ID: 1162087117

View in Genome Browser
Species Human (GRCh38)
Location 19:8255602-8255624
Sequence CAGGAGAGACAGCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 856
Summary {0: 1, 1: 1, 2: 10, 3: 103, 4: 741}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162087117_1162087129 19 Left 1162087117 19:8255602-8255624 CCCAGCCCCAGCTGTCTCTCCTG 0: 1
1: 1
2: 10
3: 103
4: 741
Right 1162087129 19:8255644-8255666 CGCTGCAGCAGACCCAGCGATGG 0: 1
1: 0
2: 0
3: 8
4: 121
1162087117_1162087123 -9 Left 1162087117 19:8255602-8255624 CCCAGCCCCAGCTGTCTCTCCTG 0: 1
1: 1
2: 10
3: 103
4: 741
Right 1162087123 19:8255616-8255638 TCTCTCCTGGCCGCCCAGTGTGG 0: 1
1: 0
2: 2
3: 17
4: 174
1162087117_1162087130 25 Left 1162087117 19:8255602-8255624 CCCAGCCCCAGCTGTCTCTCCTG 0: 1
1: 1
2: 10
3: 103
4: 741
Right 1162087130 19:8255650-8255672 AGCAGACCCAGCGATGGTTCCGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162087117 Original CRISPR CAGGAGAGACAGCTGGGGCT GGG (reversed) Exonic
900165615 1:1243244-1243266 CAGGAGTGGCTGCTGGGGCTGGG + Intronic
900184437 1:1326314-1326336 AAGCAGAGACAGGTGGGGCCGGG - Intronic
900409159 1:2505040-2505062 CAGCAGAGACTGCAGGGCCTGGG + Exonic
900503253 1:3016821-3016843 CGGGGGAGAATGCTGGGGCTTGG + Intergenic
900551622 1:3259278-3259300 CAGGGGCTGCAGCTGGGGCTGGG + Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900664558 1:3806026-3806048 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
900959770 1:5911415-5911437 CAGCAGAGACAGCGGGCACTCGG + Intronic
901049757 1:6420186-6420208 CAGGAGGGCCAGGTGGGGCCAGG + Intronic
901052014 1:6430013-6430035 CAGGAGGGGCAGCTGGGAATTGG + Intronic
901070001 1:6512349-6512371 CAGGGGGCACATCTGGGGCTGGG - Intronic
901188339 1:7389175-7389197 GAGAAGAGACAGCTGGGGGTGGG - Intronic
901202241 1:7473337-7473359 TAGGAGGAACAGCTGGGGCTGGG + Intronic
901284207 1:8063742-8063764 CGGGAGTTACAGCTTGGGCTAGG + Intergenic
901377489 1:8849579-8849601 CAAGAAGGACAGCTGGGGGTGGG + Intergenic
901796626 1:11683220-11683242 CAGGGCAGAGGGCTGGGGCTGGG - Intronic
901862043 1:12080785-12080807 CAGGAGGGTCAGCTGAGGCCAGG - Intronic
902163434 1:14550894-14550916 CTGGGGAGAGAGCTGGGGATGGG - Intergenic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902469623 1:16639339-16639361 CAGGAGAGACAGCAGGTGGTAGG - Intergenic
902713984 1:18259996-18260018 GAAGAGAGAAAGCTGAGGCTTGG - Intronic
902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG + Exonic
902841819 1:19079333-19079355 CGGGAGAGAAAGTGGGGGCTTGG - Intronic
902922521 1:19675226-19675248 CAGATGAGACAACTGAGGCTCGG - Intronic
903003470 1:20282857-20282879 CAGGAGAGACAGCAGGGTGCAGG + Intergenic
903173123 1:21565719-21565741 ACGGAGAGGCAGGTGGGGCTGGG - Intronic
903233466 1:21935711-21935733 CAGGAAAGACTGTTGGGCCTCGG + Intronic
903351525 1:22719680-22719702 TAGAAGAGAGAGCTGAGGCTCGG - Intronic
903404913 1:23088192-23088214 GAGCAGAGAGAGCTGGGGTTGGG + Exonic
903451183 1:23454846-23454868 CAGATGAGAGACCTGGGGCTTGG + Intronic
903461963 1:23526511-23526533 CGGGGGAGACAGGTGTGGCTGGG - Intronic
903738722 1:25545704-25545726 CACGAGGGACAGGTGGGGCTCGG - Intronic
904001800 1:27343009-27343031 CAAGAGGGATCGCTGGGGCTCGG + Intronic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
904375778 1:30081530-30081552 CAGGTGAGTCAACTGAGGCTTGG - Intergenic
904377134 1:30088812-30088834 CAAGTGAGAATGCTGGGGCTGGG - Intergenic
904381366 1:30113291-30113313 GAGGACTGACTGCTGGGGCTGGG + Intergenic
904396889 1:30228124-30228146 CAGGGGACACTGCTGGGGATTGG + Intergenic
904477183 1:30772940-30772962 CAGAGGAGAAAGCTGGGGTTGGG + Intergenic
904619915 1:31769071-31769093 CAGAAGAGAAAACTGAGGCTTGG - Intergenic
904738798 1:32655710-32655732 CAGGAGAGAAAGTTGGGGTAAGG - Intronic
904784237 1:32973409-32973431 CAGCAGACACAGCGGGGGATGGG + Intergenic
905371592 1:37485387-37485409 GTGCAGAGACAGCGGGGGCTTGG - Intergenic
905535232 1:38715941-38715963 CTGGAGAGACCACTGGGGCTTGG - Intergenic
906206697 1:43991026-43991048 CATGGGAGGCAGGTGGGGCTTGG + Exonic
906448166 1:45921720-45921742 CAGGAGTCACAGCTCAGGCTCGG + Intronic
906733867 1:48105694-48105716 CAGGGGAGATAGCTGGTGCAGGG - Intergenic
907044147 1:51289452-51289474 CAGGAAAGACATCTGAGGCTGGG - Intronic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
907951341 1:59186821-59186843 CATAACAGGCAGCTGGGGCTGGG - Intergenic
909060282 1:70871249-70871271 CAAGAGAGACAGTAGGGGGTGGG + Intronic
909823940 1:80101567-80101589 CAGGAGACAAAGGTGGGACTAGG - Intergenic
910599956 1:89020436-89020458 GAGGAGAGAAAGCTGGCACTGGG - Intronic
911090959 1:94016475-94016497 CAGCAGAGGCAGCTGGAGCAGGG + Intronic
912763089 1:112386252-112386274 GAGGAGGGATAGCTGGGCCTAGG + Intergenic
912950765 1:114118757-114118779 GAGGAGAGGCAGATGGGGGTGGG - Intronic
913203958 1:116518517-116518539 CATTAGAGAAAGATGGGGCTGGG - Intronic
914328314 1:146642571-146642593 CAGGAGGGAAAACTGGAGCTTGG - Intergenic
914343957 1:146782181-146782203 CGGGTGAGACAGCTGGGGACGGG - Intergenic
914445954 1:147750919-147750941 CAGGGAAGACTGGTGGGGCTGGG - Intergenic
914919902 1:151839593-151839615 CAGAGGAGGCAGGTGGGGCTAGG - Intronic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915320377 1:155052899-155052921 TGGGAGAGGCAGCTGGGCCTGGG - Intronic
916091332 1:161309896-161309918 CAGGAGCCATAGCTGGGGCAGGG + Exonic
916432441 1:164744088-164744110 CAGGAGATACACCAGGAGCTAGG + Intronic
916506049 1:165429034-165429056 CAGGAAAGAAAGGTGGGGCTAGG - Intronic
917974308 1:180229563-180229585 GGGGAGAGAGAGCAGGGGCTGGG + Intergenic
917980819 1:180267887-180267909 TAGGTGAGCCAGCTGGAGCTGGG + Intronic
918311671 1:183289663-183289685 CAGGACAGGCTGCTGTGGCTGGG - Intronic
919954804 1:202403145-202403167 CAGTAGAGAGAGATGGGGCCTGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920404939 1:205701984-205702006 TAGGACTTACAGCTGGGGCTGGG - Intergenic
920557396 1:206914161-206914183 TTGGAGAGACGGCTGGAGCTGGG - Intronic
920691933 1:208153840-208153862 CAGAACAGACAGCTGGGGGAGGG + Intronic
922342516 1:224669147-224669169 GAAGCGAGTCAGCTGGGGCTAGG + Intronic
922535607 1:226378550-226378572 AAGAAAAGCCAGCTGGGGCTGGG + Intronic
922695335 1:227728483-227728505 CGGGAGAGCCAGGTGGGGCGGGG - Intergenic
922854831 1:228765907-228765929 CAGGAGATAGAGATGAGGCTGGG + Intergenic
924164265 1:241265542-241265564 CAGGCAAGACGGCTGGGGCTGGG + Intronic
924740159 1:246790206-246790228 CAGGACAGGCAGATGGGGATTGG - Intergenic
924886417 1:248222119-248222141 CTGGATAGACAGCTGTGCCTGGG + Intergenic
1062995131 10:1858479-1858501 CAGGTGAGAAAACTGAGGCTGGG + Intergenic
1063905229 10:10774539-10774561 CAGGAGCGAGAGCGGGGGCAGGG - Intergenic
1063998141 10:11640519-11640541 CAGGAGAGGGAACTGGGGGTTGG + Intergenic
1064061539 10:12141769-12141791 CAGGACAGACCCCTGGGGCAAGG - Intronic
1064123594 10:12640122-12640144 GAGGAGAAATTGCTGGGGCTAGG - Intronic
1064245619 10:13665711-13665733 CTGGAAGGACAGGTGGGGCTGGG - Intronic
1064272591 10:13878909-13878931 CAGGACAGACAGATGAGGCAGGG + Intronic
1065032520 10:21602314-21602336 CGGGGGAGCCAGCTGGGGGTAGG - Intronic
1065930292 10:30473013-30473035 CACGGGAGACAGCTGGGGCCAGG + Intergenic
1066476563 10:35752677-35752699 CACGTGGGCCAGCTGGGGCTGGG + Intergenic
1066516315 10:36164600-36164622 CAAGCCAGAAAGCTGGGGCTTGG + Intergenic
1067228545 10:44390947-44390969 TAGGAGAGAGGGGTGGGGCTAGG - Intergenic
1067374941 10:45719290-45719312 AAGGAGGGTAAGCTGGGGCTGGG - Intergenic
1067378787 10:45753231-45753253 AAGGAGGGTAAGCTGGGGCTGGG + Exonic
1067563855 10:47322694-47322716 CAGCAGGGACAGCAGGGGCAGGG - Exonic
