGG - Intronic
1093908601 12:24720689-24720711 GTGGGCCCAGTGTCATCACAAGG + Intergenic
1095161785 12:38926229-38926251 TTGAAGCAAGTGTCATAACATGG - Intergenic
1095270635 12:40214627-40214649 GTGAACGTTGTGTCTTCACATGG - Intronic
1095301755 12:40592521-40592543 GTGGGCCCAATGTAATCACAAGG + Intergenic
1095739927 12:45595582-45595604 GTGGGCCCAGTGTAATCACAAGG - Intergenic
1095865652 12:46969199-46969221 GTGGGCCCAGTGTAGTCACAAGG - Intergenic
1095906877 12:47387785-47387807 ATGGACCCAATGTCATCACCAGG + Intergenic
1096501124 12:52064327-52064349 CTGACCCCAGTGGCGTCACAGGG - Intergenic
1096524346 12:52201659-52201681 GTGGGCCCAGTGTCATCACTAGG + Intergenic
1097436361 12:59554784-59554806 CTGGACCTAGTGTAATCACAAGG - Intergenic
1097805510 12:63960713-63960735 GTGGGCCCAGTGTAATCACAAGG + Intronic
1098205581 12:68105915-68105937 GTGGGCCCAATGTCCTCACAAGG + Intergenic
1098415064 12:70224190-70224212 GGGAACCCAGTGTTATGCCAAGG - Intergenic
1099784597 12:87244787-87244809 GTGGACCCAGTGTAATCACAAGG + Intergenic
1100108354 12:91206116-91206138 GTGGACTCAATGTAATCACAAGG - Intergenic
1100333800 12:93610695-93610717 ATGAACACTGTGTCTTCACATGG - Intergenic
1100523540 12:95399299-95399321 ATGGGCCCAGTGTAATCACAAGG + Intergenic
1100677715 12:96886346-96886368 GTGGTCCCAATGTCATCACAAGG - Intergenic
1100685379 12:96981973-96981995 GTGAGCCCAATGTAATCACAAGG + Intergenic
1100700100 12:97138215-97138237 GTGGGCCCAATGTAATCACAAGG - Intergenic
1101187383 12:102293319-102293341 GCAAGCCCAGTGTAATCACAAGG + Intergenic
1101339182 12:103826384-103826406 GTGGACCCAATGTAATCACAAGG + Intronic
1101451134 12:104780262-104780284 GTGAGCCCAGTGTCAAACCAAGG - Intergenic
1101540488 12:105660536-105660558 GTGAACTCTGTGTCCTCACATGG + Intergenic
1101740831 12:107498694-107498716 GTGGGCCCAATGTTATCACAAGG - Intronic
1101818406 12:108163588-108163610 GTGGTCCCACTGTCATCGCAAGG + Intronic
1102150307 12:110685149-110685171 GTGGACCCAATGTCATCAGAGGG + Intronic
1102391137 12:112549647-112549669 GTGGACTCAATGTAATCACAAGG - Intergenic
1102418722 12:112787132-112787154 GTGAATCCAATGTAATCACAAGG - Intronic
1102451049 12:113042427-113042449 GTAAGCCCAGTGTCATCACAAGG + Intergenic
1102495409 12:113315885-113315907 GTGGGCCCAGTGTCATCACAGGG - Intronic
1102525275 12:113508169-113508191 GTGAGCCCAGTGTCATCACAAGG + Intergenic
1102919564 12:116781669-116781691 GTGGGGCCAGTGTCATCACAGGG - Intronic
1102975061 12:117200909-117200931 GTGGATCCAGTGTCATCCCAAGG + Intergenic
1103605901 12:122085971-122085993 GTGAGCCTGGTGTAATCACAGGG + Intronic
1103862606 12:124026543-124026565 GTGGCCCCTGTGTCATCATAAGG - Intronic
1103970816 12:124670328-124670350 GTGGGCCCAAGGTCATCACAAGG - Intergenic
1104091740 12:125523445-125523467 GTGGGCCCCATGTCATCACAAGG - Intronic
1104485482 12:129148391-129148413 GGTAGCCCAATGTCATCACAAGG + Intronic
1104607995 12:130203936-130203958 GTGGACCCGATGTCATCACGGGG + Intergenic
1104954326 12:132457110-132457132 GTGGGCCCAGTGCAATCACAAGG + Intergenic
1105532593 13:21233227-21233249 GGGAACACAGTGACATCCCAGGG + Intergenic
1106155794 13:27154799-27154821 GTGAGCCCTATGTAATCACAAGG + Intronic
1106690069 13:32105284-32105306 TTGAACACTGTGTCCTCACATGG - Intronic
1106724885 13:32473817-32473839 GTGGGCCCAGTGTTATCACAAGG - Intronic
1106775340 13:33003295-33003317 GTGAGTCCAGTGTAATCACAGGG - Intergenic
1107556224 13:41518703-41518725 GTGAGCCCAGTGGAATCACAAGG - Intergenic
1107653569 13:42569219-42569241 GTGGGCCCAATGTAATCACAAGG + Intronic
1108374182 13:49797949-49797971 ATGAACACTGTGTCCTCACATGG - Intergenic
1108374187 13:49797980-49798002 ATGAACACTGTGTCCTCACATGG - Intergenic
1108949676 13:56075329-56075351 GTGGGCCCAATGTCATCACAAGG - Intergenic
1109394373 13:61736382-61736404 ATGGGCCCAGTGTAATCACAAGG - Intergenic
1109466953 13:62747153-62747175 GTGAGTCCAGTGTAATCACAAGG + Intergenic
1109973440 13:69800188-69800210 ATGAGCCCATTGTAATCACAAGG - Intronic
1110157036 13:72329913-72329935 ATGAACACTGTGTCCTCACAAGG + Intergenic
1110408369 13:75176120-75176142 GTGGACCCAATGTAAACACAAGG + Intergenic
1110849011 13:80223127-80223149 TTGGGCCCAATGTCATCACAAGG - Intergenic
1110894118 13:80727712-80727734 GTGAACCCACTGTCATTAGATGG + Intergenic
1111025144 13:82510702-82510724 GTTGACCTAGAGTCATCACAGGG + Intergenic
1111482416 13:88848399-88848421 GTGAGACCAATGTAATCACAGGG + Intergenic
1111603193 13:90500798-90500820 GTGAGCCCAGTCTAATCACATGG - Intergenic
1111754143 13:92371397-92371419 GTGGGCCCAGTGTAATCATATGG + Intronic
1111797476 13:92941262-92941284 GTGAGCCCAGTATAATCACAAGG + Intergenic
1112149176 13:96737958-96737980 GTAAACCTAATGTAATCACAAGG - Intronic
1112225644 13:97537267-97537289 GTGAACCCAGTTTCAACAGTTGG - Intergenic
1112379339 13:98873656-98873678 GTGAACCCAGTTAGATCAAAAGG + Intronic
1112587171 13:100729292-100729314 GTGGGCCCAGTGTAATGACAAGG + Intergenic
1112715681 13:102182108-102182130 GTGGGCCCAGTGTAATCACATGG + Intronic
1112748237 13:102552217-102552239 GTGGGCCCAGTGTAATCACAAGG - Intergenic
1113283320 13:108815372-108815394 ATGGGCCCAGTGTAATCACATGG + Intronic
1113525429 13:110971229-110971251 AGGAACCCTGTGTCCTCACATGG + Intergenic
1114345902 14:21794799-21794821 GTGGACTCAGTCTAATCACATGG + Intergenic
1114959051 14:27860123-27860145 GTGCTCCCTCTGTCATCACATGG + Intergenic
1115341198 14:32294707-32294729 GTGGGCCCACTGTAATCACAAGG - Intergenic
1115373874 14:32651607-32651629 GTGAACTCTGTGTCCTCACATGG + Intronic
1115901108 14:38149116-38149138 GTGGACCCAATGGAATCACATGG + Intergenic
1116110230 14:40569845-40569867 GAGAGCCCAATGTAATCACAAGG + Intergenic
1116539520 14:46082145-46082167 GTGGACCCAGTATAAACACAGGG + Intergenic
1116721251 14:48498562-48498584 GTGAGCCCAATATTATCACAAGG + Intergenic
1116739753 14:48739378-48739400 GTGGGCCCAGTGCAATCACAAGG - Intergenic
1117540593 14:56743077-56743099 GAGAACCCAGTATCATGCCATGG + Intergenic
1117794633 14:59379673-59379695 GTGGGCCCGGTGTAATCACAAGG + Intergenic
1118447385 14:65864032-65864054 GTGTGTCTAGTGTCATCACAGGG - Intergenic
1119206142 14:72794985-72795007 GTGAGTCCAGTGTAATCACAAGG - Intronic
1119277478 14:73371773-73371795 AGGAACACAGTGTCTTCACATGG - Intronic
1119647219 14:76356597-76356619 GTGACCCCACTGACCTCACATGG + Intronic
1119722365 14:76899829-76899851 GTGAGCTCAATGTAATCACAAGG + Intergenic
