ID: 1162088316

View in Genome Browser
Species Human (GRCh38)
Location 19:8261737-8261759
Sequence TTCGGCTACTACTTCTTCAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162088307_1162088316 15 Left 1162088307 19:8261699-8261721 CCACATACTACGAGTCCATCAGC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1162088316 19:8261737-8261759 TTCGGCTACTACTTCTTCAACGG 0: 1
1: 0
2: 0
3: 7
4: 85
1162088311_1162088316 0 Left 1162088311 19:8261714-8261736 CCATCAGCAACAGGGGCCCCTTC 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1162088316 19:8261737-8261759 TTCGGCTACTACTTCTTCAACGG 0: 1
1: 0
2: 0
3: 7
4: 85
1162088306_1162088316 23 Left 1162088306 19:8261691-8261713 CCTCTACACCACATACTACGAGT 0: 1
1: 0
2: 0
3: 0
4: 43
Right 1162088316 19:8261737-8261759 TTCGGCTACTACTTCTTCAACGG 0: 1
1: 0
2: 0
3: 7
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162088316 Original CRISPR TTCGGCTACTACTTCTTCAA CGG Exonic
905216453 1:36411713-36411735 TTCGGCCCCTACTTCTCCAGGGG - Intergenic
905515237 1:38557865-38557887 TTAGGATACAACTACTTCAAAGG + Intergenic
905681746 1:39877483-39877505 TACGGCTACTGCTTCTCCACAGG + Intronic
907985583 1:59526642-59526664 TTCTACTACTGCTTCTTAAAAGG - Intronic
912236899 1:107862104-107862126 TTCAACTAATATTTCTTCAATGG + Intronic
914685107 1:149971503-149971525 TTCGGTTACTAGATCTTTAAGGG - Intronic
915161437 1:153923112-153923134 TCCGGCCACTCATTCTTCAAGGG - Intergenic
915844930 1:159252862-159252884 CTCTGCTACTACGTCTGCAATGG + Intergenic
917718064 1:177758089-177758111 TTCGGATACAAATTCATCAAAGG + Intergenic
919300545 1:195757844-195757866 TTCTGCTACTTGTCCTTCAAGGG - Intergenic
922157160 1:223049511-223049533 CTCCACTACTACTTCTTCACAGG - Intergenic
922603836 1:226876475-226876497 TTAGGCTATTAATTCTTTAAAGG - Intronic
923701743 1:236306371-236306393 TCCTGCTGCTACTTCTTCCAGGG - Intergenic
1069592627 10:69651413-69651435 TTCGGCCAATGCTTGTTCAATGG - Intergenic
1073264863 10:102220623-102220645 TTCAGCTACAACTTTTTTAAAGG - Intergenic
1076051622 10:127338210-127338232 TTCGTCCACTACTTTTTAAATGG - Intronic
1084269122 11:68019775-68019797 TTCGACTACATCTTCTTCACAGG + Exonic
1085675053 11:78508618-78508640 TTCAGCCATTATTTCTTCAATGG - Intronic
1089302898 11:117509352-117509374 GTTGGCTACTTCTTCTTCAGTGG - Intronic
1094014490 12:25847920-25847942 TTTTGTTACTACTTCTTCATAGG + Intergenic
1095377523 12:41547993-41548015 TTTGACTACTTCTTTTTCAATGG - Intronic
1097294128 12:57944712-57944734 TTCAGTTAATATTTCTTCAAAGG - Intronic
1105072644 12:133244828-133244850 TTCTGCTACTATTTGTTGAATGG - Intergenic
1110132699 13:72026646-72026668 TTTGATTACTGCTTCTTCAAAGG - Intergenic
1110610383 13:77481036-77481058 CTCTGCTGCTTCTTCTTCAATGG + Intergenic
1114636422 14:24189506-24189528 TTCGGCTACTCCTTACTCACTGG - Exonic
1115838836 14:37443206-37443228 TTCGGCTTCAATTTCTTTAATGG - Intronic
1125744525 15:41989462-41989484 TTCGGCTCCGAGTTCTTCATGGG - Exonic
1125757192 15:42071821-42071843 TTCGGCTCCGAGTTCTTCATGGG - Exonic
1140055524 16:71522320-71522342 TTCGGCTACTACTACTTGTGTGG - Intronic
1142501347 17:334913-334935 TGCGGCTCCTCCTTCTTCCAGGG + Intronic
1143444487 17:6999341-6999363 TTCAGCTACCAGTTCCTCAATGG + Exonic
1144492500 17:15725982-15726004 ATGGACTACTACTTCTTCAATGG - Intergenic
1144907975 17:18653205-18653227 ATGGACTACTACTTCTTCAATGG + Intronic
1152835752 17:82529832-82529854 TTAGGCTACTACTGCCTTAAGGG - Intronic
1153127831 18:1817533-1817555 CTCAGAAACTACTTCTTCAAAGG - Intergenic
1158462077 18:57655207-57655229 TTCTGGTACTCCTTCTTCAATGG - Exonic
1162088316 19:8261737-8261759 TTCGGCTACTACTTCTTCAACGG + Exonic
1165018604 19:32903774-32903796 TTTGGCTATTATTTCTTGAACGG - Intronic
928187799 2:29129749-29129771 TTAGGATACTCCTCCTTCAAGGG + Intronic