1067719772 10:48719616-48719638 GAGGAGAAACAGGAGGGGCTGGG + Intronic
1067886488 10:50093911-50093933 AAGGAGGGTAAGCTGGGGCTGGG + Exonic
1067908379 10:50318332-50318354 CAGGTGAGAAAACTGAGGCTAGG - Intronic
1069479151 10:68765174-68765196 GAGGAGAAACTGCTGGGACTAGG - Intronic
1069576945 10:69537507-69537529 CAGGAGAGAGGGCTGGAGCAAGG - Intergenic
1069641784 10:69961131-69961153 GAGAGGAGACAGCTGTGGCTGGG + Intronic
1070281158 10:75049881-75049903 CTGGAAAGCCAGCTTGGGCTGGG + Intronic
1070320021 10:75347609-75347631 AGGGAGAGAAGGCTGGGGCTGGG - Intergenic
1070764347 10:79048010-79048032 CACAGGAGACAGCTGAGGCTCGG - Intergenic
1070969731 10:80553403-80553425 CAGGACTGACAGCAGGGTCTGGG + Intronic
1071366303 10:84903908-84903930 CAGGTGACCCACCTGGGGCTGGG + Intergenic
1072115502 10:92366742-92366764 GTGCAGAGACACCTGGGGCTGGG + Intergenic
1072188049 10:93060813-93060835 GAGGAGGGACAGGTGGGGCGGGG + Intergenic
1072310508 10:94149828-94149850 CTTCAGAGACAGCAGGGGCTGGG + Intronic
1072811173 10:98463264-98463286 CTGGAGAGGTAGCTGGAGCTGGG - Intronic
1072866648 10:99068994-99069016 CAGTAAAGACAGCTGGGACTTGG - Intronic
1073047015 10:100645460-100645482 CAGGAGACTCGGCAGGGGCTGGG - Intergenic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073293291 10:102423901-102423923 CAGGGGAAACAGATGGGGATAGG + Intronic
1073441892 10:103557078-103557100 CAGGTGAGAAAACTGAGGCTCGG - Intronic
1073469642 10:103714703-103714725 CAGGAGGGCCAGCTGGACCTTGG - Intronic
1074535135 10:114323487-114323509 CAGGGGAGAAAGCTGAGTCTTGG - Intronic
1074701151 10:116093631-116093653 CAAGAGGTACAGCTGGAGCTCGG + Intronic
1074922089 10:118024915-118024937 CTGCAGAGATGGCTGGGGCTAGG - Intronic
1075935557 10:126338148-126338170 TAGTAGAGACAGCTCGTGCTTGG - Intronic
1076189762 10:128474871-128474893 GAGGACAGAGACCTGGGGCTGGG - Intergenic
1076419687 10:130322139-130322161 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1076429062 10:130388912-130388934 CAGGTGAGACTGCTGGGGTGAGG + Intergenic
1076639615 10:131905387-131905409 CAGGAGAGGGAGCAGGGGCTGGG - Intronic
1076716775 10:132369958-132369980 ATGGAGAGACAGGTGTGGCTGGG - Intronic
1076757157 10:132578630-132578652 CAGGAGAGTGTGCGGGGGCTGGG + Intronic
1076757189 10:132578748-132578770 CAGGAGAGTGTGCAGGGGCTGGG + Intronic
1076851386 10:133095150-133095172 CAGGAGCCCCAGCTGGAGCTCGG + Intronic
1077336640 11:2008059-2008081 CCGCAGAGGCAGCTGCGGCTGGG - Intergenic
1077384275 11:2261647-2261669 CAGGAGAGCAAGCCTGGGCTAGG + Intergenic
1077401061 11:2357651-2357673 CAGGGGAGACAGGTGGGTCCTGG + Intergenic
1077602369 11:3582368-3582390 CAGGAGAGACAGGGGAGACTGGG + Intergenic
1077706594 11:4492829-4492851 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1078105323 11:8354731-8354753 GAGGAGCAGCAGCTGGGGCTGGG + Intergenic
1078105748 11:8357045-8357067 GGAGGGAGACAGCTGGGGCTTGG - Intergenic
1078281886 11:9910751-9910773 TAGAAAACACAGCTGGGGCTGGG + Intronic
1078902314 11:15652913-15652935 CAAGAGAGAAAGGTGGGGGTGGG - Intergenic
1079201887 11:18383639-18383661 CTGGAGAGGAAGCTGAGGCTGGG + Intergenic
1079202464 11:18387312-18387334 TCTGAGAGACAGATGGGGCTTGG + Intergenic
1079252243 11:18794753-18794775 CACATGTGACAGCTGGGGCTGGG - Intergenic
1080505765 11:32911665-32911687 CAGGAGAGACAGCAAGTGCAAGG - Intronic
1080802419 11:35619965-35619987 AAAGAGAGAGATCTGGGGCTGGG + Exonic
1081589699 11:44412906-44412928 GAAGAGAGACAGATGGGGCAGGG + Intergenic
1081777273 11:45684329-45684351 CAGGAGAGGCTGCTGTGGCAAGG - Intergenic
1082171974 11:49015735-49015757 CAGGACAGACCGCTGGAGCTTGG + Intergenic
1082689102 11:56277999-56278021 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1083605451 11:63975962-63975984 AAGGAGAGACAGCTGGGGTTAGG - Intronic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1083961202 11:66015957-66015979 AAGGAGAGACCCCTGGGGCCAGG + Intergenic
1084033419 11:66494011-66494033 CAGGACAGACACTTGGGGCAGGG + Intronic
1084202852 11:67573392-67573414 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1084258261 11:67956915-67956937 CAGGAGAGACAGGGGAGACTGGG + Intergenic
1084392986 11:68890783-68890805 GAGGAGGGACAGCTGGGGAGTGG - Intergenic
1084413294 11:69016187-69016209 TAGGAAAGACAGCTAGGCCTTGG - Intergenic
1084801699 11:71548275-71548297 CAGGAGAAGAAGCTGGGGCTCGG + Intronic
1084814487 11:71638295-71638317 CAGGAGAGACAGGGGAGACTGGG - Intergenic
1085245808 11:75099525-75099547 CAGGAGAAACACCTGAGCCTGGG + Intergenic
1085331135 11:75652368-75652390 CAGAAGGGACAGCTGGGGCATGG - Intronic
1085386360 11:76160451-76160473 CTGGAGAGAGACCTGGGGCCCGG + Intergenic
1085721704 11:78918008-78918030 CAGAAGAGAAAACTGAGGCTCGG + Intronic
1086434554 11:86768558-86768580 CAGGTGAGAAAACTGAGGCTTGG + Intergenic
1088489823 11:110375990-110376012 CAGGAAGGGGAGCTGGGGCTAGG - Intergenic
1088599579 11:111462693-111462715 CAGGAGGCACAGGTGGTGCTAGG + Intergenic
1088631115 11:111774795-111774817 CAGGAAAGACAGCCAGGGCCAGG - Intergenic
1089627020 11:119757752-119757774 AAAGAGACACAGCTGGAGCTGGG - Intergenic
1089748956 11:120636745-120636767 CAGGAGAATCACCTGGGCCTGGG + Intronic
1089924796 11:122246229-122246251 CAGGAGAGAGAGCATCGGCTTGG + Intergenic
1090663194 11:128895977-128895999 CAGGAGAGGTGGTTGGGGCTGGG - Intronic
1090759004 11:129819351-129819373 GAGGTGAGAAGGCTGGGGCTGGG + Intronic
1090820167 11:130334977-130334999 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1090978314 11:131694628-131694650 CAGGACAGGGAGCTGGGCCTGGG + Intronic
1202819624 11_KI270721v1_random:63241-63263 CCGCAGAGGCAGCTGCGGCTGGG - Intergenic
1091403019 12:192393-192415 CAGGACACACAACTGGGGCCAGG - Intronic
1091466854 12:692255-692277 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091642853 12:2250658-2250680 CAGGAGGGCCGGCTGGGGTTGGG - Intronic
1091706312 12:2695656-2695678 GAGGACAGGGAGCTGGGGCTGGG - Intronic
1091711540 12:2743885-2743907 GAGGACAGGGAGCTGGGGCTGGG - Intergenic
1091753515 12:3037301-3037323 AGGGAGGGACAGCTGGTGCTGGG + Intronic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1092091288 12:5805656-5805678 CAGGAAACAGAGATGGGGCTCGG - Intronic
1092261546 12:6955795-6955817 GAGGGGAGGCAGCTGGGGCAGGG - Intronic
1092281596 12:7101794-7101816 CTTGAGTGACAGCTGAGGCTGGG - Intronic
1092428513 12:8391720-8391742 CAGGAGAGACAGGGGAGACTGGG + Intergenic
1092429598 12:8397872-8397894 CAGGAGAGACAGGGGAGACTGGG + Intergenic
1092728129 12:11504428-11504450 GAGGACAGGGAGCTGGGGCTGGG + Intergenic
1093091008 12:14920272-14920294 CAGGAGAGAAGGCTGAGGCATGG + Intronic
1093097002 12:14983245-14983267 CAGGAGAGAAAGCAGGTGCCTGG - Intergenic
1094202721 12:27809794-27809816 CAGAAGAAACAGCTGGGTGTAGG - Intergenic
1094644311 12:32306536-32306558 TAGAAAAGAAAGCTGGGGCTGGG - Intronic
1094713400 12:32987193-32987215 CAGGAAACAAAGCTGGGGCCTGG - Intergenic
1095420211 12:42017542-42017564 CAGATGAGACAGCTGAGGTTAGG - Intergenic
1095988195 12:48014806-48014828 CAGGAGGCAGAGCTGGGACTGGG - Intergenic
1096463558 12:51836217-51836239 CAGGGCAGACAGGCGGGGCTGGG - Intergenic
1096621697 12:52869449-52869471 CAGCAGAGACAGCAGGGGAGGGG + Intergenic
1096908234 12:54956258-54956280 CAGAAGAGACAGGAGGGACTAGG - Intronic
1097249535 12:57624947-57624969 CTGGAGTGGCACCTGGGGCTCGG + Exonic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1100094931 12:91022593-91022615 CAGGAGGATCAGCTGGGCCTGGG - Intergenic
1101661991 12:106774434-106774456 CAGGAGAGCAAGCAGGGCCTTGG + Intronic
1102025034 12:109709637-109709659 CAGGTGAGGCAACTGGGGGTGGG + Intergenic
1102418454 12:112784925-112784947 TAAGAGATACAGCTGTGGCTGGG + Intronic
