ID: 1162086833

View in Genome Browser
Species Human (GRCh38)
Location 19:8254501-8254523
Sequence TCATTGGCCTGCCCCTGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162086825_1162086833 26 Left 1162086825 19:8254452-8254474 CCCATCTCTTCACCTGGGCTGAT 0: 1
1: 0
2: 1
3: 8
4: 209
Right 1162086833 19:8254501-8254523 TCATTGGCCTGCCCCTGAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 173
1162086826_1162086833 25 Left 1162086826 19:8254453-8254475 CCATCTCTTCACCTGGGCTGATA 0: 1
1: 0
2: 1
3: 17
4: 198
Right 1162086833 19:8254501-8254523 TCATTGGCCTGCCCCTGAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 173
1162086828_1162086833 14 Left 1162086828 19:8254464-8254486 CCTGGGCTGATAGGCTCTGTCTC 0: 1
1: 0
2: 1
3: 14
4: 193
Right 1162086833 19:8254501-8254523 TCATTGGCCTGCCCCTGAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 173
1162086830_1162086833 -8 Left 1162086830 19:8254486-8254508 CCTTTGCACCCAGATTCATTGGC 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1162086833 19:8254501-8254523 TCATTGGCCTGCCCCTGAGCCGG 0: 1
1: 0
2: 1
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162086833 Original CRISPR TCATTGGCCTGCCCCTGAGC CGG Exonic
900595946 1:3480251-3480273 TCAGTGGCGAGCACCTGAGCAGG + Intronic
900733162 1:4276280-4276302 TCCTTGTCCCTCCCCTGAGCGGG + Intergenic
902636108 1:17736019-17736041 TCCTTGGCCTGGCCCAGGGCTGG + Intergenic
904567028 1:31434321-31434343 TCCAGGACCTGCCCCTGAGCCGG + Exonic
911173606 1:94796236-94796258 TCAAGGGCCTGGCCCTGTGCTGG + Intergenic
917285274 1:173416352-173416374 CCATTTGCCTGCCTCTGGGCAGG - Intergenic
918146746 1:181763252-181763274 TCACTGGCCAGCCCATCAGCTGG + Intronic
919555410 1:199046470-199046492 TCTGTAGCCTGCACCTGAGCAGG + Intergenic
919752796 1:201048699-201048721 GCAGTGGCCTGCCGCTGAGCTGG + Intronic
920440904 1:205979775-205979797 ACATTGGCATGGACCTGAGCAGG + Intronic
920549644 1:206847512-206847534 TTATTGTACTGCACCTGAGCTGG - Intergenic
921925911 1:220710148-220710170 TCCTTGGTCTGCCCCTCAGTAGG - Intergenic
924657265 1:245984245-245984267 GCCTTGGCCTGCCCATGTGCTGG + Intronic
1062769096 10:85622-85644 CCACTGGTCTGCCCCAGAGCTGG - Intergenic
1067286171 10:44909000-44909022 TCATGGGCCAGGACCTGAGCTGG + Intergenic
1070307091 10:75246080-75246102 GCATTTGGCAGCCCCTGAGCTGG + Intergenic
1073082388 10:100868370-100868392 GCATTGGCAAGCCCCTGAGCTGG + Intergenic
1073108753 10:101048285-101048307 TCATCTCCCTGCCCCGGAGCCGG - Intergenic
1073118774 10:101108540-101108562 TCCCTGGCCTCCCCCTCAGCAGG + Intronic
1074528542 10:114281130-114281152 TGATTGGCCTGCCCCTGTGTGGG + Intronic
1076724922 10:132408815-132408837 GCATCCGCCTACCCCTGAGCAGG - Intronic
1076741348 10:132487277-132487299 TCACGGGGCTGCTCCTGAGCTGG - Intergenic
1077295910 11:1826275-1826297 CCTCTGGTCTGCCCCTGAGCTGG + Intergenic
1078088240 11:8247518-8247540 GCATTTGCCTGCCCCAGAGTTGG + Intronic