1120219833 14:81719572-81719594 GTGGACCCAATGTAATCCCAAGG - Intergenic
1120395588 14:83963266-83963288 CTGCACCCAATGTCCTCACATGG + Intergenic
1120499349 14:85275242-85275264 GTGAGTCCAATGTAATCACAAGG - Intergenic
1120558693 14:85962527-85962549 GTGAGCTCAATGTCATCACTTGG + Intergenic
1120567887 14:86081982-86082004 GTGGACCCAATGTAATCACCAGG - Intergenic
1120697952 14:87665369-87665391 GTGGACACAATGTAATCACAAGG + Intergenic
1120721346 14:87892652-87892674 TTGAACACTGTGTCCTCACATGG + Intronic
1120761569 14:88290173-88290195 GTGGGTCCAGTGTAATCACAAGG + Intronic
1121102672 14:91260903-91260925 GTGGACCCAGTGTCATCACAAGG + Intergenic
1121290797 14:92773367-92773389 GTGGGCCCAATGTAATCACAAGG - Intergenic
1121716999 14:96083502-96083524 GGGAGCTCAATGTCATCACAAGG + Intronic
1121720231 14:96104151-96104173 GTGGGCCCAATGTCATCACAAGG + Intergenic
1121856631 14:97276315-97276337 GTGGACCGGATGTCATCACAAGG + Intergenic
1121864123 14:97346617-97346639 GTAAGCCCAATGTAATCACAAGG + Intergenic
1121902230 14:97704106-97704128 ATGAGCCCAATGTAATCACAAGG - Intergenic
1122020813 14:98836456-98836478 GTGGGCCCAATGTCATCACAAGG - Intergenic
1122034315 14:98936381-98936403 GTGGGCCCAGTGTCATCACAAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122135671 14:99631532-99631554 GTGTACCCAGTGTCCACACAAGG - Intergenic
1122363349 14:101180361-101180383 GTGAGCCCAGTGAGATCGCAGGG + Intergenic
1122414469 14:101542265-101542287 GTGGGCCCAGTGTCATCACAAGG + Intergenic
1122753575 14:103958548-103958570 GTGGGCCTAATGTCATCACAGGG + Intronic
1122994702 14:105256771-105256793 GTGAACCCAGTACCAGGACAAGG + Intronic
1123218943 14:106839185-106839207 GGGAACCCAGTCTCGTCGCAGGG + Intergenic
1123449789 15:20352428-20352450 GTGAACCCAGTGGCATGACAAGG - Intergenic
1123453021 15:20385266-20385288 ATGAACCCAATGTAATCTCAAGG + Intergenic
1124007045 15:25802769-25802791 GTGGGCCCAGTGTAATCACAAGG - Intronic
1126051864 15:44693509-44693531 GTACGCCCAGTGTAATCACAGGG - Intronic
1127761130 15:62140054-62140076 GCGAGCCCAGTGTAATCACGAGG - Intergenic
1128498912 15:68213820-68213842 GTGCTCCCAGTGACATCTCAGGG + Intronic
1128612518 15:69085290-69085312 GTGGGCCCAGTGTAATCACAAGG + Intergenic
1128878868 15:71224834-71224856 GTGGGTCCAGTGTAATCACAAGG - Intronic
1128929451 15:71691015-71691037 GTGAGTCCAGTGTAACCACAAGG + Intronic
1129460730 15:75698895-75698917 GTGACCCCAGTGTCATCACTGGG - Intronic
1129724135 15:77893145-77893167 GTGACCCCAGTGTCATCACTGGG + Intergenic
1129795101 15:78370116-78370138 GTGAGCCCAATGTGATCACAGGG + Intergenic
1130221872 15:82026299-82026321 GTGGACCCACTGTAATCACAAGG - Intergenic
1130801877 15:87273108-87273130 GTGAGCCCAATGTAATCACAAGG + Intergenic
1131297833 15:91167615-91167637 GTGAGCCAAGTGTAATCACAGGG - Intronic
1131454527 15:92572666-92572688 GTGAGCTTACTGTCATCACAGGG + Intergenic
1131621081 15:94068803-94068825 GTAGACCCAGTGTAATCACAAGG + Intergenic
1131771502 15:95742805-95742827 GTGGGCCCAATGTAATCACAAGG - Intergenic
1132029636 15:98429331-98429353 GTGGGCCCAGTGTGATCACAAGG - Intergenic
1132319258 15:100913535-100913557 GCAGACCCAGTGTAATCACAAGG - Intronic
1133652891 16:7829626-7829648 TTTAGCCCAGTGTAATCACAGGG - Intergenic
1134237681 16:12480450-12480472 GTGAGCCCAGTGTGATCACAGGG - Intronic
1134661253 16:15986290-15986312 GTGGGCCCAATGTAATCACAGGG - Intronic
1134680301 16:16120351-16120373 GAGAGCGCAGTGTCCTCACATGG + Intronic
1135341461 16:21651660-21651682 GTCAACCCCCTGCCATCACATGG + Intronic
1135353087 16:21746460-21746482 GTGGGCCCAATGTAATCACAAGG + Intronic
1135408255 16:22213858-22213880 GTGAGCCCAGTGTAATCACAAGG - Intronic
1135451574 16:22562583-22562605 GTGGGCCCAATGTAATCACAAGG + Intergenic
1135492919 16:22925361-22925383 CTGAACGCTGTGTCCTCACACGG - Intergenic
1135624175 16:23981349-23981371 ATGAGCCCAGTGTGATCACAGGG - Intronic
1135925088 16:26686969-26686991 GTGGACCCAGTGTCATCACAAGG - Intergenic
1136087594 16:27896647-27896669 GTTGGCCCAGTGTAATCACAAGG + Intronic
1136533455 16:30885177-30885199 ATGGGCCCAGTGTCATCACAGGG + Intronic
1137504953 16:49046315-49046337 GTGGGCCCAGTGTAATCACAAGG - Intergenic
1138174793 16:54886975-54886997 GTGAACTGAGTGTAATCACAAGG - Intergenic
1140575283 16:76160553-76160575 ATGGGCCCAGTGTAATCACAGGG - Intergenic
1140632069 16:76865101-76865123 GTGGACCCAATGTAATTACAGGG - Intergenic
1140713209 16:77697240-77697262 GTGGGCCCATTGTAATCACAAGG + Intergenic
1140758294 16:78088672-78088694 GGGAGTCCAGTGTAATCACAGGG - Intergenic
1141066149 16:80915670-80915692 GTGGTCCCAGTGTAATCACAAGG - Intergenic
1141079000 16:81034654-81034676 ATGGGCCCAATGTCATCACAGGG + Intergenic
1141138489 16:81482198-81482220 GTGAGCCCAGTGTAACCACAGGG - Intronic
1141145866 16:81529634-81529656 GGGGGGCCAGTGTCATCACAGGG + Intronic
1141190665 16:81822432-81822454 GTGGATCCAGTGTGTTCACAGGG + Intronic
1141263358 16:82473815-82473837 GTGAACCTAATGTAATCACAAGG - Intergenic
1141267616 16:82511203-82511225 GTGAACCCAATGTAAGCACAGGG - Intergenic
1141315589 16:82959619-82959641 GTGAACCCAATGCAATCACAAGG - Intronic
1141317295 16:82974633-82974655 GTGGGCCCAGTATAATCACAAGG + Intronic
1141452074 16:84111167-84111189 GTGGGCCAGGTGTCATCACAAGG + Intronic
1141487387 16:84349781-84349803 GTGGGTCCAATGTCATCACAAGG + Intergenic
1141570582 16:84931209-84931231 GCGAGCCCAATGTCATCACAGGG - Intergenic
1141919998 16:87129239-87129261 GTGGTCCCAGTGTCATCACAAGG - Intronic
1141978667 16:87535566-87535588 GTGGCCCCAATGTCATCACAGGG - Intergenic
1142066393 16:88065400-88065422 GTGGGCCCAGTGTCATCGCGGGG - Intronic
1143348202 17:6266012-6266034 GTGACCCCAGTATACTCACAAGG - Intergenic
1143366355 17:6411147-6411169 GTGGGCCCAGTGTAACCACAAGG + Intronic
1143606078 17:7987006-7987028 GTGGACCCAGTGGCTTCACCAGG - Intergenic
1143813117 17:9488507-9488529 GTGGGCCCAATGTCATGACAAGG + Intronic
1145732929 17:27206226-27206248 GTGGGCCCAATGTAATCACAAGG - Intergenic
1145792237 17:27634688-27634710 GTGGTCCCAATGTGATCACAAGG - Intronic
1145807128 17:27742569-27742591 GTGGTCCCAATGTGATCACAAGG - Intergenic
1146456114 17:33011128-33011150 GTAGGCCCAGTGTCATCAAAAGG + Intergenic
1146461904 17:33052734-33052756 GTGAACTCACTGTTAGCACATGG - Intronic
1146515235 17:33483908-33483930 GTGGGCCCAGTGGTATCACAGGG + Intronic