1103342024 12:120225855-120225877 CAGGACAGGCAGCTGGGACAAGG - Intronic
1103516114 12:121509539-121509561 CAGGAGTGGCGTCTGGGGCTGGG - Intronic
1104862883 12:131933831-131933853 AAGGAAAGACAGCTGGGTCCAGG + Intronic
1104899155 12:132178909-132178931 CAGGAGAGGCAGGTGCGGCCCGG - Intergenic
1104927666 12:132322001-132322023 GAGGAGAGACAGTGGGGGTTTGG - Intronic
1104972513 12:132538370-132538392 GTGAAGAGACAGCTGGGGATGGG - Intronic
1105287177 13:19013920-19013942 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1105901039 13:24753435-24753457 CAGGAGAGCCAGTTAGTGCTTGG + Intergenic
1106180990 13:27369212-27369234 CAGGTGAGGCAGCCGTGGCTTGG - Intergenic
1106218229 13:27721953-27721975 CAGGAGAGACAGCTGGGATGTGG + Intergenic
1106374257 13:29169543-29169565 CAGGAGACTCTTCTGGGGCTGGG + Intronic
1106758486 13:32845334-32845356 CAGGTGATACAGCTTGAGCTGGG - Intergenic
1107076111 13:36322484-36322506 CAGGAGAGAAAGCTGTGATTTGG - Intronic
1107086310 13:36431475-36431497 CGGGCGACAGAGCTGGGGCTTGG - Intergenic
1107255745 13:38424955-38424977 CAGGAGGCAAAGCTGGGGCAGGG + Intergenic
1107675082 13:42787458-42787480 GAGGAGAGACAGCAGAGGATGGG - Intronic
1107842556 13:44474293-44474315 CAGGAGTGTCAGTTGGGCCTGGG - Intronic
1108327824 13:49351694-49351716 CAGGAGAGGGAACGGGGGCTTGG + Intronic
1108579545 13:51817102-51817124 CAGGAGAGACACCTGGGGCGTGG + Intergenic
1109595559 13:64549224-64549246 CAGGAGAGAGAGCGAGGGATAGG - Intergenic
1109940092 13:69350440-69350462 CTGGAGAGAAATCTGGAGCTGGG + Intergenic
1111490038 13:88960424-88960446 AAAGAGAGACATTTGGGGCTGGG + Intergenic
1112226516 13:97545491-97545513 CAGGGGAGGCAGCTATGGCTCGG - Intergenic
1112410741 13:99161337-99161359 CAGGCGAGACAGCTTGTGCAGGG + Intergenic
1113775453 13:112942498-112942520 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1113884599 13:113651986-113652008 CAGGAGGCAGAGCTGGGGCGGGG + Intronic
1113914198 13:113861230-113861252 CAGGGGAAACAGCCAGGGCTGGG + Intronic
1114618194 14:24079624-24079646 GAGAAGAGACAGCTGGGGAGGGG + Intergenic
1115990617 14:39146037-39146059 CAGGAGAATCAGCTGGACCTGGG - Intergenic
1116503560 14:45650426-45650448 CAAGAGAGATAGCTGGGGAGAGG + Intergenic
1116814346 14:49569742-49569764 CAGGAGATACAAATGAGGCTTGG + Intergenic
1116915364 14:50520067-50520089 CATAAGACAAAGCTGGGGCTGGG + Intronic
1117285613 14:54283115-54283137 GGGGAGGCACAGCTGGGGCTGGG - Intergenic
1118627632 14:67674214-67674236 CAGCAGGGAGACCTGGGGCTGGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121014006 14:90537416-90537438 CAGGAGAATCAGCTGAGGCCAGG - Exonic
1121114687 14:91335400-91335422 CAGGAGAGACACCTGAGGTCAGG - Intronic
1121422360 14:93824617-93824639 GGGGAGAGGGAGCTGGGGCTTGG + Intergenic
1121554904 14:94829127-94829149 CAGGTGAGGCTGCAGGGGCTGGG - Intergenic
1121585117 14:95058068-95058090 CATGAGAGACACCTGTGGCTGGG - Intergenic
1122272310 14:100573721-100573743 CAGGGGAGACACCAAGGGCTGGG + Intronic
1122548699 14:102538765-102538787 CAGGAGGGCCAGCTGGGCCCAGG + Intergenic
1122687600 14:103517408-103517430 CAGGAGGGACAGCTGAGGTGGGG + Intergenic
1122687930 14:103518799-103518821 TAGGTGAGCCAGCGGGGGCTAGG - Intergenic
1122755943 14:103980202-103980224 AAGAAAAGACAGCTGGGCCTGGG + Intronic
1122768003 14:104085046-104085068 AAGGAGGGACAGCAGGGCCTGGG + Intergenic
1122793798 14:104195604-104195626 CAGGAGACGCAGGTGAGGCTGGG + Intergenic
1122853423 14:104548642-104548664 CTGGGGAGAACGCTGGGGCTGGG - Intronic
1122853452 14:104548714-104548736 CTGGGGAGAATGCTGGGGCTGGG - Intronic
1122854763 14:104554768-104554790 CAGGAGATGCCGCGGGGGCTGGG - Intronic
1122985128 14:105208414-105208436 CAGGACAGACAGCTCTGGCTGGG - Intergenic
1123110212 14:105863700-105863722 CAGGAAAGAAAGCTGGGGAGAGG - Intergenic
1125667944 15:41447096-41447118 CAAGAATAACAGCTGGGGCTGGG - Intronic
1126878774 15:53072226-53072248 GAGAAGAGACAGCTGGTGCAGGG + Intergenic
1126921909 15:53536075-53536097 CAAGAGGCACAGCTGGGACTTGG + Intronic
1126955017 15:53923909-53923931 CAAGAGAGACAGCACGGGCTGGG + Intergenic
1127263013 15:57339427-57339449 CAAGAGAGACAGCTGGTGGTGGG - Intergenic
1127514237 15:59676261-59676283 GAGGAGAGAGAGCTTGAGCTTGG - Intronic
1127773261 15:62247009-62247031 CAGGTGGGTAAGCTGGGGCTGGG - Intergenic
1127774439 15:62254245-62254267 CAGGAGAGGCTGCTGGAGCTGGG - Intergenic
1127849147 15:62897856-62897878 CAGGAAAGAAAGCGAGGGCTGGG + Intergenic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128229954 15:66027521-66027543 CAGAGGGGAAAGCTGGGGCTTGG - Intronic
1128311515 15:66634061-66634083 CAGGAGGGAAAACTGAGGCTCGG - Intronic
1128395242 15:67218329-67218351 CAGGTGATAAAGCTGGGGCAGGG + Intronic
1128429031 15:67573381-67573403 CAGGAGAGACAGTTGGGTAGAGG + Intronic
1128667370 15:69548262-69548284 CAGAAGAGCCAGCTTGGGCCAGG + Intergenic
1129189862 15:73930937-73930959 CAGGAGACCCAGCTGGGCCTGGG - Intronic
1129205079 15:74032727-74032749 CAGGAGGGAAGGCTGGGGCTGGG - Intronic
1129251911 15:74313875-74313897 CAGGCTTGACAGCTGGGCCTTGG + Intronic
1129328257 15:74813219-74813241 GAGGAGAAACAGCTTGGGCAGGG - Intronic
1129389758 15:75214662-75214684 CAGGAGAGACAGGAGGGGCTTGG - Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129496125 15:75982826-75982848 GTGGGGAGACAGCTTGGGCTTGG - Intronic
1130857508 15:87854042-87854064 CAGGTGAGAAAACTGGGGTTTGG - Intergenic
1130861334 15:87893488-87893510 GAGGAGGGACAGCTGTGGTTGGG - Intronic
1131191244 15:90318672-90318694 CTGGAGAGACAGGCTGGGCTGGG - Intergenic
1131331847 15:91507702-91507724 AAGGAGAGACAGCAGGGGACAGG - Intergenic
1132715200 16:1286577-1286599 GGGGAGAGACAGGTGGGTCTGGG + Intergenic
1133027587 16:2995435-2995457 CAGGTGAGACAGATGGGGTCTGG + Intergenic
1133335317 16:5003363-5003385 CAGCAGAGCCAGGTGGAGCTGGG + Intronic
1133369710 16:5238646-5238668 CAGGAGAGACAGGGGAGACTGGG - Intergenic
1134005923 16:10818728-10818750 CAGGAGAGAAAGCGGCGGCAGGG + Exonic
1134270797 16:12731416-12731438 CAGCAGAGACTGCTGGGGCATGG + Intronic
1135060905 16:19270664-19270686 CAGGGTAGGCAGCTGGGCCTGGG - Intergenic
1135424361 16:22324969-22324991 CAGGAGCAAGAGCTGGGGCCTGG + Intronic
1136281764 16:29217675-29217697 GAGGAGAGACAGGTGGTGGTTGG + Intergenic
1137686512 16:50390580-50390602 CAGGAGAGGAAGCTGGTGCGAGG - Intergenic
1137855234 16:51788076-51788098 CAGAAGAGGAAACTGGGGCTTGG - Intergenic
1138008524 16:53358069-53358091 CAGAGGAGACTGCTGGGGCAGGG - Intergenic
1138199577 16:55078763-55078785 AGGGAGAGAAAGCTGAGGCTCGG + Intergenic
1138336851 16:56260210-56260232 CAGTAGCGAGAGCTGGGCCTGGG - Intronic
1138572547 16:57884911-57884933 AGGGAGAGGCTGCTGGGGCTGGG + Intronic
1139352583 16:66346574-66346596 GAGGAGAGATAGGTGGGGCAGGG + Intergenic
1139428053 16:66895449-66895471 CAGGAGACCCAGCTTGGGCTGGG - Intronic
1139430940 16:66910759-66910781 CAGGACAGAGAGCTGGCCCTGGG - Intronic
1139463370 16:67140705-67140727 GGGCAAAGACAGCTGGGGCTAGG - Intronic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1139604646 16:68009470-68009492 CAGCTGGGACAGCTGGTGCTGGG - Intronic
1139990038 16:70933154-70933176 CGGGTGAGACAGCTGGGGATGGG + Intronic
1140005250 16:71068370-71068392 CAGGAGGGAAAACTGGAGCTTGG + Intronic
1140478359 16:75250153-75250175 CAGGAAAGTCACCTTGGGCTGGG - Intronic
1140536315 16:75713205-75713227 GAGGAGATACAGCTGGGTCCTGG + Intronic
1140913136 16:79471447-79471469 CAGGAGTTACAGCTCAGGCTGGG + Intergenic
1140990401 16:80205341-80205363 CCTGAGAGACAGCAGGGACTAGG - Intergenic
1141283603 16:82650911-82650933 CAGGAGAGACAGGTGAAGTTGGG + Intronic
1141647781 16:85376713-85376735 CAGCAGAGGCACCTGTGGCTTGG - Intergenic