1078267770 11:9767611-9767633 TCACTAGCCTTCACCTGAGCAGG - Intergenic
1078283649 11:9929398-9929420 TCTTGGTCCTACCCCTGAGCTGG - Intronic
1080778391 11:35407631-35407653 TCATTGGCCTTTGCCAGAGCTGG - Intronic
1081999901 11:47388508-47388530 TCATGGGCCTGCTCTTCAGCAGG + Intergenic
1084793793 11:71491086-71491108 GAATGGTCCTGCCCCTGAGCTGG + Intronic
1085048143 11:73365109-73365131 TCACTGGCCTCCCCCTGGACAGG - Intronic
1085052605 11:73387571-73387593 TCCCTGGCTTTCCCCTGAGCTGG + Intronic
1085521799 11:77143525-77143547 TCAGGGGCCTGCCCCGGAGAAGG + Intronic
1088614178 11:111606862-111606884 GCATTGGCCTCCCACTGTGCTGG - Intronic
1088814226 11:113410475-113410497 TCTATGAGCTGCCCCTGAGCTGG + Exonic
1089358303 11:117870147-117870169 GCATTGGCCTGTGCCTGAGTTGG - Intronic
1091267284 11:134281471-134281493 TCTGTGCCCTGCCCCTGACCAGG - Intronic
1091434716 12:463181-463203 TCATTTGCCTGTCCCTGTGTTGG + Intronic
1092135120 12:6141949-6141971 CTGTTGACCTGCCCCTGAGCTGG - Intergenic
1092518403 12:9240210-9240232 TCATTAGCATTCCCGTGAGCAGG + Intergenic
1096583075 12:52600992-52601014 GCATTGGCCTGTCCCTGCGTTGG - Intronic
1098885149 12:75953452-75953474 TCATTAGCCTGGGCCTGGGCTGG + Intergenic
1101581539 12:106046588-106046610 TCACTGGCCTGGCTCAGAGCTGG + Intergenic
1101917595 12:108907944-108907966 GCATTGGCCTGCCCTTTAGCAGG - Intergenic
1102189135 12:110973035-110973057 TCTTGGGCGTGCCCCTGGGCCGG - Intergenic
1102569681 12:113819810-113819832 TCATTTGCCTGGCCCAGAGGAGG - Intronic
1102910782 12:116712345-116712367 CCGTTGGTCTGCACCTGAGCTGG - Exonic
1104258437 12:127160826-127160848 TAATTGGCCTGCCCCGAAGGGGG - Intergenic
1106420000 13:29578174-29578196 TCATTTGCCAGCCCCTAAGAAGG - Intronic
1107411284 13:40160813-40160835 TCATAGGCCTGCCTCTGTCCAGG - Intergenic
1108511810 13:51163141-51163163 ACATTTGCTGGCCCCTGAGCAGG - Intergenic
1114662358 14:24355369-24355391 TCTTTGACCAGCCCCTTAGCTGG + Intergenic
1117073457 14:52076888-52076910 GCATTGGCCTCCCCCAGTGCTGG - Intergenic
1118318900 14:64742011-64742033 CCATTGGCCTGGCCCTGGCCTGG - Exonic
1118722482 14:68604263-68604285 TCATTGGCGTGGCCTTGTGCAGG - Intronic
1119874196 14:78043150-78043172 TCTTCGGCCTGCCTGTGAGCTGG + Intergenic
1122194793 14:100076837-100076859 TGAGTTGCCTGCCCCAGAGCTGG + Intronic
1122602367 14:102928180-102928202 CCAGTGTCCTGTCCCTGAGCTGG - Intronic
1122758546 14:104002390-104002412 AAATTGGTCTGCCCCTGAACTGG + Intronic
1202929735 14_KI270725v1_random:26825-26847 TCATGGTCCTGCCCCTGTTCTGG + Intergenic
1128497662 15:68207454-68207476 TCATGGGCCTGAGCCTGGGCAGG + Exonic
1129687616 15:77695614-77695636 CCATTTCCCTGCCCCAGAGCTGG - Intronic
1130105994 15:80928916-80928938 GCATTGGCCTGACCCTGGCCAGG + Exonic
1132112109 15:99109190-99109212 TCATTGGCCTGCCCCAGGCCTGG + Intronic
1132458201 16:35866-35888 CCACTGGTCTGCCCCAGAGCTGG - Intergenic
1133330005 16:4966984-4967006 TAATGGACCTGCCTCTGAGCTGG - Intronic