1147020355 17:37526784-37526806 GTGACCCCAATGTCATCACATGG - Intronic
1148705843 17:49631388-49631410 GTGTACCCAGTTTCCTCCCATGG - Intronic
1149588143 17:57807441-57807463 GTGAGCCCAATGTAATCACATGG + Intergenic
1150883605 17:69059352-69059374 GTAGACCCAGTGTAATCACAAGG + Intronic
1150998555 17:70347555-70347577 ATAAACCCAATGTCCTCACATGG + Intergenic
1151867389 17:76813093-76813115 GTGGGCCCAGTGTCATCATGGGG + Intergenic
1151875473 17:76865731-76865753 GTGAACACAGGGGCATCACAGGG + Intergenic
1152211799 17:79006341-79006363 GGGAGCCCAGTGTAATCACAGGG - Intronic
1152338852 17:79713462-79713484 GTGAACCCAATGGCATTACAAGG + Intergenic
1152539620 17:80968421-80968443 GGGGGCCCAGTGTAATCACAAGG - Intergenic
1153517617 18:5918787-5918809 GTGGTCCTAGTGTCATCACAAGG + Intergenic
1153577711 18:6539378-6539400 GAGAACCCAGTGATAGCACAGGG + Intronic
1153789431 18:8564248-8564270 GTGGGCCCAGTGTCATTACAGGG + Intergenic
1153809971 18:8743729-8743751 GTGGACCCAATGCCATCATAGGG - Intronic
1153922695 18:9805504-9805526 GTGGGCCCAGTGTCCTCACAAGG - Intronic
1153939667 18:9967409-9967431 GTGGGCCCAGTGTCATCGCAGGG - Intergenic
1155344764 18:24847396-24847418 GTGGACCCAATGTAATCACAAGG + Intergenic
1155561262 18:27079900-27079922 GTGGACTCCATGTCATCACAAGG - Intronic
1157211174 18:45743213-45743235 ATGGACCCAATGTAATCACAAGG - Intronic
1157328000 18:46682725-46682747 GGGAGTCCAGTGTCATCACAAGG + Intronic
1157428994 18:47607968-47607990 GTGGGCCCAATGCCATCACAAGG - Intergenic
1157434879 18:47659864-47659886 GTGGGCCCAGTGTAATCACCTGG - Intergenic
1157436883 18:47677883-47677905 ATGAATCCTGTGTCCTCACATGG + Intergenic
1157870418 18:51225371-51225393 CTGGGCCCAGTGTAATCACAAGG + Intergenic
1158868261 18:61659023-61659045 GTGGACCCAATGTAATCACAAGG + Intergenic
1158888751 18:61853726-61853748 TTGAGCCCAATGTAATCACAGGG - Intronic
1158968190 18:62642190-62642212 GTGGGCCCAATGTAATCACAAGG + Intergenic
1159582828 18:70251679-70251701 GTGAATCCAATATAATCACAGGG + Intergenic
1159796442 18:72849982-72850004 GAGGACCCAGTGTAATTACAAGG - Intronic
1159871862 18:73767459-73767481 GTGGTCCCAATGTGATCACAGGG - Intergenic
1160057913 18:75503011-75503033 GAGTAAACAGTGTCATCACAAGG + Intergenic
1160325655 18:77945136-77945158 GTGGACCCAGTGTCATCACAGGG - Intergenic
1160782852 19:885466-885488 GGGGCCCCAGTGTCCTCACAGGG + Intronic
1160840294 19:1143732-1143754 GGAGACCCAGTGTCCTCACAGGG - Intronic
1160984502 19:1832074-1832096 GGGAACCCAGTGTCCTCACAGGG + Intronic
1161031683 19:2060678-2060700 GGGAGCCCAGTGTCCTCACAGGG + Intergenic
1161116946 19:2502671-2502693 GTAGGCCCAATGTCATCACAGGG - Intergenic
1161117198 19:2504325-2504347 GAGTCCCCAGTGTCCTCACAGGG + Intergenic
1161339177 19:3731309-3731331 GGGGGCCCAGTGTCACCACAGGG + Intronic
1161503318 19:4629761-4629783 ATAAACCCAGTGCAATCACAGGG - Intergenic
1161589396 19:5122300-5122322 GGGAACCCAGGGTCCTCACCGGG - Intronic
1161638995 19:5407885-5407907 GTGAATCCAACGTCATCACAGGG - Intergenic
1162085113 19:8244032-8244054 GTGAACCCAGTGTCATCACAAGG + Intronic
1162254054 19:9473225-9473247 TTAAACCCAGTGTCATCTCTTGG - Exonic
1165152346 19:33768205-33768227 GTGAACCTAGTGTCCCCACTAGG - Intronic
1165593961 19:36996037-36996059 GTGGGCCCAGTGTAATCACAAGG + Intronic
1167192528 19:48001472-48001494 ATGGACCCAATGTCATCACAAGG - Intronic
1167285723 19:48597981-48598003 GTGGGCTCAGTGTCATCACCTGG - Intronic
1167490521 19:49790339-49790361 GTGGACCCAATGTCATCACAGGG - Intronic
1167767402 19:51492611-51492633 GTGGGCCCAGTGGAATCACAGGG + Intronic
1168010532 19:53527469-53527491 GTGGGCCCAATGTAATCACAGGG + Intronic
1168455288 19:56502787-56502809 GTGAAGGCACTGTAATCACATGG + Intergenic
1168660492 19:58161998-58162020 GTGGGCCCAGTGTATTCACAAGG - Intergenic
925077082 2:1025715-1025737 GAGGGCCCAGTGTCATCACAGGG - Intronic
925241562 2:2335311-2335333 GGGAACCCATTTTCATTACAGGG + Intergenic
925719426 2:6813192-6813214 GTGACCCCCGTGTTTTCACAAGG - Intergenic
925768746 2:7262357-7262379 GTGAGCCCAATGCAATCACAAGG - Intergenic
925994893 2:9284042-9284064 ATGAGGCCAATGTCATCACAAGG - Intronic
926077901 2:9956856-9956878 GTACACCTAGTGTTATCACACGG - Intronic
926482290 2:13414158-13414180 ATGAACCCAATGTAATCTCAAGG - Intergenic
926776673 2:16430205-16430227 GTGAGCCCAAGGGCATCACAAGG + Intergenic
927042477 2:19243562-19243584 GTGGGCCCAATGTAATCACAAGG + Intergenic
927523706 2:23718925-23718947 GTGGGCCCAGTGTAATCACAAGG - Intergenic
927710304 2:25321430-25321452 GTGGGCCCAGTGTAATCAGAAGG - Intronic
927828679 2:26329045-26329067 GTGGGCCCAATGTAATCACAAGG + Intronic
927922777 2:26986239-26986261 GTGGGCCCAGTGTAATCACCAGG - Intronic
928251607 2:29686029-29686051 GTTGACCCAGTGGAATCACAGGG - Intronic
928285039 2:29982770-29982792 GTGGGCCCAGTGTAATCAGAAGG + Intergenic
928650765 2:33401271-33401293 GTGGGCCCAATGTAATCACAAGG + Intergenic
928686875 2:33759152-33759174 GTGATCCCAGTGTAGTTACAAGG + Intergenic
929055012 2:37869129-37869151 GTGAGCTCAATGTAATCACAAGG - Intergenic
929426659 2:41851029-41851051 ATGAACCCAGGGTCAAAACATGG - Intergenic
929488981 2:42379821-42379843 GTGGGCTCAGTGTAATCACAGGG - Intronic
930331979 2:49996557-49996579 GTGGGCCCAGTGTAATGACAAGG + Intronic
930551241 2:52837265-52837287 GTGAACTCAGTCTAATCATATGG - Intergenic
930603166 2:53465455-53465477 GTGGGCCCAATGTAATCACAAGG - Intergenic
930978622 2:57494855-57494877 GAAAGCCCAGTGTAATCACAAGG + Intergenic
932558658 2:72848057-72848079 GTGAGCCCAGTGTAATCACAGGG - Intergenic
932942946 2:76190593-76190615 TTGGACCCCGTGTAATCACAGGG - Intergenic
933218184 2:79654564-79654586 GTGAGCCCATTGTAATCACAAGG - Intronic
933298976 2:80521532-80521554 GTGGGCCCAATGTAATCACAAGG + Intronic
933407004 2:81873336-81873358 GTGGGCCCAATGTAATCACAAGG - Intergenic
933717956 2:85375966-85375988 GTGGGCCCAATGTCATCAGAAGG - Intronic
934061480 2:88298137-88298159 ATGAACCCAATCTAATCACATGG - Intergenic
934082703 2:88483125-88483147 GTGGGTCCAGTGTAATCACAAGG - Intergenic
934166990 2:89302830-89302852 CTCAAACCAGTGTAATCACAAGG + Intergenic
934478292 2:94608420-94608442 GTGCTCCCTCTGTCATCACATGG - Intergenic
934764606 2:96873732-96873754 GAGAACCCAGTGTCCACCCAGGG - Intergenic
935326548 2:101942889-101942911 GTAAACCCAATGCAATCACAAGG + Intergenic
935478677 2:103557944-103557966 GAGAACACTGTGTCCTCACATGG + Intergenic