1141650935 16:85392826-85392848 CTGGAGAGGCGGCTGGGGCCAGG + Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1142086143 16:88183591-88183613 GAGGAGAGACAGGTGGTGGTTGG + Intergenic
1142192044 16:88722543-88722565 CAGGGGCAGCAGCTGGGGCTCGG + Intronic
1142546575 17:708144-708166 TAGGAAAGACAGCTGGGCCCGGG + Intronic
1142613148 17:1120086-1120108 CAGGTGCGAAAACTGGGGCTCGG - Intronic
1142994454 17:3752349-3752371 CGGGTGAGGAAGCTGGGGCTCGG - Intronic
1143107030 17:4535094-4535116 GAGGCGAGGCAGCTGGAGCTCGG + Intronic
1143295569 17:5869135-5869157 CAGGGGAGATAGCTGGTGCGTGG + Intronic
1143388683 17:6547428-6547450 TAGGGGGGACAGCTGGGCCTTGG - Intronic
1143587964 17:7860822-7860844 CAGGAGAGAAATCTGGGGTATGG - Exonic
1143835253 17:9686845-9686867 GAGGATAGACTGCTGGAGCTGGG - Exonic
1143975880 17:10829277-10829299 CAGAGAAGATAGCTGGGGCTGGG + Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144508100 17:15850644-15850666 CAGGAGAGACAGCAGCTGCTGGG - Intergenic
1144628234 17:16856450-16856472 GAGGAGAGCAAGGTGGGGCTGGG + Intergenic
1144655072 17:17029987-17030009 GAGGAGAGAGAGGTGGGGTTGGG - Intergenic
1144832745 17:18140620-18140642 CAGGAGTGACTGCTGGAACTTGG - Exonic
1144952394 17:19001248-19001270 CAGGGCAGAAAGCAGGGGCTTGG + Intronic
1145159826 17:20567017-20567039 GAGGAGAGCAAGGTGGGGCTGGG + Intergenic
1145172220 17:20668282-20668304 CAGGAGAGACAGCAGCTGCTGGG - Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146289790 17:31598931-31598953 CAGGAGGGCCAGCTGAGGATGGG + Intergenic
1147006907 17:37410628-37410650 CAGTTGAGCCACCTGGGGCTAGG + Intronic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147320392 17:39642420-39642442 CAGGAGAGGCAGCCTGGGCAGGG + Intronic
1147545019 17:41394448-41394470 CAGGAAAGTAAACTGGGGCTTGG - Intronic
1147584175 17:41643582-41643604 CAGGAGAAGCAGGTGGAGCTAGG + Intergenic
1147836783 17:43338508-43338530 AAGAAAAGACAGCTGGGGCTGGG + Intergenic
1147841132 17:43372298-43372320 TAGGAAAGACAGCTGGGCCCAGG + Intergenic
1147900162 17:43778659-43778681 CGGGAGCCACAGCGGGGGCTTGG - Intronic
1148142671 17:45339471-45339493 CAGAAGAGGAAACTGGGGCTTGG - Intergenic
1148385641 17:47232709-47232731 CAGGAGAATCACCTGGGGCCAGG - Intergenic
1148623933 17:49054677-49054699 CTGGAGTGAGACCTGGGGCTTGG + Exonic
1148733601 17:49852057-49852079 CAGGAGATAAAGCAGGGGCAGGG + Intergenic
1149043796 17:52220943-52220965 AAGTAGAGACAGCTGGGGAGTGG - Intergenic
1149368782 17:55971855-55971877 GAGAAGAGAGAGCTGGAGCTGGG - Intergenic
1149610690 17:57955857-57955879 GAGGACGCACAGCTGGGGCTTGG + Intergenic
1150107456 17:62472770-62472792 CAGGAGAGACAGGTGGACCTGGG + Intronic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151535665 17:74737516-74737538 CAGCAGAGACACCTAGAGCTTGG - Intronic
1151828056 17:76534729-76534751 CTGGAGAGACAGCTGTGCCAGGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152244139 17:79176462-79176484 AAGGAGACCCAGTTGGGGCTGGG - Intronic
1152293615 17:79454374-79454396 CAGGAGGGGCAGGAGGGGCTGGG - Intronic
1152430575 17:80246359-80246381 CAGGAGACTGAGCAGGGGCTGGG + Intronic
1152508817 17:80771577-80771599 CAGGGTAAACACCTGGGGCTGGG - Intronic
1152577971 17:81151273-81151295 TGGGGGAGACAGGTGGGGCTGGG - Intronic
1152682547 17:81676644-81676666 GATGAAAGACAGCTGGGCCTGGG - Intergenic
1152742319 17:82023693-82023715 CAGGACAGCCTCCTGGGGCTCGG - Exonic
1153017539 18:597143-597165 GAGGAGAGAAATCTGGGGCCCGG - Intronic
1153042412 18:826332-826354 CAGGAGAGACAGCTCCGGAAAGG + Intergenic
1153759403 18:8316205-8316227 CAGTAGAGACTGCAGGAGCTGGG - Intronic
1154070882 18:11149939-11149961 CAGGAGAGAAGCCAGGGGCTTGG + Intergenic
1154199328 18:12288242-12288264 CAGCTGAGACAGCTGGGGCGGGG + Intergenic
1154354683 18:13616107-13616129 AAGGAAAGACACCTGGGGTTTGG - Intronic
1157238096 18:45982788-45982810 CAGAACACACAACTGGGGCTGGG - Intergenic
1157437730 18:47685248-47685270 CAGGAGTGACTGCTGGGGCAAGG + Intergenic
1159026126 18:63183487-63183509 CATGAGAGACAGCTGCAGATGGG + Intronic
1160614184 18:80111366-80111388 CAGAAGAGCCAGCTGAGGCCTGG + Intronic
1160783258 19:887821-887843 CCAGAGAGACAACTGGGTCTCGG + Intronic
1161168938 19:2803581-2803603 CAGGAGTGACGGCTGGCGGTCGG - Intronic
1161314092 19:3609849-3609871 CAGGACAGGCTGCTGGGGCAGGG - Intergenic
1161449717 19:4338405-4338427 CGGGAGAGACAGACGGGGCCAGG + Intronic
1161574809 19:5049380-5049402 CAGGGGAGACAGCTGGGGCGGGG + Intronic
1161619015 19:5288770-5288792 TGGGAGAGCCAGCTGTGGCTGGG - Intronic
1161809626 19:6464521-6464543 CAGGAGAGACAACTGGCGCCAGG - Intronic
1161894019 19:7066746-7066768 AAGAAAAGACAGCTGGGACTGGG + Intergenic
1161981837 19:7633977-7633999 AAGGAGACAGAGCTGGAGCTAGG - Intronic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162089484 19:8269620-8269642 AAGGAAAGACAGCTGGGGCCTGG - Intronic
1162237955 19:9323046-9323068 AAGGAAAAACACCTGGGGCTGGG - Intergenic
1162290526 19:9776658-9776680 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1162392459 19:10397835-10397857 GGGGAGTGACATCTGGGGCTGGG - Intronic
1162524478 19:11199435-11199457 CAGCACAGACAGCTGAGGCCCGG + Exonic
1162818570 19:13209898-13209920 CAGGAGAGCAAGCTGGGGCAGGG - Intronic
1162908602 19:13837530-13837552 CAGGAGAGTCACCTGAGGCCAGG + Intergenic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163075607 19:14888468-14888490 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1163150944 19:15413678-15413700 CAGTGGAGACCGCAGGGGCTGGG - Intronic
1163295924 19:16412776-16412798 CAGCAGTGGCATCTGGGGCTGGG + Intronic
1163472469 19:17505535-17505557 CAGGAGGGGAAGGTGGGGCTGGG - Exonic
1163631885 19:18421685-18421707 CAGGAAAAGGAGCTGGGGCTGGG + Intronic
1163632946 19:18426384-18426406 CACGAGAGTCTGCTGGGGGTTGG - Intronic
1163691150 19:18739162-18739184 CAGGTGAAACAGCTGAGGCCTGG - Intronic
1163823107 19:19507573-19507595 CAGGAGCTGGAGCTGGGGCTGGG - Exonic
1164653695 19:29904287-29904309 CAGGAGAGATAGCTGAGTTTTGG + Intergenic
1165059448 19:33197970-33197992 CAGCAGACAGGGCTGGGGCTAGG - Intronic
1165093798 19:33399967-33399989 CAGGCGGCAGAGCTGGGGCTGGG + Intronic
1165183232 19:33991195-33991217 CAGGAGAGACAGTTTGGATTTGG + Intergenic
1165291999 19:34893439-34893461 CAGGAGAACCAGCTGAAGCTGGG + Intergenic
1165886890 19:39084736-39084758 CAGGATGGAAAGCTGGGGATGGG + Intronic
1165943750 19:39428884-39428906 AAGGCGACAGAGCTGGGGCTGGG - Intergenic
1165981466 19:39727850-39727872 CGGGATAGACAGCTTGGGCTGGG + Intergenic
1166075144 19:40409891-40409913 CAGAGGAGACACCTGAGGCTGGG + Intronic
1166310177 19:41958408-41958430 GCGGTTAGACAGCTGGGGCTGGG + Intronic
1166369628 19:42293684-42293706 CAGGGGCTACAGCTGGAGCTGGG - Exonic
1166415035 19:42589166-42589188 CAGTAGAAACAGCGGGGGTTTGG - Intronic
1166465541 19:43027635-43027657 CCCAAGAGACAGCTGGGGGTAGG + Intronic
1166496281 19:43305382-43305404 CAGGACAGTCAGCTGGGCCAAGG - Intergenic
1166583472 19:43924458-43924480 CAGGCGAGGAAGCTGAGGCTTGG + Exonic
1167081381 19:47278386-47278408 AAAGAGAATCAGCTGGGGCTGGG - Intergenic
1167163007 19:47779854-47779876 CAGGTGAGAAAACTGAGGCTGGG + Intronic
1167206817 19:48108076-48108098 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1167392833 19:49207852-49207874 AAGAAAAGACAGCTGGGCCTGGG + Intronic
1167534557 19:50041484-50041506 AAGCTGTGACAGCTGGGGCTGGG - Intronic
1167705740 19:51079886-51079908 AAGGAGAGGCAGCTGGGGCTGGG - Intronic
1167865317 19:52320882-52320904 CAGGAGAGATCGCTTGAGCTGGG + Intronic
1168153269 19:54460378-54460400 CAGGGGAGGCAGCGAGGGCTGGG + Intronic
924997420 2:375048-375070 TAAGGGAGACAGCTGAGGCTGGG - Intergenic