939156897 2:138536569-138536591 TTAGGGAACTATTTCTTCAAAGG - Intronic
940504721 2:154538775-154538797 TTCTTCTTCTACTTCTTCTAAGG - Intergenic
941430734 2:165410972-165410994 TGAGGCTACTACCCCTTCAAGGG + Intergenic
941541087 2:166785308-166785330 TTCCTCTATTACTTCTTCACAGG - Intergenic
942448440 2:176093269-176093291 TACGGCTACCACTTCGGCAACGG + Exonic
942593301 2:177568489-177568511 TGCAGTTGCTACTTCTTCAAAGG - Intergenic
943478005 2:188383443-188383465 TGGGGCTACTTCTTGTTCAAGGG + Intronic
946441991 2:219704470-219704492 TTCTGCTAAAACCTCTTCAATGG + Intergenic
1169073799 20:2749691-2749713 ATCGGCGACAACTTCTTCGACGG + Exonic
1176208046 20:63901494-63901516 TTCAGCTCCTGCTTCTTCAAGGG - Intronic
1179946364 21:44680530-44680552 TCCTGCTACTATTTATTCAAAGG + Intronic
1180782105 22:18526508-18526530 GCCGTCTACTACTTCTTAAAGGG + Intergenic
1181238992 22:21465847-21465869 GCCGTCTACTACTTCTTAAAGGG + Intergenic
1185322247 22:50206993-50207015 TGCGGCTCCTGCTTCTTCAGTGG - Intronic
958626266 3:96627924-96627946 TTCAGAAACTATTTCTTCAAAGG + Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
961948716 3:130722278-130722300 GTGTGGTACTACTTCTTCAATGG - Intronic
969858604 4:10019009-10019031 TTCGGCTCCTCCTTCCTCTACGG - Exonic
971710797 4:30109002-30109024 TTCTGCTTCTACTTCTAGAATGG + Intergenic
974490585 4:62558612-62558634 TTCAGCTCCTACTTCTTCTTTGG - Intergenic
985479802 5:102186-102208 TTTCCCTACTACTTCTTCCAGGG - Intergenic
991451708 5:66758134-66758156 ATGGGCTGCTAGTTCTTCAAGGG + Intronic
994194381 5:96906257-96906279 TTCCTCTTCTTCTTCTTCAAGGG + Intronic
996247831 5:121286691-121286713 TTGAGCTACTGCTTTTTCAAGGG + Intergenic
1000604035 5:163309121-163309143 TTCTCTTACTACTTCTTTAACGG - Intergenic
1001565831 5:172698602-172698624 TTCTGCTACTCCTGCTTGAAAGG - Intergenic
1010857240 6:80855099-80855121 TTCTGCTATTACTACTTCATTGG - Intergenic
1011974213 6:93273651-93273673 TTCAGCTACATCTCCTTCAAGGG - Intronic
1013211352 6:107989777-107989799 TTGGGCTACTTTTTCTTAAAAGG - Intergenic
1014920612 6:127211103-127211125 TTGGGCTAGAATTTCTTCAAAGG + Intergenic
1018641187 6:165906231-165906253 TTCGGCCAGTACTGCTCCAAGGG + Intronic
1022466278 7:30655043-30655065 GTCTTCTACTGCTTCTTCAATGG - Exonic
1032953144 7:136939134-136939156 TTCTGCTACTGCTTCCTCATGGG - Intronic
1032955482 7:136966480-136966502 TTCACCTACTCCTTATTCAAAGG - Intronic
1033835238 7:145302493-145302515 TTGGGATACTTCTTCTTCCAGGG + Intergenic
1036405821 8:8454458-8454480 TCCTGCCACTACTTCTTCAACGG - Intergenic
1040907036 8:52479776-52479798 TTCTTCTACTACTCCTTCGATGG + Intergenic
1043585326 8:81761863-81761885 TTTGGCCATTATTTCTTCAAAGG - Intergenic
1045706709 8:104931752-104931774 TGATGCTACAACTTCTTCAATGG - Intronic
1052484238 9:29075517-29075539 TTCGAATTCTTCTTCTTCAAAGG + Intergenic
1053565237 9:39242432-39242454 TTTGAGTACTACTTCATCAAAGG - Intronic
1054131914 9:61376607-61376629 TTTGAGTACTACTTCATCAAAGG + Intergenic
1054599547 9:67107160-67107182 TTTGAGTACTACTTCATCAAAGG + Intergenic
1058810541 9:108634606-108634628 TTCAGCTACTAATTATTCAGGGG - Intergenic
1061876573 9:133547052-133547074 GCTGGCTACTACTTCTTCAACGG + Exonic
1189392145 X:40585337-40585359 TTTGGCTACCACTGCTTTAAAGG + Intronic
1189618316 X:42808495-42808517 TTTGGATACTACTTCTCCCATGG - Intergenic
1190713529 X:53086007-53086029 TACGGCAACAACTTCTTCAAAGG + Exonic
1193951322 X:87803329-87803351 TTAGGCTATGAATTCTTCAAGGG + Intergenic
1196149836 X:112361517-112361539 TTCGACAACTTCCTCTTCAAAGG + Intergenic
1202262053 Y:22980376-22980398 TTCTGCAACAGCTTCTTCAATGG - Intronic
1202415042 Y:24614117-24614139 TTCTGCAACAGCTTCTTCAATGG - Intronic
1202455744 Y:25055969-25055991 TTCTGCAACAGCTTCTTCAATGG + Intronic