936506099 2:113108511-113108533 GTGGACCCAATCTAATCACAAGG - Intronic
936593815 2:113828835-113828857 ATGGGCCCAGTGTAATCACAAGG - Intergenic
936924386 2:117721719-117721741 GTGGACCCAGTGTAATCACAGGG + Intergenic
937059397 2:118970485-118970507 CTGAACCCAGAGTCCCCACATGG + Intronic
937113297 2:119384192-119384214 ATGGACCCGGTGTAATCACAAGG + Intergenic
939141386 2:138358642-138358664 ATGAACCCCATGTCATCAAAAGG + Intergenic
939410698 2:141820977-141820999 GTGGGCCCAATATCATCACAAGG + Intronic
939422796 2:141995445-141995467 GTGGGCCCAATGTAATCACAGGG - Intronic
939649266 2:144741684-144741706 GTGGACCCAATGTAATCACGAGG + Intergenic
940180133 2:150922950-150922972 GTGAGCCCAATGTAATTACAAGG + Intergenic
940341704 2:152588375-152588397 ATGGGCCCAATGTCATCACAAGG - Intronic
940557097 2:155243099-155243121 GTAAACCCAATGTAATCACAAGG - Intergenic
940763534 2:157764634-157764656 GTGAAAGCAGTGTCAGCACTTGG + Intronic
941170223 2:162126992-162127014 GTGGGCCCAATGTAATCACAGGG + Intergenic
941356909 2:164504838-164504860 GTGGGCCCACTGTAATCACAAGG + Intronic
941678558 2:168370757-168370779 GTGAGCCCAGTGTAATGTCAAGG + Intergenic
943075739 2:183191947-183191969 GTTGTCCCAGTGTGATCACAAGG + Intergenic
943097179 2:183443568-183443590 ATGAACCTTGTGTCCTCACATGG + Intergenic
943116815 2:183683072-183683094 GTGGGCCCAATGTAATCACAAGG + Intergenic
943187745 2:184634452-184634474 GTGGGCCCAATGTAATCACAAGG + Intronic
943257860 2:185619138-185619160 ATGGACCCAGTGTAATCCCAAGG + Intergenic
943779783 2:191810452-191810474 GTGGGCCCAGTGAAATCACAAGG - Intergenic
943956529 2:194199016-194199038 GTGGGCCCAGTATAATCACAAGG + Intergenic
944659629 2:201910581-201910603 GTGGGCCCAATGTTATCACAGGG + Intergenic
944877414 2:203976225-203976247 GTGGGCCCAGTGTAATCACAAGG + Intergenic
944944583 2:204668853-204668875 GTGGGCTCAGTGTAATCACAGGG + Intronic
945121629 2:206463245-206463267 GTGGGCCCAGTGTAATCACAAGG + Intronic
945352343 2:208796096-208796118 GTGGGCCCAATGTAATCACAAGG + Intronic
946055040 2:216893638-216893660 GTGGGCCCAGTGTAATCACAAGG + Intergenic
946425094 2:219590385-219590407 GTGGGCCCAGTGTAATCACAAGG + Intergenic
946473021 2:219980582-219980604 GTGGGCCCAATGTAATCACAAGG + Intergenic
946842018 2:223828720-223828742 GTGGACACAGGGTCATTACATGG + Intronic
947402767 2:229744916-229744938 ATGAACGCTGTGTCTTCACATGG + Intergenic
947584811 2:231348190-231348212 GTGGACCCAATGTAATCACAAGG + Intronic
947814591 2:233027874-233027896 ATGAACACTGTGTCCTCACATGG + Intergenic
947944505 2:234090061-234090083 GTGGACCCAATGTAACCACAAGG - Intergenic
947995606 2:234524682-234524704 GAGAACACTGTGTCCTCACATGG - Intergenic
948435195 2:237948536-237948558 GTGGGCCCAATGTCGTCACAAGG - Intergenic
948442570 2:238004754-238004776 GTGGACCCAGTGTAATTACAGGG + Intronic
948510539 2:238461329-238461351 GTTGGCCCAGTGTCATCACAGGG - Intergenic
948667816 2:239547089-239547111 GGGAAACCAGTGGCATCACAGGG + Intergenic
948667832 2:239547147-239547169 GGGAAACCAGTGGCATCACAGGG + Intergenic
948667848 2:239547205-239547227 GGGAAACCAGTGGCATCACAGGG + Intergenic
949010357 2:241674848-241674870 GTGGGCCCAGTGTCATCACAGGG - Intergenic
1169401931 20:5289418-5289440 GTGCACCCATTGTACTCACAAGG - Intergenic
1169409597 20:5356359-5356381 GTGGACCCACTGTAATCACAAGG + Intergenic
1169499477 20:6145646-6145668 GTGTGACCAGTGTCACCACAAGG + Intergenic
1170063457 20:12285166-12285188 GTGAGCCCAATGTAATCACAAGG - Intergenic
1170132347 20:13034324-13034346 GTGTCCCCAGTGTCTACACATGG - Intronic
1170309477 20:14976472-14976494 GTGGGCCCAGTGTTATCACATGG - Intronic
1171156567 20:22879997-22880019 GACAGCCCAGTGTAATCACAAGG - Intergenic
1171394797 20:24825098-24825120 ATGAACGCAGTGTCCTCACATGG + Intergenic
1171726251 20:28623877-28623899 GGGAACACTGTGTCCTCACATGG + Intergenic
1172862022 20:38061989-38062011 GAGGGCCCAGTGTAATCACAGGG + Intronic
1172933726 20:38603937-38603959 GTGGGCCCAATGTCATCACAAGG - Intronic
1173204967 20:40985700-40985722 CTGGGCCCAGTGTAATCACAAGG - Intergenic
1173281967 20:41636703-41636725 GTGGGCCCAGTGTAATCCCAAGG + Intergenic
1174062626 20:47843452-47843474 GTGGGCCCAGTGTAATCACAGGG + Intergenic
1174073010 20:47912043-47912065 GTGGGCCCAGTGTAATCACAGGG - Intergenic
1174151052 20:48486598-48486620 CTGGGCCCAGTGTAATCACAGGG + Intergenic
1174303008 20:49595710-49595732 CGTGACCCAGTGTCATCACAAGG - Intergenic
1174433557 20:50489099-50489121 GTGGGCCCAGTATAATCACAGGG - Intergenic
1174552906 20:51374474-51374496 GTAGACCCAGTGGAATCACAAGG - Intergenic
1174627895 20:51930355-51930377 GTGGGCCCAATGTAATCACAAGG - Intergenic
1174723417 20:52837516-52837538 GTGAACAGACTGTCCTCACAGGG + Intergenic
1174821644 20:53731525-53731547 ATGAACACAGGGTCCTCACATGG - Intergenic
1174856479 20:54050219-54050241 GTGGACCCAGTGTGATCACAAGG - Intronic
1175124465 20:56741058-56741080 GAGGAGCCAGTGTCATCACAAGG - Intergenic
1175182657 20:57159583-57159605 GTGAGCCCCATGTCATCACAGGG + Intergenic
1175294502 20:57899122-57899144 GTGAGTACAGTGTAATCACAGGG - Intergenic
1175495984 20:59414587-59414609 GTGGGCCCAATGTCATCACAAGG - Intergenic
1175698757 20:61122382-61122404 GTGGTCCCAGTGTCCTCATAGGG - Intergenic
1175942352 20:62543306-62543328 GTGGGCCCAGTGTCCTCACAGGG - Intergenic
1175958249 20:62622293-62622315 GTGAGCCCAGTATAATCACCAGG + Intergenic
1176878173 21:14156273-14156295 GTGGACCCAATGTAATCACAAGG + Intronic
1177003583 21:15643244-15643266 GTGAGCCCAGTGTAATCAGGAGG - Intergenic
1177179221 21:17726898-17726920 GTGACCCCAGTTTCCTCACCAGG + Intergenic
1177327939 21:19616681-19616703 AGGAACCCTGTGTCCTCACATGG - Intergenic
1177770733 21:25512782-25512804 GTGGGCCCAGTGTCATCACAAGG + Intergenic
1178020645 21:28404481-28404503 GTGAGCCCAGTGCAATCACAAGG - Intergenic
1178234064 21:30821638-30821660 GCAAACCCAGTGTCATCACAAGG + Intergenic
1179008520 21:37534958-37534980 ATGGAGCCAGTGTCATCACAAGG + Intergenic
1179169482 21:38961921-38961943 GTGGGCCCAGTGTAATCACAGGG - Intergenic
1179224209 21:39439085-39439107 GTGGACCTAATGTAATCACATGG + Intronic
1179287032 21:39986305-39986327 GTGAATGCTGTGTCCTCACATGG - Intergenic
1179596786 21:42448338-42448360 GTGGGCCCAGTGTCAACACAAGG - Intergenic
1179722309 21:43322735-43322757 GTGAGCCCAGGGTCATCGCGAGG + Intergenic
1179943000 21:44651637-44651659 GTGGGCCCAGTGTCTCCACAGGG - Intronic