926128476 2:10286070-10286092 CAGGAGGGAGCGCTTGGGCTCGG + Intergenic
926226366 2:10969885-10969907 CTGGAAAGACTGCTGGGTCTAGG - Intergenic
927012449 2:18919240-18919262 CAGGAGACACAGCTGACACTGGG + Intergenic
927397122 2:22665352-22665374 CTCGAGAGACAGTTGGGGGTAGG - Intergenic
928714762 2:34047605-34047627 CAGATGAGAAAACTGGGGCTTGG + Intergenic
929971022 2:46576825-46576847 CAGAAGAGACAGTGGAGGCTGGG + Intronic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
931022667 2:58067063-58067085 CAGGAGAGAAAGATGAGGGTTGG - Intronic
931184826 2:59939741-59939763 CAGAAGAGAAAGCTTGGGTTTGG + Intergenic
932580415 2:72989680-72989702 GAGGAGAGAAAGATGGGGTTGGG + Intronic
932591777 2:73071756-73071778 CGGGAGAGGCAGCTGTGGCGGGG - Exonic
932712883 2:74080795-74080817 GAGGACAAACAGCTGAGGCTGGG - Intronic
933182756 2:79245781-79245803 TAGGAAAGACATTTGGGGCTGGG - Intronic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936528104 2:113255836-113255858 CACGAGAGACAGCTCAAGCTAGG + Intronic
937210470 2:120266185-120266207 CAGGAGAGTCACTTGAGGCTAGG + Intronic
937288459 2:120767673-120767695 CAGGCGAGGCAGTGGGGGCTGGG - Intronic
937309512 2:120893399-120893421 CAGCAGGGCCAGCGGGGGCTGGG - Intronic
937413503 2:121696653-121696675 GAAGAGGAACAGCTGGGGCTGGG + Intergenic
937430773 2:121836191-121836213 CTGGAGAGACCCCTGGGGCAGGG - Intergenic
937670090 2:124529510-124529532 CAGAAGGGAAAGCTGGGGCAAGG + Intronic
937677643 2:124609359-124609381 CAGGAGAATCAGTTGAGGCTAGG + Intronic
938125447 2:128667642-128667664 CAGGAGAGACGGCTGGGGTGAGG + Intergenic
938156951 2:128949844-128949866 CAGGAAAGGCAGGAGGGGCTGGG - Intergenic
938767605 2:134470764-134470786 CAGGAGAGCCATCTGGGCCTGGG - Intronic
940252577 2:151695784-151695806 CAGAAGAGACATCTAGAGCTTGG + Intronic
940607228 2:155941571-155941593 CAGGAGAGAGAGAGAGGGCTAGG + Intergenic
940725060 2:157327697-157327719 CAGTAGAGACAGTTGTGGCCAGG + Exonic
941628339 2:167855388-167855410 CAGAAGAGAAAGCTGAGGCCTGG - Intergenic
941697664 2:168570768-168570790 CAGAAGAAAAATCTGGGGCTTGG - Intronic
942267670 2:174244715-174244737 CAGGAGAAACAGCTTGAGCCCGG - Intronic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
946308225 2:218868211-218868233 CAGGAGGTAGGGCTGGGGCTGGG - Intronic
946429218 2:219615704-219615726 CAGGTGAGGAAGCTGAGGCTTGG + Intronic
947288692 2:228546957-228546979 AGGGAGAGACCGCTGGAGCTAGG - Intergenic
947551668 2:231050911-231050933 CAGGAGCCCCAGCTGGGGCTGGG - Intergenic
947602412 2:231462287-231462309 CAGATGAGAAAGTTGGGGCTTGG - Intronic
947798959 2:232915099-232915121 CAGGAGAGCCAGGAGGGTCTGGG - Intronic
947903941 2:233745923-233745945 CAGAAGGGACAGCTGGGGGTTGG + Intronic
947905344 2:233757278-233757300 CAGAAGGGACAGCTGGGGGTTGG + Intronic
948074526 2:235155668-235155690 CCGGAGGGACGGCTGGGGCCTGG + Intergenic
948358565 2:237400643-237400665 CAGGAGAGACATCTGGTCCTGGG - Intronic
948543146 2:238704064-238704086 CAGCAGCTGCAGCTGGGGCTAGG + Intergenic
948832212 2:240603654-240603676 CAGGGGAGATAGCTGGCGCCTGG - Intronic
948841035 2:240649061-240649083 GAGGAGAAGCAGCTGGGGCCGGG - Intergenic
948924154 2:241083144-241083166 CAGGAGAGCCTGCTGGGGATGGG + Intronic
948964475 2:241366815-241366837 CAGTTGAAAAAGCTGGGGCTGGG + Intronic
1168955657 20:1832584-1832606 CCGGAGAGGGAGCTGGGGCTCGG + Intergenic
1169091784 20:2865347-2865369 CAGGAGAGGCAGGTGGTCCTGGG - Intronic
1170075831 20:12417735-12417757 CAGTGCAGACAGCAGGGGCTGGG - Intergenic
1170438617 20:16355209-16355231 CAGGGGAGACGGCTGGCTCTAGG + Intronic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1170868809 20:20185561-20185583 CAGGAAAGACAGCTGGGTGGAGG + Intronic
1171199997 20:23233171-23233193 CAGCAGTCACAGCTGGGGTTGGG - Intergenic
1171428564 20:25064150-25064172 CAGGAGAGGCAGCTTGGGAATGG - Intergenic
1172122913 20:32609167-32609189 CAGGAGAGTAAACTGAGGCTCGG + Intergenic
1172178627 20:32987407-32987429 CAGCAGGGGCTGCTGGGGCTAGG - Intronic
1172661952 20:36574153-36574175 CGAGAGTGACAGCTGGGGGTGGG + Intronic
1172668013 20:36614130-36614152 CAGGCTCGACAGGTGGGGCTGGG - Intronic
1172910997 20:38408709-38408731 CTGGAGAAACAGCTGGGCTTTGG - Intergenic
1173018124 20:39245336-39245358 GAGGAGGGGCAGCTGGGGGTGGG + Intergenic
1174024807 20:47565274-47565296 TAAGAGAGACATCTGGGGCCAGG - Intronic
1174067078 20:47873327-47873349 AAGAGGAGACAGCTGGGGCCTGG + Intergenic
1174416088 20:50368182-50368204 CAGCAGGGAGAGCGGGGGCTTGG - Intergenic
1174421151 20:50399925-50399947 CAGGTGAGAGAGGTGGGGCTGGG - Intergenic
1174457955 20:50662755-50662777 CAGGTGAGAAAGCTGAGGCTTGG - Intronic
1174635177 20:51993330-51993352 CAGGAGAATCAGTTGAGGCTAGG + Intergenic
1174972606 20:55293306-55293328 GTGGAGAGACAGTTTGGGCTGGG + Intergenic
1175238894 20:57532028-57532050 CAGGAAAAACAGCTGGGAGTGGG + Intergenic
1175625579 20:60486063-60486085 CAGCAGAGGCAGCTGGGGGTGGG + Intergenic
1175681461 20:60991837-60991859 CCGGAGACACATCTGGGTCTGGG + Intergenic
1175892808 20:62322912-62322934 CAGGGGAGGCAGCTGGGGAGTGG - Intronic
1176064465 20:63187511-63187533 CGGGAGAGAGAGCAGAGGCTGGG - Intergenic
1176064489 20:63187607-63187629 CTGGAGAGACTGCAGAGGCTGGG - Intergenic
1176195688 20:63835579-63835601 CTGGAGCGGCAGTTGGGGCTTGG - Intergenic
1176256671 20:64156627-64156649 GAGGAGAGACAGCTGAGGGCTGG - Intronic
1176265738 20:64208406-64208428 GAGCAGAGCCAGCTGGGCCTGGG + Exonic
1176412551 21:6457045-6457067 CAGGTGAGGCACCTGGGGCCTGG - Intergenic
1176420263 21:6508477-6508499 AAGGAAAGACAGGTGGGCCTGGG + Intergenic
1178594499 21:33940864-33940886 CAGGGGAGGCAGCTGGTGCCAGG + Intergenic
1178732451 21:35117225-35117247 CAGGAAGGAGAGCTGGGTCTGGG + Intronic
1178886644 21:36490007-36490029 TAAGAGATACAGCTGGGCCTGGG - Intronic
1179658189 21:42858605-42858627 CATGAGGGACAGATGGGGCCTGG + Intronic
1179688045 21:43065367-43065389 CAGGTGAGGCACCTGGGGCCTGG - Exonic
1179695755 21:43116797-43116819 AAGGAAAGACAGGTGGGCCTGGG + Intergenic
1179906323 21:44425008-44425030 GAGGAGAGGCAGCTGGGGGTGGG + Intronic
1179944441 21:44661756-44661778 CAGGAGAGAAAGACGGGGCTGGG + Intronic
1180143775 21:45908757-45908779 CAGGAGACAGAGCTGGGCTTTGG - Intronic
1180169734 21:46051631-46051653 CACGGGAGACAGCTGGTTCTCGG - Intergenic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1181048896 22:20229492-20229514 CAGAAGAGACAACTGAGGCATGG + Intergenic
1181298486 22:21861545-21861567 GAGTTGAGACAGCTGGGGGTAGG - Intronic
1182043167 22:27254148-27254170 CAGAAGAGAGAGTTGGGGATTGG + Intergenic
1182416037 22:30222072-30222094 CAGGAGATAAAACTGAGGCTTGG + Intergenic
1182821700 22:33222268-33222290 CAGGAGAGACAGCCAGGGTTAGG + Intronic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1183086863 22:35491910-35491932 CAGGGGACACATCTGGGGCAGGG - Intergenic
1183165734 22:36145929-36145951 CAAGAGAGACAGCGAGGGCGGGG - Intronic
1183304246 22:37073685-37073707 CAGAGGAGCCAGCCGGGGCTTGG + Intronic
1183344343 22:37298868-37298890 CAGATGAGGAAGCTGGGGCTGGG + Intronic
1183667671 22:39254794-39254816 CTGGAGAGAAAGCTGGGCCAAGG - Intergenic
1183726444 22:39592558-39592580 TAGGCGAGGCAGCTGGGCCTTGG + Intronic
1183884086 22:40862596-40862618 TATGAGAGACAGCTCAGGCTGGG + Intronic
1183949557 22:41345174-41345196 TAGCAAAGACAGCTGAGGCTCGG + Intronic
1184105566 22:42365706-42365728 GAGGAGAGGCAGCTGGGGAGGGG + Intergenic
1184205053 22:42996858-42996880 CAAGTGAGAAAGCTGGGCCTAGG - Intronic
1184257392 22:43294991-43295013 CAGGTGAGAAAACTGGGGCCTGG + Intronic
1184293791 22:43511482-43511504 CAGAAGAGGGAGCTGAGGCTCGG + Intergenic
1184450604 22:44580365-44580387 CAGGAGAGGAAGCTGAGGCTGGG + Intergenic