1134357625 16:13499007-13499029 TGAGAGGTCTGCCCCTGAGCAGG + Intergenic
1138003379 16:53305713-53305735 TCATTTTCTTGCCCCTGAACTGG - Intronic
1138664949 16:58558454-58558476 TCATTTGCCTCCCCCTTACCTGG + Exonic
1139020537 16:62743232-62743254 TCATTGGCCTCCCACAGTGCTGG + Intergenic
1139269138 16:65665754-65665776 TACTTGGCCAGCCCATGAGCTGG - Intergenic
1143330566 17:6131931-6131953 GCCTCGGCCTGACCCTGAGCAGG - Intergenic
1145999839 17:29124573-29124595 CCACTGGCCTGCACCTGGGCTGG - Intronic
1148160522 17:45447329-45447351 CCATTGGGCTGTCCCTGGGCTGG - Intronic
1148611868 17:48970013-48970035 GCTTTATCCTGCCCCTGAGCAGG - Intergenic
1149653314 17:58292630-58292652 CCATTGCCCTGCCCCGGTGCAGG + Intergenic
1150300819 17:64045573-64045595 ACATAAGCCTGCCCCAGAGCTGG + Intronic
1152240149 17:79156768-79156790 TGGCTGGCCGGCCCCTGAGCTGG + Intronic
1152545649 17:80998950-80998972 TCACTTGCCTCCCCCAGAGCTGG + Intronic
1152662071 17:81547150-81547172 GTGTTTGCCTGCCCCTGAGCAGG - Exonic
1152791248 17:82281280-82281302 TCAGTGGCCTTCACCTGTGCAGG - Intergenic
1152962156 18:86432-86454 CCACTGGTCTGCCCCAGAGCTGG - Intergenic
1157045577 18:44099041-44099063 TCTGTGGCCAGCACCTGAGCAGG - Intergenic
1160125774 18:76169919-76169941 TCATTGGCCTTACCCTGAAGGGG - Intergenic
1162086833 19:8254501-8254523 TCATTGGCCTGCCCCTGAGCCGG + Exonic
1162203356 19:9037309-9037331 TGATGTGCCTGGCCCTGAGCTGG - Intergenic
1163110177 19:15155630-15155652 TCCTTGGCCTGCCAATGTGCCGG - Intergenic
1163648064 19:18501555-18501577 TCATCCGCCTGGCTCTGAGCTGG - Intronic
1163749747 19:19069339-19069361 GTGTTGGCCTGCCCCTCAGCTGG - Intronic
1164237032 19:23346289-23346311 GTATTGGCATGCACCTGAGCTGG - Intronic
1164876354 19:31693449-31693471 TCATTTCCCTGCCACTGGGCTGG + Intergenic
1165908421 19:39208308-39208330 CCATTGGCCTGGCCCTGCCCAGG + Intergenic
1166404573 19:42510902-42510924 TCATTGGAGTGGTCCTGAGCTGG + Exonic
932087488 2:68775008-68775030 TTCTTGGCCTGGCCCTGACCGGG + Intronic
933990938 2:87633390-87633412 GCATTGGCCTTCCCCAGGGCAGG + Intergenic
936302902 2:111317433-111317455 GCATTGGCCTTCCCCAGGGCAGG - Intergenic
945381357 2:209145306-209145328 TCACAGGCCTGCCCCTGCCCTGG - Intergenic
946487450 2:220114385-220114407 GCTCTGCCCTGCCCCTGAGCTGG + Intergenic
947532790 2:230923479-230923501 TCATCCGCCTGTGCCTGAGCTGG + Intronic
947933949 2:233987489-233987511 CCAGTGGCCTCCCCCTGAGCAGG + Intronic
1169382364 20:5119443-5119465 TCATTGGCCTGCCACGCAGTGGG - Intronic
1170623359 20:18012052-18012074 TCATTAGCCTTCCCATTAGCAGG - Intronic
1171464323 20:25317154-25317176 TCATTGGCCTCCCCCTGGTTTGG - Intronic
1171977951 20:31607217-31607239 TCATTACCCAGCTCCTGAGCAGG + Intergenic
1172704353 20:36872138-36872160 TCAGTAGCCTGCCCCTGGGATGG - Intergenic
1173233802 20:41225347-41225369 TCAGTGGCCAGCCTCTGAGTGGG - Intronic
1173328888 20:42057826-42057848 ACCTTGGCCTCCCCCTGTGCTGG + Intergenic