1181753529 22:25006845-25006867 CTGAGCCCAATGTCATCACAAGG - Intronic
1181975715 22:26727930-26727952 GTGAACTCTGTGTCCTCACATGG + Intergenic
1182266490 22:29119916-29119938 GTGAGACCAATGTAATCACAGGG + Intronic
1183207332 22:36428495-36428517 GTGGGCCCAATGTAATCACAGGG - Intergenic
1183260116 22:36789359-36789381 GTGTTCCCAGAGTCTTCACAGGG - Intergenic
1183412100 22:37660860-37660882 GTAAACCCAGTGTTATGGCATGG + Intronic
1183436182 22:37796831-37796853 GTGGGCCCAGTGGAATCACAAGG - Intergenic
1183453652 22:37909938-37909960 GTGAACCCAGTGTTGGCCCAGGG + Intronic
1184618039 22:45651428-45651450 GTGGGCCCAATGTAATCACAGGG + Intergenic
1184745616 22:46454056-46454078 GTGGCCCCAAAGTCATCACAAGG + Intronic
1184894134 22:47397279-47397301 GGGTGCCCAGTGTCATCAAAGGG - Intergenic
1185336539 22:50273095-50273117 GGGAACCCAATGTCATTTCAGGG + Intergenic
949164867 3:927636-927658 GTGAGTCCAGTGTAATCACATGG + Intergenic
949204129 3:1417595-1417617 GTGGACCCAATGTAGTCACAAGG + Intergenic
949420713 3:3862941-3862963 GTGGGCCCAATGTAATCACAAGG + Intronic
949438580 3:4056037-4056059 GTGGGCCCAATGTAATCACAAGG - Intronic
950500045 3:13358063-13358085 ATGAAACCAGCGTCCTCACAGGG + Intronic
950550587 3:13663737-13663759 GTGGGCCCAATGTGATCACAAGG - Intergenic
950882525 3:16334847-16334869 GTGTGCCCAGTATAATCACAGGG + Intronic
952196822 3:31084603-31084625 GTGGGCCCAGTATAATCACAGGG + Intergenic
953551032 3:43903213-43903235 GTAGAACCAATGTCATCACAAGG + Intergenic
954286834 3:49625317-49625339 CTGCACCCAGTGTCACAACAAGG + Exonic
954732012 3:52672272-52672294 GTGGGTCCAGTGTAATCACAAGG - Intronic
954924316 3:54218899-54218921 GTGGACTCAGTGTAGTCACAAGG - Intronic
955137477 3:56233912-56233934 GTGAGCCCAATGTAATTACAGGG - Intronic
956380572 3:68660595-68660617 GTGGGCCCAATGTCATCACAAGG + Intergenic
956512748 3:70012357-70012379 GTGGGCTCAATGTCATCACAAGG + Intergenic
956585974 3:70865422-70865444 GTGGAACCACTGTAATCACAAGG - Intergenic
956775505 3:72562134-72562156 GTGAGACCAATGTAATCACAAGG + Intergenic
956974601 3:74565428-74565450 TTGGGCCCAGTGTGATCACAAGG - Intergenic
957252329 3:77789128-77789150 ATGAACGAAGTTTCATCACATGG + Intergenic
957510766 3:81184913-81184935 GTGGGCCCAATGTAATCACAGGG + Intergenic
957978418 3:87476114-87476136 GTGGGCCCAATGTAATCACAAGG - Intergenic
958009928 3:87864094-87864116 GTGAGCCCAATGTAATCATAAGG - Intergenic
958476514 3:94590848-94590870 GTGGACCCAATGTAATCACATGG - Intergenic
958635831 3:96744480-96744502 GTGGTCCCAATGTAATCACAAGG - Intergenic
959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG + Intergenic
959908004 3:111731694-111731716 GTGGGCCCAGTGTAATCACAGGG - Intronic
960359714 3:116697131-116697153 GTGGGCCCAGTGTAATCACAGGG + Intronic
960556839 3:119039429-119039451 GTGGGCCCAGTGTAATCACGAGG - Intronic
961353992 3:126322495-126322517 GTGGATCCAGCGTAATCACAAGG - Intergenic
962071805 3:132041515-132041537 ATGAACGCAGTGTCCTCACATGG + Intronic
962614887 3:137115698-137115720 ATGAACACTGTGTCTTCACATGG - Intergenic
962644974 3:137429312-137429334 GTGGGCCCAGTGTAATCGCAGGG - Intergenic
963443813 3:145375284-145375306 TTGAACCCAGTGTAGTCCCAAGG + Intergenic
963678525 3:148345426-148345448 GTGAACCTTGTGTCCTCACATGG - Intergenic
963826353 3:149958469-149958491 GTGAGCTCAATGTGATCACAAGG - Intronic
963847380 3:150172866-150172888 ATGAACACTGTGTCCTCACAGGG - Intergenic
963963074 3:151332094-151332116 GTGAAAGCAGTGTGATCAGAAGG + Intronic
964441055 3:156710595-156710617 GTGGGCCTAGTGTAATCACAAGG + Intergenic
964479514 3:157127737-157127759 GGGAGTCCAATGTCATCACAAGG - Intergenic
964609001 3:158589950-158589972 GTGGGCCCAATGTAATCACAAGG - Intronic
964654927 3:159055697-159055719 GTGAACCCAATGTAATTACAAGG - Intronic
965106813 3:164366864-164366886 TTGAATCAAATGTCATCACAGGG + Intergenic
965245573 3:166262735-166262757 GTGAGCCCAATGTAATCACAAGG - Intergenic
965636566 3:170788134-170788156 GTGGGCCCAGTGTAATCACAAGG + Intronic
965897754 3:173598312-173598334 GTAACAGCAGTGTCATCACAAGG - Intronic
966001858 3:174958611-174958633 GTGAAACAAGTGCCAGCACAAGG + Intronic
966427004 3:179790369-179790391 GTGAGACCAATGTAATCACAAGG - Intergenic
967209933 3:187159377-187159399 GATAACCCAGTGACATCAGATGG - Intronic
968067778 3:195768219-195768241 GTGAAAGCAGTGTAATCAAAGGG + Intronic
968805027 4:2766738-2766760 GTGATCCCAATGTCATCACAGGG + Intergenic
969072821 4:4553047-4553069 GTGGGCCCAATGTCATGACAGGG - Intergenic
969309058 4:6341672-6341694 ATGGGCCCAATGTCATCACAAGG + Intronic
969342750 4:6552617-6552639 GTAGGCCCAATGTCATCACAGGG - Intronic
969474768 4:7415501-7415523 GTGGGCCCAGTGTCACCCCAGGG - Intronic
969497510 4:7534585-7534607 ATCAGCTCAGTGTCATCACAGGG + Intronic
969726596 4:8921819-8921841 GGTGGCCCAGTGTCATCACAGGG - Intergenic
969833347 4:9817152-9817174 GTAAACCCAATGTCCTCATAAGG - Intronic
969843888 4:9904465-9904487 GTGAGCCCAATATTATCACAGGG - Intronic
969863137 4:10053291-10053313 GTGGATCCACTGTCATCACAAGG + Intronic
970268896 4:14321538-14321560 GTGGGCCCAGTATAATCACAAGG - Intergenic
970588161 4:17534174-17534196 GTGGACCAAGTATAATCACAAGG - Intergenic
970886653 4:20994039-20994061 GTGGGCCCAATGTAATCACAAGG - Intronic
970965857 4:21927201-21927223 GTGGGCCCAGTCTGATCACATGG - Intronic
971551076 4:27956110-27956132 GTGAATCTAATGTAATCACAAGG + Intergenic
972388018 4:38586546-38586568 GTGGGCCCAGTGGAATCACAAGG - Intergenic
972842555 4:42948742-42948764 ATGGACCCAGTGTAATAACATGG + Intronic
973184657 4:47311461-47311483 GTGGGCCCAATGTAATCACAAGG + Intronic
973226532 4:47791162-47791184 GTGAGCCCAATGTAATCACAAGG + Intronic
973334070 4:48938324-48938346 GTGGACCCAATGTAATTACAAGG + Intergenic
973538726 4:51911945-51911967 GTGAAGCCAGAGTCATCTTACGG - Intronic
974181931 4:58395657-58395679 TTGAGCTCAGTGTAATCACATGG - Intergenic
974478486 4:62414674-62414696 GTGAACATTGTGTCCTCACATGG - Intergenic
975566081 4:75755843-75755865 GTGGACCCAGTGTTATCACAGGG + Intronic
975597251 4:76060649-76060671 GTGGACCCACTGTAATAACATGG + Intronic
976626871 4:87194238-87194260 ATGAACACTGTGTCCTCACATGG - Intronic
976763962 4:88579800-88579822 GTTAACCCAATGTAATCACCAGG + Intronic
976830719 4:89310549-89310571 GTGGACCCCATGTCATTACAGGG - Intergenic
977457313 4:97277728-97277750 GTGTGCCCAATGTAATCACAAGG + Intronic