1184455568 22:44607883-44607905 CGGGAGAGGCTGCTGTGGCTGGG - Intergenic
1184475646 22:44719922-44719944 CAAGAGAGACAGCTGTGGGAAGG - Intronic
1184519196 22:44982422-44982444 CAGATGAGAAACCTGGGGCTCGG + Intronic
1184655057 22:45936910-45936932 GAGGAGTGGCAGCTGCGGCTGGG - Intronic
1184726144 22:46347799-46347821 CAGCAGAAGCAGCAGGGGCTGGG - Intronic
1184743448 22:46442492-46442514 CAGGAGCCACAGCTGGGGGCAGG - Intronic
1184791529 22:46703331-46703353 CAGGAGGGGCAGGTGGGGGTTGG - Intronic
1185071915 22:48661309-48661331 AAGGAGAGAGGGCTGGGGCAAGG - Intronic
1185094501 22:48798896-48798918 CAGGAGAAACAGCTGAGCATGGG - Intronic
1185233938 22:49700190-49700212 CAGGAGAGACTGCAGGAACTGGG - Intergenic
1185295233 22:50049807-50049829 GAGGAGGGACAGCTGAGGCCGGG + Intronic
950005606 3:9689206-9689228 CAGTAGAGACAGCAGGAGCACGG - Intronic
950289308 3:11770874-11770896 GGGGAGAGACACCTGGGACTAGG - Intergenic
950390615 3:12693799-12693821 CAGGAGCTCCAGCTGGGGCCTGG - Intergenic
950525322 3:13519608-13519630 TTGGAGAGACTGCTGGGGCTGGG + Intergenic
950711324 3:14814803-14814825 CAGGAAAGACTGCAGGTGCTGGG - Intergenic
951149245 3:19267855-19267877 CAGAAGAGAAAACTGAGGCTCGG - Intronic
952007705 3:28861232-28861254 TGGGAGTGACAGCTGGGGCTGGG - Intergenic
952758357 3:36891901-36891923 TAGGACAGACAGCTGTTGCTGGG - Intronic
952860351 3:37807584-37807606 CGAGAGAGAGATCTGGGGCTGGG + Intronic
952866192 3:37856668-37856690 CAGGAGAGAGACCTGTGGGTGGG + Intergenic
952892280 3:38051355-38051377 CAGCAGGGACAGGTGGGGTTGGG - Intronic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
952970458 3:38647664-38647686 CACCAGAGACAGCTGGGGATGGG - Intronic
953005358 3:38972468-38972490 GGTGAGAGACAGCTGGGGCCTGG - Intergenic
953342194 3:42144105-42144127 CAGGAGTGACAGGTGGGGTGAGG - Intronic
953376673 3:42434536-42434558 AAGGAAAGACAGCTGGGTTTTGG - Intergenic
953680516 3:45035228-45035250 AAGGGGTGTCAGCTGGGGCTGGG + Intronic
953755793 3:45644864-45644886 CAGGAGAGTGGCCTGGGGCTGGG + Intronic
953878752 3:46680876-46680898 CAGGAGACGCAGCTGGGGTGAGG + Intronic
954273851 3:49529773-49529795 AAGGAGCCACAGATGGGGCTGGG + Intronic
954299821 3:49694878-49694900 CAGGAGAGACAGCAGGTGGTAGG + Intronic
954660461 3:52224274-52224296 CAGGAGAGACAGCGGGTGCAGGG + Exonic
954914973 3:54140895-54140917 CAGCTGAGAAAACTGGGGCTTGG + Intronic
955402769 3:58605218-58605240 TGGGAGAGTCAGCTGGGGCTGGG - Intronic
955848667 3:63195635-63195657 CAGGAGTGACACTTGAGGCTAGG - Intergenic
956648860 3:71484614-71484636 CAGAAGAGAAAACTGAGGCTTGG + Intronic
956837110 3:73104409-73104431 CAGGAGAGACATTTGGGGCTGGG - Intergenic
957073217 3:75581435-75581457 CAGGAGAGACAGGGGAGACTGGG + Intergenic
957357753 3:79114067-79114089 CAGGAAAGACAGCTTGTGCAGGG - Intronic
958069405 3:88590586-88590608 TAATAGAGACAGCTGGGGATGGG - Intergenic
958657235 3:97018344-97018366 AAGGAAAGACAGCTGGGCCCGGG + Intronic
960047273 3:113210903-113210925 GGGGAGGGAGAGCTGGGGCTGGG - Intergenic
960967175 3:123113423-123113445 CAGAAGAGAAAGCTGGGGCAGGG + Intronic
961214598 3:125149320-125149342 CAGTAGAGACAGCTGGGTTTTGG + Intronic
961235853 3:125366388-125366410 TAGGAGAGTCAGTTGGGGTTGGG - Intronic
961280867 3:125765345-125765367 CAGGAGAGACAGGGGAGACTGGG - Intergenic
961506163 3:127371887-127371909 CAGAGGAGACAGATGGGGCTGGG + Intergenic
961698514 3:128723666-128723688 CAGGAGCGACAGCTGCCACTGGG + Intergenic
961719409 3:128882856-128882878 CAGGAGAGATTGCAGGGGCGTGG - Intronic
961816996 3:129556186-129556208 GAGCAGAGACGGCTGGGGCGGGG - Exonic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
961873523 3:130004240-130004262 CAGGAGAGACAGGGGAGACTGGG + Intergenic
962234059 3:133692932-133692954 CCGATGAGCCAGCTGGGGCTGGG + Intergenic
962299813 3:134229328-134229350 AAGGAGAGACAGAAGGGGTTGGG - Intronic
962317873 3:134370061-134370083 CAGGAGAGGCTGCTGGGCCATGG - Intronic
963248479 3:143083989-143084011 CAGGTGGGACAGCCAGGGCTGGG + Intergenic
963969727 3:151416331-151416353 CTGGGGAGGCTGCTGGGGCTGGG - Exonic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
966680547 3:182637777-182637799 CAGTAGAGCTAGGTGGGGCTGGG - Intergenic
967741747 3:193010553-193010575 CAGGAAAGAAAGCGGGGCCTAGG - Intergenic
967760779 3:193224252-193224274 CAGGAGAGTCACCTGGACCTGGG - Intergenic
968049093 3:195641993-195642015 CAGGGGAGAGGGCTGGTGCTGGG + Intergenic
968925813 4:3547447-3547469 CAGGGGAGACAGCTTGGGACGGG - Intergenic
969016813 4:4108729-4108751 CAGGAGAGACAGGGGAGACTGGG + Intergenic
969637426 4:8377500-8377522 CAGGAGACAACGCTGAGGCTTGG - Intronic
969737148 4:8999586-8999608 CAGGAGAGACAGGGGAGACTGGG - Intergenic
970155680 4:13139686-13139708 CAGCAGAGACAGGTGGCTCTTGG - Intergenic
970652773 4:18196909-18196931 CTGGAGAGACAGCTCCAGCTGGG + Intergenic
971468217 4:26988429-26988451 AAGGAGAGACAGTGGGGCCTGGG + Intronic
973720824 4:53721617-53721639 CAGGTGAGAGAGTTGGGGATTGG + Intronic
974240023 4:59235311-59235333 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
974286777 4:59879108-59879130 CTGGAGAGACAGCTCCAGCTGGG - Intergenic
974493450 4:62596023-62596045 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
976190327 4:82480762-82480784 CAGGAGAGATAGCAGTGGTTTGG + Intergenic
976364256 4:84215347-84215369 TATGACAGACAGCTGGGGCTGGG - Intergenic
976598308 4:86914834-86914856 AAGGAGAGAAAGCTGGGGTCGGG + Intronic
978308059 4:107353912-107353934 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
978553279 4:109950742-109950764 GAGGAGAGACAGCTGGTGAAGGG - Intronic
979218111 4:118190667-118190689 CAGGAGGCAAAGCTGGGGCAGGG + Intronic
979660834 4:123253185-123253207 CAAAAGAAATAGCTGGGGCTGGG + Intronic
979783087 4:124680818-124680840 CAGGAGAAATAGCTGGGGGTAGG + Intronic
981258883 4:142696002-142696024 AAGGAGAGCCAGCTGGGACTAGG + Intronic
981956022 4:150475389-150475411 CAGGAAAGACAACTGGGTCTGGG + Intronic
982305154 4:153923014-153923036 CAGGAGAGAGAGCTGACTCTAGG - Intergenic
983504086 4:168533684-168533706 CTGGAGAGATAGCTGGGCCATGG + Intronic
983946703 4:173594110-173594132 CAGGAGAAAGAGTTGGGGGTGGG + Intergenic
984187744 4:176566873-176566895 CAGTTGAGACATCTGGGGGTGGG - Intergenic
984702173 4:182825546-182825568 GAGGAGAGACAGAGGGGCCTGGG - Intergenic
984811562 4:183799873-183799895 CAGCAGAGACAGCTCAGGCCAGG - Intergenic
984881443 4:184413166-184413188 CAGGAGAGACTGCTGTGGAAAGG - Intronic
984959742 4:185085009-185085031 CAGAAGGGCCAGGTGGGGCTGGG + Intergenic
985291301 4:188390948-188390970 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
985564019 5:606345-606367 CAGGAAGGACTGGTGGGGCTGGG - Intergenic
985663211 5:1167724-1167746 CAGGAAATGCAGCTGGGGATGGG + Intergenic
987130395 5:14854824-14854846 CCAGAGAGACAGCTGTGGCCTGG - Intronic
990229401 5:53695361-53695383 CAAGAGAGACAGTTGGGGAGAGG - Intergenic
990973654 5:61537736-61537758 AAGAAGAGTCAGCTGGGTCTGGG - Intronic
991927309 5:71718521-71718543 CAAAAGAGAAAGCTGAGGCTTGG + Intergenic
992243990 5:74798954-74798976 AAGGAGAGAAAGCTGGGGTCGGG - Intronic
992747621 5:79835125-79835147 CAGGAAAGTCAGCTGAGGCTGGG + Intergenic
993140547 5:84027702-84027724 CAGGATAGACAGCAGGGAGTGGG + Intronic
994516214 5:100775538-100775560 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
995145908 5:108787020-108787042 CTGCAGAGCCAGCAGGGGCTGGG + Intronic
996184317 5:120457853-120457875 AAGAAAAGACAGCTGGGTCTAGG + Intergenic
996533590 5:124552147-124552169 CAGGAAATACAGTTGGTGCTGGG - Intergenic
996566186 5:124881615-124881637 CAGAAGAGAAACCTGGGGCTGGG - Intergenic
996823630 5:127657212-127657234 CAGAAGAGCCACCTGGGGCCAGG - Intronic