1173428481 20:42963735-42963757 TTATTGGCTTTCCCCTGTGCAGG - Intronic
1173826793 20:46052940-46052962 TCCTTGGCCTCCCTCAGAGCTGG + Exonic
1175606906 20:60318526-60318548 ACAGTGGCCTATCCCTGAGCAGG - Intergenic
1176591757 21:8655424-8655446 TCATGGTCCTGCCCCTGTTCTGG + Intergenic
1179793125 21:43767062-43767084 TCATAGGCCTCCCTCAGAGCCGG + Intergenic
1180274604 22:10632536-10632558 TCATGGTCCTGCCCCTGTTCTGG + Intergenic
1181023119 22:20113686-20113708 CCATTGGCCTGGCCCTGGCCCGG - Exonic
1181108419 22:20587939-20587961 TCATCTGCCTGTCCCTGTGCTGG + Intergenic
1182259424 22:29062601-29062623 TCACTGGCCTCCCCCTCAGGAGG - Intergenic
1183828914 22:40407850-40407872 TCCTTGGTCTGCTCTTGAGCTGG + Intronic
1184039770 22:41935839-41935861 CCACTGGCCAGGCCCTGAGCTGG - Intergenic
1184968397 22:47997748-47997770 TCATTCGCCTGCCACTGGGTAGG - Intergenic
1185058084 22:48591682-48591704 GCCTGGGCCTGACCCTGAGCTGG + Intronic
952871287 3:37903494-37903516 TCATTGACCAGGACCTGAGCAGG + Intronic
954704384 3:52471437-52471459 CCATAGGCCTGCGCCTGACCTGG + Intronic
954922484 3:54203705-54203727 TCAGTGGCCTGCCTGTGTGCTGG + Intronic
956697028 3:71927049-71927071 TCATTCGCCACCCCCAGAGCAGG - Intergenic
956828799 3:73025059-73025081 TGATTGGCCTGGCCCTGGTCAGG + Intronic
958177238 3:90012093-90012115 TCATTGTCTTCCCACTGAGCAGG + Intergenic
959570100 3:107873885-107873907 CCATTGCCCTGCCCCTGAGTGGG - Intergenic
959666845 3:108932232-108932254 TTATTGGCCTGAGCCTGAGTGGG + Intronic
960596494 3:119412429-119412451 TGGTTGTCCTGGCCCTGAGCAGG + Intronic
961366030 3:126399976-126399998 ACAATGGCCAGCCGCTGAGCCGG - Intronic
961671774 3:128537444-128537466 TCATTCTCCTTCCCCTGGGCTGG - Intergenic
962536397 3:136333140-136333162 TCTGTGGCCTCCCACTGAGCTGG + Intronic
964469849 3:157041098-157041120 TAATTGCCCTCCCCCTGAGAAGG - Intronic
965789091 3:172368414-172368436 TTAAGGGCCTGGCCCTGAGCTGG - Intronic
968885864 4:3331844-3331866 TCATGGGCCTGCGGCAGAGCTGG + Intronic
969247724 4:5946168-5946190 CCCTTGTCCTGCCCCTGAGCAGG + Intronic
969725389 4:8915345-8915367 TCTCTGTCCAGCCCCTGAGCTGG - Intergenic
969839913 4:9873625-9873647 TCATTGGTCTGGCACTGAGAAGG - Intronic
973982870 4:56320902-56320924 GCACTGGCCTCCCCCTGAGGTGG + Intronic
975292607 4:72694779-72694801 TGATTGCCCTGCCCAGGAGCTGG + Intergenic
978468677 4:109037482-109037504 TCCTTGGCCAGCCCCTCTGCTGG + Intronic
983660689 4:170128021-170128043 GCCTTGGCCTGCCCCAGAGAGGG + Intergenic
985252985 4:188042069-188042091 TCAATGGCCTGTCCGTGTGCCGG - Intergenic
997046526 5:130325658-130325680 TCATTGACCTGCGCCTGGCCAGG + Intergenic
997693937 5:135846484-135846506 TGCCTGGCCTGCCCCTGACCTGG - Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1000079687 5:157833099-157833121 GCCTTGGCCTGCCCCAGTGCCGG - Intronic
1002070610 5:176677101-176677123 TCATGGACCTGCCCCAGAGAGGG + Intergenic
1003182192 6:3801493-3801515 TCACTGTCCTGCACATGAGCTGG - Intergenic