977677637 4:99765381-99765403 GTGGGCCCAGTGTAATCACAAGG - Intergenic
978352400 4:107833794-107833816 GTGAGCCCAGTGTAATCACAAGG + Intronic
978630110 4:110734359-110734381 GTGGACCCAATGTAATCACAAGG - Intergenic
979344549 4:119571369-119571391 GTGGGCCCAATGTAATCACAAGG + Intronic
979502697 4:121458258-121458280 GTATGCCCAGTGTAATCACAAGG + Intergenic
979616420 4:122747694-122747716 GAGAACACTGTGTCTTCACATGG - Intergenic
981107628 4:140899240-140899262 CTGAACCAAGTGTCACCATAAGG + Intronic
981356456 4:143794916-143794938 GTGGGCCCAGTGTAACCACAGGG - Intergenic
981661756 4:147175544-147175566 GTGGGCCCAGTGGAATCACAGGG + Intergenic
981912436 4:149997156-149997178 GTGAGCCTAATGTAATCACAAGG + Intergenic
982359149 4:154500145-154500167 GTGGACCCAATGTAATCCCAGGG + Intergenic
982438208 4:155401812-155401834 GTGGGCCCAGTGTAGTCACAGGG + Intergenic
982491670 4:156038252-156038274 GGGAACCCAGTGAGCTCACAGGG - Intergenic
982788748 4:159566086-159566108 GTGAACACAGTGGCTTCCCATGG - Intergenic
983045441 4:162981374-162981396 GTGGGCCCAGTGTAATCACAAGG - Intergenic
984113491 4:175648827-175648849 ATGGGCCCAGTGTAATCACAAGG - Intronic
984379127 4:178967914-178967936 GTGGACCCAATGTAATCACAGGG + Intergenic
984459163 4:180010998-180011020 GTGAGCCCAATATAATCACAAGG - Intergenic
984523756 4:180831673-180831695 GTGAATGCTGTGTCCTCACATGG + Intergenic
984874097 4:184352204-184352226 GTGGGCCCAGTGTAGTCACAGGG - Intergenic
985116157 4:186593546-186593568 GTGGGCCCAGTGTAATCATAAGG + Intronic
986085981 5:4447355-4447377 GTGGACCCAATGTGACCACAAGG + Intergenic
986304823 5:6507225-6507247 GTGGGCCCAGTGTCAGCCCAAGG + Intergenic
986649904 5:9953043-9953065 GTGGCCCCCGTGTAATCACAGGG - Intergenic
986658904 5:10041637-10041659 GTGGGCCCAGTGTTATCCCAAGG - Intergenic
986769348 5:10957724-10957746 GTGGACCCAGTGTAATCAGAAGG + Intergenic
986846640 5:11764056-11764078 TTGAGCCCAGTGTAATCACAGGG + Intronic
987030577 5:13973085-13973107 GTGGGCCCAATGTAATCACAAGG + Intergenic
987180966 5:15368123-15368145 ATGGGCCCAATGTCATCACAAGG + Intergenic
987413590 5:17639367-17639389 GTGAACTCAGGGCCTTCACAGGG - Intergenic
987520535 5:18976777-18976799 GTGAGCCCTGTATAATCACACGG - Intergenic
988075078 5:26341940-26341962 GTGGACCCAATGTAATCACAAGG + Intergenic
988303706 5:29467489-29467511 GTGAACCTAATGTAATCATAAGG + Intergenic
988472361 5:31551582-31551604 GTGGGCCCAGTGTAATCACAAGG + Intronic
988579091 5:32453592-32453614 GTGGACCCAATGCAATCACAAGG - Intergenic
988794069 5:34636086-34636108 GTGAACTCTGTGTCCTTACATGG + Intergenic
988874084 5:35424698-35424720 GCGGGCCCAGTGTAATCACAAGG + Intergenic
988915082 5:35883963-35883985 GTGGACCCAGTGTAATCACAAGG - Intergenic
989114541 5:37939647-37939669 GTGAGCCCAGTGTAAAGACAAGG - Intergenic
989116452 5:37958520-37958542 GTGAACCCAGTGTAATCACAAGG - Intergenic
989626168 5:43431352-43431374 GTGGGCCCAGTCTAATCACATGG + Intergenic
989674674 5:43959830-43959852 GTGGATCCAATGTTATCACAGGG - Intergenic
989987089 5:50713738-50713760 TTGAGCCCAGTGTCATCACATGG + Intronic
990737309 5:58878403-58878425 GTGGGCCCAATGTCATCAGAAGG + Intergenic
990865350 5:60373926-60373948 GTGGGCCCAGTGTAATCACAAGG - Intronic
991221368 5:64223275-64223297 GTAGACCCAATGTAATCACAAGG - Intronic
991599321 5:68336685-68336707 GTGAAATCAATGTAATCACAAGG + Intergenic
991657176 5:68915761-68915783 ATGTACCAAATGTCATCACACGG + Intergenic
992031177 5:72722915-72722937 GTGGGCCCAATGTGATCACAAGG + Intergenic
992541378 5:77768021-77768043 CTGAACACTGTGTCTTCACATGG - Intronic
993013549 5:82510538-82510560 GTGGACCCAATGTAATCCCAGGG - Intergenic
993342500 5:86741651-86741673 GTAGACCCAATGTAATCACAGGG + Intergenic
993791089 5:92212179-92212201 GTGTGCTCAGTGTAATCACAAGG - Intergenic
994953671 5:106498762-106498784 GTGAGCCCAGTGTGATCCCAGGG - Intergenic
995979953 5:118089360-118089382 GTGAGCCCAATGTAATTACAAGG + Intergenic
996140138 5:119897062-119897084 GCGAGCCCAGTGTAATCACCAGG - Intergenic
996351816 5:122552117-122552139 CTGAGCTCAGTGTAATCACATGG + Intergenic
996848601 5:127928471-127928493 GTGGACCCAATGTAATCACAAGG - Intergenic
997081423 5:130744003-130744025 GAGAAAGCAGTGTCATCAGAAGG - Intergenic
997113186 5:131097698-131097720 GTGGGCCCAATGTAATCACAAGG - Intergenic
997120591 5:131168785-131168807 CTGGACTCAGTGTAATCACAAGG - Intronic
997262314 5:132474643-132474665 GTGGGCCCAGTGTAATCACAAGG - Intronic
997588831 5:135060777-135060799 GAGGGCCCAGTGTAATCACATGG - Intronic
998039283 5:138942088-138942110 GTGGGCCCACTGTAATCACAGGG + Intergenic
998639568 5:143994549-143994571 GTGACCACACAGTCATCACAAGG + Intergenic
998743444 5:145229968-145229990 ATGAACCCGGTGTCATCAATCGG - Intergenic
999711499 5:154322434-154322456 GTGGTCCCAATGTAATCACAAGG - Intronic
1000017437 5:157290462-157290484 GGGAGCCCAGTGTAAACACAAGG - Intronic
1000035660 5:157445751-157445773 GTGGACCCAATGTAATCACAAGG - Intronic
1001218281 5:169876177-169876199 GTGGGCCCAGTGTAATCACAAGG - Intronic
1001307713 5:170587716-170587738 GTGAACCTGATGTAATCACAAGG - Intronic
1001815594 5:174666605-174666627 GTGAGCCCGATGTTATCACAGGG - Intergenic
1001907338 5:175484084-175484106 CTGTTCCCAGTGTCAGCACAAGG + Intronic
1001907551 5:175485507-175485529 GTTGGCCCAATGTCATCACAAGG - Intronic
1002438018 5:179245096-179245118 ATGGGCCCAGTGTAATCACAAGG + Intronic
1002582171 5:180215552-180215574 GTGAGCCCAGCGTAATCACAGGG + Intergenic
1002824066 6:756819-756841 GTGGGCCCAGTATAATCACAGGG + Intergenic
1002949104 6:1790963-1790985 GTGGACCCAATGTCATCAAAGGG + Intronic
1002993307 6:2257896-2257918 GGGAACACTGTGTCCTCACATGG - Intergenic
1003389673 6:5702893-5702915 GTGAACACAGTGACATCCCAGGG - Intronic
1003699287 6:8444376-8444398 GTGAGCCCAGTGTAATCACAAGG - Intergenic
1003757873 6:9142460-9142482 GTGGGCCCAATGTAATCACAAGG - Intergenic
1003897326 6:10620003-10620025 GTGAGCCAAATGTAATCACAAGG - Intronic
1005275390 6:24211556-24211578 GTGAACTCAATATAATCACAAGG + Intronic
1005604834 6:27466048-27466070 GTGAGCCTAGAGTAATCACAAGG + Intronic
1005849013 6:29804861-29804883 ATGAATGCAGTGTCCTCACAAGG - Intergenic
1006913872 6:37582279-37582301 GTGGGCCCAGTGTCATCACAAGG + Intergenic
1007695287 6:43728501-43728523 GTGAACACACAGTCATCACTCGG + Intergenic
1008141713 6:47839565-47839587 GTGGACCCAATTTAATCACAAGG - Intergenic