997596762 5:135112226-135112248 GAGCAGAGACAGATGTGGCTGGG + Intronic
997847402 5:137300542-137300564 CAGGGGAGACAGTTTGGACTTGG - Intronic
998308506 5:141102649-141102671 CGGGAGAGGCAGGTAGGGCTGGG - Exonic
998316715 5:141189318-141189340 CGGGAGAGGCAGGTAGGGCTGGG - Exonic
998317347 5:141194552-141194574 CGGGAGAGGCAGGTAGGGCTGGG - Exonic
998318979 5:141210907-141210929 CGGGAGAGGCAGGTAGGGCTGGG - Exonic
998319544 5:141216123-141216145 CGGGAGAGGCAGGTAGGGCTGGG - Exonic
998420110 5:141977084-141977106 CAAGAGAGGCAGCTGGGGCTGGG - Intronic
999198975 5:149802681-149802703 CAGATGGGGCAGCTGGGGCTGGG + Intronic
999357916 5:150954340-150954362 CAGGAGAGTCACTTGGGCCTAGG + Intergenic
999771921 5:154782497-154782519 AAAGATAGTCAGCTGGGGCTGGG + Intronic
999902455 5:156099505-156099527 CAGGAGAGTCACCTGAGCCTGGG - Intronic
1000014446 5:157265546-157265568 CAGAAGATGCAACTGGGGCTAGG - Intergenic
1000151307 5:158503895-158503917 CAGGGGAGAGAGCTGGAGGTAGG + Intergenic
1000852332 5:166355784-166355806 CAGCAGAGTCAGCAGGGGCCAGG + Intergenic
1001673106 5:173490852-173490874 CCCCAGAGACAGCTGGGGCATGG + Intergenic
1002054890 5:176593131-176593153 TAGGAAAGCCAGCTGGGGGTGGG + Intronic
1002108865 5:176894533-176894555 CAGGAGTGACAGCGGTGGCTGGG - Intronic
1002345271 5:178544301-178544323 CAGGAGCTCCAGCAGGGGCTGGG - Intronic
1002915691 6:1526185-1526207 GTGGACAGACAGGTGGGGCTGGG - Intergenic
1004314077 6:14571171-14571193 CAGGAGGGACAGGTGAGGCGGGG - Intergenic
1005670280 6:28098914-28098936 CAGGAGATACAGCTGGGCCAGGG - Intergenic
1005815064 6:29543910-29543932 CAGTAGAGACATCTGGGCCTGGG + Intergenic
1005825188 6:29628039-29628061 CAGGAGGGAGATGTGGGGCTGGG + Intronic
1006011783 6:31048377-31048399 CAGCAGAGGGAGCTGGGGCTGGG + Intergenic
1006227598 6:32553467-32553489 CAGGTGGGAGATCTGGGGCTGGG - Intronic
1006230255 6:32580338-32580360 CAGGTGGGAGATCTGGGGCTGGG - Intronic
1006382095 6:33704915-33704937 CAGGACAGACAGGAGGGGCATGG + Intronic
1006387495 6:33739453-33739475 CTGGAGCTTCAGCTGGGGCTGGG + Intronic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006502122 6:34465854-34465876 CAGGCAAGACTGCTGGGGCAGGG + Intergenic
1006816001 6:36850405-36850427 GCGTAGAGACAGCTGAGGCTAGG + Intergenic
1006902194 6:37510469-37510491 CTGGAGAGACAGATGTGCCTGGG + Intergenic
1006915206 6:37589505-37589527 CAGGGGTGAGGGCTGGGGCTGGG + Intergenic
1006933883 6:37704225-37704247 CAGTGGAGTCAGATGGGGCTGGG - Intergenic
1007092520 6:39193110-39193132 CAGAAGAGAAAGCTGAGGCAGGG + Intronic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007318586 6:41009824-41009846 CAGGAAAGAAAGCTGAGGCACGG - Intergenic
1007344933 6:41222427-41222449 CAGAACAGACAAGTGGGGCTTGG - Intergenic
1007378441 6:41471609-41471631 CAAGAGAGACAGATAGGGGTGGG + Intergenic
1007406819 6:41640129-41640151 CCGGAGGGACAGCTGGGGGCAGG + Intronic
1007450553 6:41938356-41938378 AGAGAGAGACAGCTGTGGCTGGG - Intronic
1007728915 6:43933843-43933865 CAGGACAGCCAGAGGGGGCTGGG - Intergenic
1008466737 6:51839972-51839994 AAGAAGACAGAGCTGGGGCTTGG - Intronic
1008628013 6:53336566-53336588 TAGGAGGGACACCTGGGCCTGGG + Intronic
1008639632 6:53448575-53448597 TAGATGAGACAGCTGAGGCTTGG + Intergenic
1010211182 6:73363736-73363758 CTGGAGAGACTGCTGGGTCCCGG - Exonic
1010559542 6:77333074-77333096 CCGCAGAGCCAGCAGGGGCTGGG + Intergenic
1010862542 6:80931371-80931393 CAGGAGAATCACCTGGGCCTGGG - Intergenic
1010873742 6:81074824-81074846 CTTGAGAGAGAGCTGGGACTGGG + Intergenic
1011509595 6:88086089-88086111 CAGTAGAAAAATCTGGGGCTAGG - Intergenic
1011594140 6:88999942-88999964 CAGGAGATACAGCTGGGTCAGGG - Intergenic
1011649430 6:89492180-89492202 CTGGAGAGAGCGCCGGGGCTGGG + Intronic
1011702909 6:89972104-89972126 CAGGAGCAGCAGCTGGGGCAAGG + Intronic
1013181681 6:107721710-107721732 CAGGAGAGACAACTGTGGCCTGG + Intronic
1013470334 6:110458351-110458373 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1013503614 6:110776632-110776654 GAGAAGATACAGCTGAGGCTGGG - Intronic
1014480730 6:121933326-121933348 CAGGAAAGAAAACTGGGGTTGGG - Intergenic
1014545730 6:122733298-122733320 CTGGAGAGCCGGCTGGTGCTAGG - Intergenic
1015657674 6:135538145-135538167 GAGGTAAGACAGCTGGGGGTGGG - Intergenic
1015881883 6:137878572-137878594 CATGAGAGAAAGCTGGGGCACGG - Exonic
1016003429 6:139066162-139066184 AAGTAAAGACAGCTGGGGCTTGG + Intergenic
1016363894 6:143295259-143295281 GAGGAGAGATAACTGAGGCTTGG - Intronic
1016377932 6:143443186-143443208 CATGTGAGAGAGCTGGGACTAGG + Intronic
1017166320 6:151411486-151411508 CAGTAGAGGCAGAAGGGGCTTGG + Intronic
1017453089 6:154572915-154572937 CAAGAGGGACAGCTGTTGCTAGG + Intergenic
1017608437 6:156158162-156158184 CAGGAGGGAGGGCTGGGGCTTGG + Intergenic
1018993584 6:168693154-168693176 CAGGAGAGACACCAGGGGCCGGG + Intergenic
1018993763 6:168694877-168694899 CAGGAGAGACACCAGGGGCCGGG - Intergenic
1019024872 6:168951045-168951067 GAGGAGAGGAAGCTGCGGCTTGG - Intergenic
1019295313 7:270755-270777 CAGGAGAGGCCGCTGGGGTTGGG - Intergenic
1020838522 7:13184948-13184970 CAGGAGAGAGAGAGGGGGATTGG - Intergenic
1021852078 7:24818029-24818051 CAGGTGAGAGAGGTGGGTCTGGG + Intronic
1021864261 7:24939372-24939394 CAGGATTTACAGCTGGGGTTGGG - Intronic
1022152111 7:27618543-27618565 CAGTAGTGGCAGCGGGGGCTGGG - Intronic
1022629509 7:32071501-32071523 CAAGAGAGAGAGATGGGGGTGGG - Intronic
1022863159 7:34389218-34389240 CAGGAGAGACAGAAGAGACTTGG - Intergenic
1022887606 7:34662512-34662534 CAGGAGATACATTTGGGGGTTGG - Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1023976189 7:45031968-45031990 TAGGAGGGACAGCCGGTGCTGGG - Intronic
1023980764 7:45068737-45068759 GAGCAGAGAGAGGTGGGGCTGGG - Intronic
1024056305 7:45661739-45661761 CAGGAAAGACAACCAGGGCTTGG - Intronic
1024251589 7:47509655-47509677 CAGGATAGGAAGCTGGGCCTGGG - Intronic
1024565551 7:50676995-50677017 CAGGGGAGAGGGCAGGGGCTGGG + Intronic
1025138761 7:56444491-56444513 TAGGAGAAACAGCTGAGACTGGG + Intergenic
1026550785 7:71366614-71366636 GAAGAGAGAGATCTGGGGCTGGG - Intronic
1026821599 7:73553288-73553310 CAGGAGAGACACCTGCTGCTGGG + Intronic
1026840341 7:73667467-73667489 CAGAAGAGAAAACTGAGGCTTGG + Intergenic
1026930750 7:74221764-74221786 CAGGAGAGGAGGCTGGGCCTGGG + Intronic
1027358572 7:77384670-77384692 CAGGAGTGGCAGGTGGGGCTTGG - Intronic
1027781918 7:82530650-82530672 CAGGAGAGACAAGTGGGGAGGGG - Intergenic
1029075291 7:97929529-97929551 CAGGAGAGACAGGGGAGACTGGG + Intergenic
1029161971 7:98559003-98559025 CAGGGGTAACAGCTGGGACTGGG - Intergenic
1029435593 7:100562446-100562468 CAGGAGATGCCGATGGGGCTGGG - Intronic
1029441381 7:100588648-100588670 CAGGAGAAACAGCAGGGGTCAGG - Intronic
1029604257 7:101589159-101589181 CTGGAGAGAGAGCATGGGCTGGG + Intergenic
1030516548 7:110545300-110545322 CAGGAGAGAGAGATGGGGAGGGG - Intergenic
1032076580 7:128838864-128838886 CAGGAGGAAGAGCTGGGGCGGGG + Intronic
1032542503 7:132715036-132715058 CAGGAGAAAGGGCTGGGGGTGGG - Intronic
1032977367 7:137241078-137241100 CAGGAGAGACAGCGAGAGCAAGG + Intronic
1033217589 7:139504709-139504731 CAGGACACACAGCTGCTGCTTGG + Intergenic
1033239096 7:139662559-139662581 CAGGAGAGACAGCTAGGGACAGG - Intronic
1033544312 7:142386115-142386137 CAGGACTGTGAGCTGGGGCTCGG - Intergenic
1033828196 7:145218413-145218435 CAGGAGCCATAGCTGGGTCTAGG + Intergenic
1034293180 7:149948408-149948430 CAGAAGAGGCAGGTGGGACTTGG + Intergenic
1034340908 7:150354423-150354445 CAGGAGAGACGGATGAAGCTGGG - Intergenic
1034424457 7:151007287-151007309 CAGGAGTCAGAGCAGGGGCTGGG - Intronic