1003242694 6:4358523-4358545 CCATTGGCCTGTGCCAGAGCTGG - Intergenic
1003432650 6:6054100-6054122 TCCTTGACCTGGCCCTGAGTGGG + Intergenic
1015404635 6:132823175-132823197 TCACTGACCTGTCCCTCAGCTGG - Intergenic
1018062716 6:160103203-160103225 TCATTGGCCTGTGGCTCAGCTGG - Intronic
1021710454 7:23411027-23411049 TCAGTGGCCTGACTTTGAGCAGG - Intronic
1024365702 7:48517822-48517844 TCATTTCTCAGCCCCTGAGCTGG - Intronic
1025161133 7:56661876-56661898 TCATTGACATGCCTATGAGCTGG - Intergenic
1025942893 7:66086800-66086822 TCAATGTCCTGCCCCTGGGGAGG + Exonic
1026605235 7:71810287-71810309 GCATTGGCCTGTCCCGGACCGGG + Intronic
1028239256 7:88399279-88399301 TCATTGGCTTGCCATGGAGCTGG + Intergenic
1034480272 7:151314472-151314494 TCATTTGCCTGCTCCTAAGCTGG - Intergenic
1041378013 8:57221982-57222004 TCATTGGCATGCTTCTGAGTTGG + Intergenic
1042054383 8:64748490-64748512 TCATTTACCTGCCCCTGTGCTGG + Intronic
1042834064 8:73061985-73062007 TCGTTGGCCTCCCACTGTGCTGG + Intergenic
1043059039 8:75476810-75476832 TCATTCACCTGCCCCAGAGCAGG - Intronic
1044930685 8:97248857-97248879 TCCCTGGCCTGCCTCAGAGCAGG + Intergenic
1051838037 9:21362842-21362864 CCATTGTCCTGCCCCTAAACTGG + Intergenic
1051887028 9:21904145-21904167 TCAGTGGCCTGCCAGTGTGCTGG + Intronic
1052916199 9:33925922-33925944 TCCTTGCCCTGCCCATGGGCAGG - Intronic
1055068430 9:72142671-72142693 TCATTGGCTTGTGACTGAGCTGG + Intronic
1056206747 9:84326754-84326776 ACATTGGCCTGCCAGAGAGCTGG - Intronic
1060052990 9:120390349-120390371 TCCTTTGCCTGCCCTTTAGCTGG + Intronic
1060237041 9:121871811-121871833 TCACTGGCCTGCCCTGGAACCGG + Intronic
1060666684 9:125436013-125436035 TCCTGGCCCTGGCCCTGAGCTGG - Intergenic
1061464372 9:130766226-130766248 TCATCCGCATGCCCCTGAGCAGG - Intronic
1061724487 9:132574478-132574500 TGAGTGGGCTGGCCCTGAGCAGG + Intergenic
1061953295 9:133948468-133948490 CCAGTCGCCTGCCCCTGACCTGG - Intronic
1062424412 9:136499409-136499431 CCATGGGGCTGCCCCTGAGGAGG + Intronic
1062456851 9:136644108-136644130 CCCTTGGCCTGCCCCAAAGCCGG + Intergenic
1062735984 9:138137685-138137707 CCACTGGTCTGCCCCAGAGCTGG + Intergenic
1203621784 Un_KI270749v1:134188-134210 TCATGGTCCTGCCCCTGTTCTGG + Intergenic
1185942888 X:4340905-4340927 TCAATGGCCTGCCCGTGTGCTGG + Intergenic
1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG + Exonic
1193012620 X:76694432-76694454 TCCTTGGCCTGCCAAAGAGCTGG + Intergenic
1197271238 X:124426895-124426917 TCAGTGCCCTGCCACTGAGAGGG + Intronic
1198222162 X:134612789-134612811 GCTTTGCCCTGCCCCTGAGCCGG + Intronic
1199811422 X:151353601-151353623 TCATTGTCTTACCCCTGAGGTGG + Intergenic
1200398197 X:156003504-156003526 CCACTGGTCTGCCCCAGAGCTGG + Exonic
1201727806 Y:17172671-17172693 TCAATGGCCTGCCCATGAGCTGG + Intergenic
1201765326 Y:17569358-17569380 GCACTGGCCTGCCACTGGGCCGG + Intergenic
1201836226 Y:18336631-18336653 GCACTGGCCTGCCACTGGGCCGG - Intergenic