1008602517 6:53109949-53109971 GTGGGCCCAATCTCATCACATGG - Intergenic
1009572438 6:65404252-65404274 GTGGATCCAGTGTAATCACAAGG - Intronic
1009763134 6:68034825-68034847 GGGAATCCTGTGTCCTCACATGG - Intergenic
1010150154 6:72721992-72722014 GTGGGCCAAGTGTCATCAAAAGG + Intronic
1010321701 6:74518052-74518074 GTGGGCCCAATGTAATCACAGGG + Intergenic
1010582799 6:77620089-77620111 GTAACCCCAATGTCATTACAGGG - Intergenic
1010760302 6:79714857-79714879 GTGGGCCCAGTGTAATCACAGGG - Intergenic
1011362104 6:86538499-86538521 ATGGACCCAGTGTAATCACCAGG - Intergenic
1013055375 6:106577721-106577743 GTGGGCCCAGTGTAATCTCAGGG + Intronic
1013722568 6:113048530-113048552 CTGGTCCCAATGTCATCACAAGG - Intergenic
1013754186 6:113441673-113441695 ATGAGCCCAGTGTAATCACAAGG - Intergenic
1013817161 6:114112262-114112284 GTGGGCCCAGTGTAATCTCATGG + Intronic
1014018537 6:116562687-116562709 GTGGGCCCAATGTAATCACAAGG + Intergenic
1014187884 6:118456596-118456618 GTGGGCCCAAGGTCATCACAAGG + Intergenic
1014336446 6:120142560-120142582 TTGAACCCTGTGTCCTCACCTGG - Intergenic
1014708855 6:124782514-124782536 GTGTTCCCATTGTCATCACTGGG + Intronic
1016166929 6:140957579-140957601 GTGAAGGAAGTGACATCACATGG - Intergenic
1016469976 6:144364933-144364955 GTGTGCCCAGTGAAATCACAAGG - Intronic
1016879925 6:148900999-148901021 GTGAGTCCAATGTAATCACAAGG - Intronic
1017165960 6:151408673-151408695 GTAAGCCCAATGTAATCACAAGG + Intronic
1017326502 6:153146682-153146704 GTGAACCCAATCTAATGACATGG + Intergenic
1018225634 6:161626139-161626161 GTGCACACAGTGTCAGGACAGGG + Intronic
1020933835 7:14434380-14434402 GTGAGCCAAATGTAATCACAAGG + Intronic
1021386517 7:20037577-20037599 GTGAATCTAGTGTAATCACAAGG + Intergenic
1022448067 7:30486113-30486135 GTGGGCCCAATGTAATCACAAGG + Intergenic
1022486549 7:30783330-30783352 GTGGGCCCAATGTAATCACAGGG - Intronic
1022917395 7:34971976-34971998 GTGGACCCAATGTAACCACAGGG + Intronic
1023344418 7:39256635-39256657 GTGGACTCAATGTAATCACAAGG + Intronic
1023672619 7:42593995-42594017 ATGGGCCCAGTGTAATCACAAGG + Intergenic
1024094696 7:45974413-45974435 GAGAACCATGTGTCAGCACATGG - Intergenic
1024338800 7:48236659-48236681 GTGAGCCCAGTGTAACCACAAGG - Intronic
1024496674 7:50056425-50056447 GTGGGTCCAGTGTAATCACAGGG - Intronic
1025026168 7:55517960-55517982 GTGAACCCAGTGTGGTGCCAAGG - Intronic
1025231823 7:57207691-57207713 GTGGGCCCAGTGTAATCACAGGG - Intergenic
1025928252 7:65975950-65975972 CTGAAGCCAGGGTCACCACATGG + Intronic
1026613593 7:71882323-71882345 GTGGCCCCAGTGTAATCACAAGG - Intronic
1027296838 7:76783029-76783051 GTAAGCCCAATGTAATCACAAGG - Intergenic
1027536632 7:79411338-79411360 GTGAGCCCAATTTAATCACAAGG + Intronic
1028893329 7:96013101-96013123 GTCGGCCCAGTGTAATCACAAGG + Intronic
1028925215 7:96350165-96350187 GTGAGCCCAGTGGAATCATAAGG - Intergenic
1029224995 7:99019598-99019620 TTGATCTCAGTGTCATCACTAGG - Intergenic
1030306009 7:108019372-108019394 GTGGGCCCCGTGTAATCACAAGG - Intergenic
1030339941 7:108366074-108366096 TTGAACCCTGTGTCCTCACATGG - Intronic
1030360514 7:108590521-108590543 GTGGACCCAGTGTAATCACAAGG + Intergenic
1030413180 7:109207809-109207831 GTGAACCTGATGTAATCACAGGG + Intergenic
1030947738 7:115746236-115746258 GTGGGCTCAGTGTAATCACAGGG - Intergenic
1031489287 7:122368025-122368047 GTGAGCCCAATGTAATCACAAGG - Intronic
1031654383 7:124334352-124334374 TTGAACCCTGTGTCTTCACATGG + Intergenic
1034325563 7:150228493-150228515 GTGTACCCAATGTAATTACAAGG + Intergenic
1034407880 7:150917321-150917343 GTGGGCCCAATGTAATCACAAGG + Intergenic
1034767636 7:153740767-153740789 GTGTACCCAATGTAATTACAAGG - Intergenic
1035186506 7:157130206-157130228 GTGGACCCCATGTCATCCCAGGG + Intergenic
1036152638 8:6312958-6312980 GTGGGCCCAATGTCCTCACAAGG + Intergenic
1037743672 8:21626934-21626956 GTGGACCCAGTGTAATCACAAGG - Intergenic
1038387374 8:27161490-27161512 GTGGGCCCAATGTAATCACACGG + Intergenic
1038403939 8:27307968-27307990 GTGGGCCCAATGTCATCACAGGG + Intronic
1038424419 8:27455210-27455232 CTGAGCCCAGTGTTGTCACAGGG + Intronic
1040516018 8:48135792-48135814 GTGAACCCAGTGTAATCGTGTGG + Intergenic
1042415513 8:68513731-68513753 GGGAACGCAGTGGCAGCACATGG + Intronic
1043514889 8:80986765-80986787 GTGGGCCCAGTGTAATCACAAGG + Intronic
1043614939 8:82113980-82114002 ATGAACACTGTGTCTTCACATGG + Intergenic
1043708165 8:83378725-83378747 TTGCAGCCAGTGTCCTCACAGGG + Intergenic
1044753447 8:95438045-95438067 GTGGGCCCAGTGTAAACACAAGG + Intergenic
1045291647 8:100838338-100838360 GTCGGCCCAGTGTAATCACAAGG + Intergenic
1045546621 8:103134892-103134914 ATGAACACTGTGTCCTCACAAGG - Intronic
1045682452 8:104677262-104677284 GTGGGCCCAGTGTAATCACAAGG + Intronic
1046453664 8:114429171-114429193 ATAAAACTAGTGTCATCACATGG + Intergenic
1046794791 8:118359248-118359270 CTTAACCCTGTGTCTTCACATGG - Intronic
1046845206 8:118907666-118907688 GTGGACCCCATGTAATCACATGG + Intergenic
1047087698 8:121537222-121537244 GTGGACCCAATGTAATAACAAGG + Intergenic
1047387594 8:124424498-124424520 GTGGGCCCAGTGTAATCACAGGG - Intergenic
1047461818 8:125072679-125072701 GTGGACTCAGTGTAATCATAAGG - Intronic
1047467230 8:125128832-125128854 GTGGACCTAATGTAATCACAAGG - Intronic
1047509196 8:125503417-125503439 GTGGCTCCAATGTCATCACAAGG + Intergenic
1047964911 8:130039337-130039359 GTGGACCCAATGTAATCACAGGG + Intergenic
1048324715 8:133430050-133430072 GTGGGCCCAATGTCATCACAAGG - Intergenic
1048518993 8:135136744-135136766 GTGTGCCCAGTGTCATCACAAGG + Intergenic
1048567545 8:135618632-135618654 GTGTACCCAGTGTTTTGACATGG + Intronic
1049042675 8:140124404-140124426 ATGGGCCCAGTGTCATCACCAGG - Intronic
1049117591 8:140702949-140702971 GTGAGTCCAGTGTAATTACAAGG + Intronic
1049617882 8:143583845-143583867 GTGGGCCCACTGTCATCACAAGG + Intronic
1050417353 9:5431562-5431584 ATGGACTCATTGTCATCACAAGG - Intronic
1050605383 9:7295856-7295878 ACGAACCCTGTGTCTTCACATGG - Intergenic
1051922880 9:22288300-22288322 GAGAACACTGTATCATCACATGG + Intergenic
1052278126 9:26701912-26701934 GTGAGCGCAGTGTAATCACAAGG + Intergenic
1053214759 9:36261142-36261164 GTGGACCCAATGTAATCACCGGG - Intronic
1053723365 9:40971986-40972008 GGGAACACTGTGTCCTCACATGG - Intergenic
1054736840 9:68761753-68761775 GTGAGCACAGTGTAGTCACAAGG - Intronic