1034513882 7:151558524-151558546 CGGGTGGGACAGCTGGGACTTGG + Intronic
1034529543 7:151687181-151687203 CAGGGCAGACAGCAGAGGCTGGG - Intronic
1034812894 7:154148471-154148493 CAGAAGAGGCAGGTGGGACTTGG - Intronic
1035080284 7:156210087-156210109 CCGGAGAGACAGTAGGTGCTTGG + Intergenic
1035110644 7:156478765-156478787 CCTCCGAGACAGCTGGGGCTGGG - Intergenic
1035665752 8:1378487-1378509 CAGGAAAGACAGGTGAGGCCAGG - Intergenic
1035665770 8:1378603-1378625 CAGGACAGACAGGTGAGGCCAGG - Intergenic
1035757692 8:2046429-2046451 CAGGAGAGTCAGCTGGCGCCTGG + Intronic
1036242237 8:7090849-7090871 CAGGAGAGACAGGGGAGACTGGG - Intergenic
1036308066 8:7616345-7616367 CAGGAGAGACAGGGGAGACTGGG - Intergenic
1036700568 8:11011056-11011078 CAGATGAGAAAGCTGAGGCTTGG + Intronic
1036830503 8:12016281-12016303 CAGGAGAGACAGGGGAGACTGGG + Intergenic
1036892036 8:12602606-12602628 CAGGAGAGACAGGGGAGACTGGG + Intergenic
1036899583 8:12660581-12660603 CAGGAGAGACAGGGGAGACTGGG + Intergenic
1037805254 8:22055161-22055183 CAGGAAGGACAGCTGTGGCCAGG - Intronic
1038406486 8:27326110-27326132 CAGGAGAGTCAGGGTGGGCTGGG - Intronic
1038713138 8:29967189-29967211 CAGGAGGAAGAGCTGGGGCGTGG + Intergenic
1038973092 8:32659710-32659732 CTGGGGAGACAGCTGGAGTTAGG - Intronic
1040582803 8:48711118-48711140 AAGGATAGACAGCTGGGACATGG - Intronic
1041326167 8:56667661-56667683 CAGGAGTAGCAGCTGGAGCTGGG - Intergenic
1041390958 8:57347227-57347249 CAGGAGAGACAGCTGGCGGCAGG - Intergenic
1041717375 8:60944363-60944385 TTGGAGGGACAGCTGAGGCTTGG + Intergenic
1042659306 8:71135915-71135937 CAGGTGAGGCAGCTGAGGCTTGG - Intergenic
1042661590 8:71160551-71160573 CAAGATAGAGAGCTGGAGCTGGG - Intergenic
1044225934 8:89718119-89718141 CATGAGAGACAACTGGGGGTGGG - Intergenic
1045801633 8:106108857-106108879 CAGAAGGCACAGCTGGGTCTGGG + Intergenic
1046067545 8:109214294-109214316 AAGAAAAGACAGCTGGGTCTGGG - Intergenic
1046638952 8:116703807-116703829 AAGAAAAGACAGCTGGGCCTGGG - Intronic
1047233219 8:123015470-123015492 CGGGAGACACAACTGGGGCCAGG - Exonic
1048611495 8:136027873-136027895 CAGGAAAGACAGAGGTGGCTTGG + Intergenic
1049099817 8:140570721-140570743 CAGGTGAGGCAGTTGAGGCTTGG + Intronic
1049423091 8:142525424-142525446 CAGGAGGGGCTGCTGGGGCTCGG - Intronic
1049435044 8:142582594-142582616 CAGCAGAGACAGCTAGGGCGTGG + Intergenic
1049464838 8:142746324-142746346 CATGGCAGATAGCTGGGGCTTGG - Intergenic
1049846516 8:144804599-144804621 AAGAAAAGACAGCTGGGCCTGGG + Intronic
1049881412 8:145066687-145066709 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1050899037 9:10921635-10921657 CAGGAGAGACAACTTTGTCTAGG + Intergenic
1051080135 9:13284482-13284504 CAGGAGCGAAAGCTGGGTATTGG - Intergenic
1051326748 9:15980381-15980403 CTGGAGAGATCACTGGGGCTAGG - Intronic
1051836258 9:21341479-21341501 CAGGGGAGACAGCAGGGCCTAGG - Intergenic
1052391884 9:27888863-27888885 CAGGAGAGGCAGCAGAGGCCTGG - Intergenic
1052494950 9:29213544-29213566 CAGGATAGCCGGCTGGGGCTTGG + Intergenic
1053164506 9:35835064-35835086 CAGGGGACACAGCTGTGCCTGGG + Exonic
1053280785 9:36818738-36818760 GAGGAGAGACAGCTGGAGAGAGG - Intergenic
1053800695 9:41762624-41762646 CAGGGGAGACAGCTTGGGACGGG - Intergenic
1053826563 9:42030700-42030722 CAGGAGAGACAGCTGCAGGTGGG - Intronic
1054144499 9:61552211-61552233 CAGGGGAGACAGCTTGGGACGGG + Intergenic
1054189126 9:61974776-61974798 CAGGGGAGACAGCTTGGGACGGG - Intergenic
1054603997 9:67156697-67156719 CAGGAGAGACAGCTGCAGGTGGG + Intergenic
1054649395 9:67613841-67613863 CAGGGGAGACAGCTTGGGACGGG + Intergenic
1055188413 9:73486630-73486652 CACAAGAGACAGCTGGAACTGGG + Intergenic
1055662539 9:78519809-78519831 CAGGACAGTCAGGTGGGGCTGGG - Intergenic
1055907531 9:81311400-81311422 CAGATGAGAAAGCTGAGGCTCGG + Intergenic
1056549061 9:87636259-87636281 CAGGGGACACAGCAGGGCCTGGG - Intronic
1056743393 9:89279692-89279714 CAGGAGACACGGCAGGAGCTAGG - Intergenic
1057549610 9:96042546-96042568 CAGAAGAGACAGCTGCTTCTTGG - Intergenic
1057742996 9:97728441-97728463 CATGAAAGACACCTGGAGCTGGG + Intergenic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059646905 9:116276825-116276847 GAGGGGAGGGAGCTGGGGCTGGG - Intronic
1060092758 9:120758689-120758711 CAGATGAGAAAGCTGTGGCTTGG - Exonic
1060206536 9:121685768-121685790 CAGAAGGGCCAGCCGGGGCTTGG + Intronic
1060344812 9:122806724-122806746 GAAGAGAGACACCTGGGGCAGGG + Intronic
1060548980 9:124476404-124476426 CCGGAGAGACAGGTGAGGCTGGG + Exonic
1060550438 9:124482455-124482477 CAGGAGAGAGAGCTGGGAGCAGG + Exonic
1060664281 9:125423662-125423684 CAGGAGAGAAAACTGAGGCCAGG + Intergenic
1060722510 9:125988511-125988533 CAGGACAGAGAGGTGGGGGTGGG - Intergenic
1060766614 9:126298718-126298740 CAGTAGAAACAGCTGGAGCAAGG - Intergenic
1060783883 9:126433787-126433809 CAGGAGTGGAAGCTGGGACTGGG - Intronic
1061158099 9:128877287-128877309 GAGGAGGTACAGGTGGGGCTAGG - Intronic
1061238948 9:129358107-129358129 CAGGTGAGAGGGCTGAGGCTGGG + Intergenic
1061320130 9:129823504-129823526 CAGGAGCGGGGGCTGGGGCTGGG - Intronic
1061365075 9:130168459-130168481 CAGGAGAGACATTTGGGGGCTGG - Intergenic
1061365082 9:130168486-130168508 CAGGAGAGACATTTGGGGGCTGG - Intergenic
1061785590 9:133026049-133026071 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1061935161 9:133853434-133853456 CAGCAGAGGCCGCTGGGGCAGGG - Intronic
1062137300 9:134936245-134936267 GACAAGAGACAGCTGGGGGTGGG + Intergenic
1062334101 9:136057371-136057393 GGGGAGGGACAGCTGGGGCTGGG + Intronic
1062477360 9:136735334-136735356 CAGCAGAGACAGCTGCGGCCGGG - Intergenic
1062484322 9:136767184-136767206 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1062487214 9:136785106-136785128 TAGGAAAGACAGCTGGGCCCTGG + Intergenic
1062716293 9:138011868-138011890 CAGGGGAGCCAGGTGGGTCTGGG + Intronic
1185724140 X:2405702-2405724 CAGGAGAAACACTTGGGCCTGGG + Intronic
1185765932 X:2725906-2725928 ATGGAAAGAGAGCTGGGGCTGGG - Intronic
1189221126 X:39373118-39373140 CAGATGAGAAAGCTGAGGCTTGG + Intergenic
1189761060 X:44322060-44322082 CTGGTGATACAGCTGGGGGTGGG - Intronic
1190369951 X:49730975-49730997 CTAGAGATACAGCTGGGGCAGGG + Intergenic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1192369722 X:70503428-70503450 CAGAAGGGAAAGCAGGGGCTGGG + Exonic
1193611318 X:83634850-83634872 AAGAAAAGACAGCTGGGCCTGGG + Intergenic
1194128616 X:90051175-90051197 CAGGAGATAGAGCTGGGCCAGGG - Intergenic
1194711175 X:97238068-97238090 CAGAAGAGACAGCAGGGGAAGGG + Intronic
1195067505 X:101250817-101250839 CAGGAGAACCAGCAGGGGCTGGG - Intronic
1195737143 X:108023850-108023872 CAGGAGAAACAGCTTAGGGTTGG + Intergenic
1196075470 X:111570921-111570943 CAGGAGGCACAGCTGGGTCAGGG - Intergenic
1196104619 X:111882856-111882878 CAGGAGAGTCACCTGAGGTTAGG + Intronic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1196736361 X:118984163-118984185 CAGGTGAGACAGATGAAGCTGGG + Intronic
1199753857 X:150846407-150846429 CAGGAGAGACACCTTGCGCAAGG + Intronic
1199894243 X:152116501-152116523 CTGGAGTGACAGCAGGGGCAGGG + Intergenic
1199927375 X:152481113-152481135 CAGAAGACACACCTGAGGCTCGG + Intergenic
1200310955 X:155076672-155076694 CAGGAGAGACACCTGGTGAAAGG - Intronic
1200972466 Y:9167909-9167931 CTGGTGAGAGAGCTTGGGCTTGG + Intergenic
1201070151 Y:10140796-10140818 CAGGAGAGACTGACGTGGCTAGG - Intergenic
1201458965 Y:14201478-14201500 AAGGAGAGAAAGAAGGGGCTGGG + Intergenic
1201708202 Y:16959829-16959851 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1201748436 Y:17405782-17405804 AAGAAAAGACAGCTGGGCCTGGG - Intergenic
1202579589 Y:26365858-26365880 CAGTAGAGATAGATGGGGCCTGG + Intergenic