1055440421 9:76331337-76331359 GTAGACCCAATGCCATCACAAGG + Intronic
1056058930 9:82862259-82862281 GTGGGCCCAGTGTAATCTCAAGG - Intergenic
1056220697 9:84448260-84448282 GTGGGCCCAGTGTCATCACAGGG + Intergenic
1056299036 9:85222791-85222813 GTGAGCCCCATGTAATCACAAGG - Intergenic
1056347126 9:85708273-85708295 GTGGGCCCAGTGTAATCATAAGG - Intronic
1056376509 9:86018815-86018837 GTGAATCCAGTCTCACCTCATGG - Exonic
1056478874 9:86980749-86980771 GTGAGCCCTGGGTAATCACAGGG - Intergenic
1056665441 9:88577571-88577593 GTGGACACTGTGTCCTCACATGG + Intronic
1058175352 9:101729558-101729580 GTGTACTCAATGTCATCACAAGG - Intronic
1058372051 9:104280823-104280845 ATGAACCCATTGGCATCAAAAGG - Intergenic
1058790410 9:108438957-108438979 GTGGATCCAATGTAATCACAAGG + Intergenic
1059052829 9:110945887-110945909 GTGGGCTCAGTGTAATCACAGGG - Intronic
1059359696 9:113732265-113732287 GTAACCCCAGTGTGATCACTGGG - Intergenic
1059361929 9:113750822-113750844 ATGAACTCTGTGTCCTCACATGG - Intergenic
1059456022 9:114400792-114400814 GTGGACCCAGTATAATCACCAGG - Intergenic
1059466135 9:114470018-114470040 GTGGGCCCCGTGTCATCACGGGG - Intronic
1060778252 9:126392462-126392484 CTGAGGCCAGTGGCATCACAGGG - Intronic
1061819800 9:133220792-133220814 GTGGGCCCACTGTTATCACAGGG + Intergenic
1061892695 9:133631090-133631112 CTGCACCCACTGACATCACAGGG - Intergenic
1062240856 9:135537156-135537178 GTGGGCCCACTGTTATCACAGGG - Intergenic
1062292260 9:135801424-135801446 GGGAGCCCCATGTCATCACAAGG - Intergenic
1185653388 X:1665540-1665562 ATGGACCCAGTGTCTTCACAGGG + Intergenic
1185699568 X:2220273-2220295 GTGAACCTAATGCCATCACGAGG - Exonic
1186002327 X:5026642-5026664 GTGGGCCCAATGTCATCTCAAGG + Intergenic
1186103633 X:6182650-6182672 GTGAGCCCAGTGGCATTACAAGG + Intronic
1186131423 X:6470130-6470152 GTGGGACCAGTGTAATCACAGGG + Intergenic
1186167678 X:6844186-6844208 ATGGACCCAGTGTAATCACAAGG - Intergenic
1186288692 X:8072823-8072845 GTGAGTCCAATGTAATCACAAGG + Intergenic
1186363959 X:8872471-8872493 GTGAGCCCAATGTCATCACAAGG + Intergenic
1186365788 X:8891964-8891986 GTGAGCCCAGTGTCATCACAGGG + Intergenic
1186501583 X:10055157-10055179 GCAGGCCCAGTGTCATCACAAGG + Intronic
1186513825 X:10151061-10151083 GTGGGCCCAGTGTCGTCACAAGG - Intergenic
1186652577 X:11577063-11577085 GTGTGCCCATTGTAATCACAAGG - Intronic
1186659651 X:11656732-11656754 GTGGGGCCAATGTCATCACAAGG - Intronic
1186724060 X:12338049-12338071 GGGAACACTGTGTCTTCACATGG + Intronic
1186866291 X:13723932-13723954 GTGGACCCAATGTCATGACAAGG + Intronic
1186891231 X:13961080-13961102 GTGGGCCCAATGTCATCACAAGG + Intergenic
1186894890 X:13995761-13995783 GTGGGCCCAATGTCATCACAAGG - Intergenic
1187069893 X:15878039-15878061 GTGAGCCTGATGTCATCACAAGG - Intergenic
1187135474 X:16543416-16543438 TTGAGCCCAATGTAATCACAAGG - Intergenic
1187504635 X:19868981-19869003 CTGATCCCAGTGTAATCACACGG + Intronic
1187909716 X:24100221-24100243 GTGGGCCCAATGTCATCACAAGG - Intergenic
1188099217 X:26062239-26062261 GTGGGCCCAATGTCATCACAAGG + Intergenic
1188326189 X:28804680-28804702 GTGGGCCCAATGTAATCACAAGG - Intronic
1188352843 X:29153218-29153240 ATGAGCCCAGTGTAATCGCAAGG - Intronic
1188355255 X:29182847-29182869 GTGGACTCAGTGTATTCACAGGG + Intronic
1188755390 X:33955195-33955217 GTAAACCCAATGTAGTCACATGG - Intergenic
1188990049 X:36807275-36807297 GTGCACCCAATATAATCACAAGG - Intergenic
1189532682 X:41902489-41902511 ATGGACCCAGTTTAATCACAAGG - Intronic
1189538947 X:41966292-41966314 GTGGACCCAATGTAGTCACAAGG + Intergenic
1189561193 X:42193005-42193027 GTGGACCCAGTGTAACAACAAGG + Intergenic
1189660533 X:43292201-43292223 GTGAACTCAATGTAATGACAAGG + Intergenic
1189722271 X:43932592-43932614 GTGGGCCCAATGTAATCACAAGG + Intergenic
1189722315 X:43932995-43933017 GTGGGCCCAATGTAATCACAAGG - Intergenic
1190074412 X:47305674-47305696 GGGAACACTGTGTCCTCACATGG - Intergenic
1190250621 X:48721787-48721809 GTGAGCCCAGTGTAATCACAAGG - Intergenic
1190425032 X:50327907-50327929 GTGGGCCCAATGTAATCACAAGG + Intronic
1190577222 X:51852256-51852278 GTGAGCCCAGTGTAATTACTGGG - Intronic
1190577871 X:51859699-51859721 GTGGGCCCAATGTAATCACAAGG + Intronic
1190858854 X:54324209-54324231 GTGGACCCAGTGTAATCACAAGG - Intronic
1191685536 X:63885542-63885564 GTGTCCCCAGTGGCAGCACATGG - Intergenic
1191845738 X:65546517-65546539 ATGAACACAGTGTTCTCACATGG + Intergenic
1191882659 X:65858080-65858102 GTGGGCCCAGTGCAATCACAAGG - Intergenic
1192118742 X:68434945-68434967 GTGGACCCAGTGTAATCATAAGG - Intergenic
1192574905 X:72235712-72235734 GTGAGCCCAGTGTAATCACAGGG - Intronic
1192730182 X:73795245-73795267 GTGGGCCCAATGTAATCACAGGG + Intergenic
1193565155 X:83066602-83066624 GTGAATCTAATGTAATCACAAGG - Intergenic
1193913919 X:87342125-87342147 GTGACCTCAGTATAATCACAAGG + Intergenic
1193967472 X:88006429-88006451 CTGAGACCAGTTTCATCACAGGG - Intergenic
1194262082 X:91708487-91708509 GAGAACGCTGTGTCCTCACATGG + Intergenic
1194344341 X:92744649-92744671 GTAAAGCCTGTGTCCTCACACGG + Intergenic
1194975423 X:100391536-100391558 GAGCAACCATTGTCATCACATGG + Intronic
1196559860 X:117132878-117132900 GTGAAGCCTTTCTCATCACAAGG - Intergenic
1196579767 X:117364948-117364970 GTGGGCCCAATGTAATCACAAGG - Intergenic
1196595453 X:117540807-117540829 GTGGGCCCAGTGTCATCAAAAGG - Intergenic
1196770760 X:119291122-119291144 ATGGGCCCAGTGTAATCACAGGG + Intergenic
1196867865 X:120085931-120085953 GTGAACCAAGTGGCATCAGCAGG + Intergenic
1196875237 X:120150350-120150372 GTGAACCAAGTGGCATCAGCAGG - Intergenic
1197610905 X:128637166-128637188 GTGACCCCAGTATGTTCACAAGG - Intergenic
1197664691 X:129210889-129210911 GGGAACCCAGTGAGCTCACAGGG + Intergenic
1197804993 X:130390099-130390121 GTGGACCCAATGTCATCACAAGG - Intergenic
1199460213 X:148075747-148075769 GTGGTCCCAATGTAATCACAAGG + Intergenic
1199539857 X:148946843-148946865 GTGGGCCCAGTGTAATCACGGGG - Intronic
1199735308 X:150680571-150680593 GTGAACCCAATGTCATTACAAGG + Intergenic
1199759067 X:150891506-150891528 GTGGACCCAATGTAATCACCCGG - Intronic
1199764393 X:150930347-150930369 GTGGGCCCAATGTCATCACAAGG - Intergenic
1199923191 X:152431667-152431689 GTAAACACAATGTAATCACAAGG + Intronic
1200580729 Y:4947274-4947296 GAGAACACTGTGTCCTCACATGG + Intergenic
1200652686 Y:5861290-5861312 GTAAAGCCTGTGTCCTCACACGG + Intergenic