ID: 1162088451

View in Genome Browser
Species Human (GRCh38)
Location 19:8262279-8262301
Sequence CCAGTTGCCCAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162088451_1162088460 14 Left 1162088451 19:8262279-8262301 CCTTCTTCCCTCTGGGCAACTGG 0: 1
1: 0
2: 1
3: 33
4: 320
Right 1162088460 19:8262316-8262338 CAGCAGCTGGATGCTGTGGCTGG 0: 1
1: 0
2: 6
3: 36
4: 504
1162088451_1162088457 1 Left 1162088451 19:8262279-8262301 CCTTCTTCCCTCTGGGCAACTGG 0: 1
1: 0
2: 1
3: 33
4: 320
Right 1162088457 19:8262303-8262325 CAGATCTGGGAGCCAGCAGCTGG 0: 1
1: 0
2: 4
3: 39
4: 339
1162088451_1162088458 10 Left 1162088451 19:8262279-8262301 CCTTCTTCCCTCTGGGCAACTGG 0: 1
1: 0
2: 1
3: 33
4: 320
Right 1162088458 19:8262312-8262334 GAGCCAGCAGCTGGATGCTGTGG 0: 1
1: 0
2: 1
3: 45
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162088451 Original CRISPR CCAGTTGCCCAGAGGGAAGA AGG (reversed) Exonic
900482838 1:2907673-2907695 CCAGATGCTCAGAGGGGAGATGG + Intergenic
900682361 1:3924026-3924048 CCTGTGTCCCAGAGGGGAGATGG + Intergenic
900869696 1:5293198-5293220 ACAGAGGCCCAGAGGGAAGGAGG + Intergenic
901762952 1:11482371-11482393 TCTGATGCCAAGAGGGAAGATGG + Intronic
902124270 1:14195402-14195424 CCAGAAGCCCAGAGAGAATATGG + Intergenic
902126233 1:14213963-14213985 CCACTTACCAAGAGTGAAGATGG + Intergenic
902781220 1:18706133-18706155 CCACCTGCCCAGAGTGAGGAGGG - Intronic
903189859 1:21650534-21650556 CCTCCTGCCCAGAGGTAAGAAGG + Intronic
903293558 1:22329692-22329714 CCATTTACCCAGAGGGCACAAGG - Intergenic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
903648443 1:24908881-24908903 CCTGAGGCCCAGAGAGAAGAAGG - Intronic
903788528 1:25876525-25876547 CCTGTGGCCCAGAGAGAACAAGG - Intergenic
903957359 1:27034538-27034560 CCAGGTGCCCAGGGGTATGAGGG + Intergenic
904489148 1:30847590-30847612 CCTGTTTCCCAGAGGGAATCCGG + Intergenic
905856823 1:41319962-41319984 CCAGTGGCCCAGAGGCAGGACGG + Intergenic
905915069 1:41678904-41678926 CCAGATGTCCAGGGAGAAGAAGG + Intronic
906128466 1:43442024-43442046 CCAGTTGCCCAGGGGAACAAGGG - Exonic
909078403 1:71080795-71080817 CCAGTTCCCTGGCGGGAAGAAGG - Intronic
911793341 1:102046450-102046472 CATGTTGCCCAGGGTGAAGACGG + Intergenic
914993654 1:152520011-152520033 GCATTTGTCCAGAAGGAAGAGGG + Intronic
915524214 1:156466365-156466387 ACAGTAGCCAAGAGGGAAGGTGG + Exonic
915614014 1:157021112-157021134 CCAGTTGCTCTGTAGGAAGATGG + Intronic
916584295 1:166136813-166136835 TCAGTTCCTGAGAGGGAAGAGGG + Intronic
918236283 1:182583438-182583460 CCAATTGCCCATAGGAAATAAGG + Intronic
918424385 1:184393299-184393321 ACAGGGGCCCTGAGGGAAGAAGG - Intronic
918894123 1:190317471-190317493 CCCTTTGGCAAGAGGGAAGAAGG - Intronic
920984855 1:210877371-210877393 TCAGCTGCCCTGAGGGAGGATGG + Intronic
921101611 1:211933605-211933627 CCAGTGGCCCAGAGAGCAGCGGG - Intergenic
922232863 1:223701524-223701546 CCAGCTCCCCAGAGAGAATATGG - Intergenic
922419465 1:225449765-225449787 ACAGTCGCACAGTGGGAAGATGG + Intergenic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
923430866 1:233919226-233919248 CTAGTTGTCCTGAGGGAAGGTGG + Intronic
1063147119 10:3305686-3305708 CCAGAAGCCCAGATGCAAGAAGG - Intergenic
1063947847 10:11194580-11194602 CGAGCTGCACAAAGGGAAGATGG + Intronic
1066566380 10:36725798-36725820 GCAGTTGCCCCAAGGGAAGGGGG - Intergenic
1067409014 10:46048465-46048487 CCAGCTGCCCACAGGGAGGAAGG + Intergenic
1067770404 10:49118686-49118708 CCAGTTGTGCAGGGAGAAGACGG - Intergenic
1069468591 10:68664887-68664909 CCAGTTGCTCAGAAGGCTGAGGG - Intronic
1070340704 10:75495603-75495625 CCAGCTGCCCGCAGGCAAGAAGG - Intronic
1070429722 10:76325272-76325294 CCATTTGCCCAGAGCCCAGACGG - Intronic
1070562254 10:77576757-77576779 CCAGTGGCTTAGAGGGCAGAAGG - Intronic
1070662380 10:78316573-78316595 CCAGCAGCCAAGAGGGCAGATGG - Intergenic
1070759403 10:79014387-79014409 CCAGTTGCCTAGAAGGGATATGG - Intergenic
1070803658 10:79257724-79257746 CCAGGTGTCCAGTGGAAAGACGG + Intronic
1070915954 10:80154824-80154846 CCAGGTCCCAGGAGGGAAGAAGG - Exonic
1073544017 10:104334132-104334154 CCAGGTGCCCAGAGCCAAGGCGG - Intronic
1074248117 10:111714472-111714494 ACAGTGGCCCCGAGGGCAGAGGG + Intergenic
1074306928 10:112287679-112287701 CCAGAAGCCCAGAGGGAGGAAGG + Intronic
1074479929 10:113809987-113810009 CCAGGTTCCCAGATGGAAAATGG - Intergenic
1076279125 10:129230301-129230323 CCAGATGGCCAGAGGGAAAGTGG + Intergenic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1078596656 11:12692944-12692966 CCAGTTGCACAGAAGGAAAAGGG - Intronic
1079370418 11:19847472-19847494 CTAGATGCACTGAGGGAAGAAGG - Intronic
1083269238 11:61562966-61562988 CCAGCTGCCCAGAGGGGAACGGG + Intronic
1084043299 11:66555111-66555133 CCAGCTGGACAGAGAGAAGAGGG - Exonic
1086152150 11:83623812-83623834 GCAGTTGGGCAGGGGGAAGAGGG + Intronic
1087215323 11:95487211-95487233 CCAGACACCCAGATGGAAGAAGG - Intergenic
1089131955 11:116219295-116219317 CCAGCCGCCCCCAGGGAAGAAGG + Intergenic
1089761170 11:120724842-120724864 CAAGTTGGCAAGAGTGAAGAGGG - Intronic
1091302822 11:134518435-134518457 CCTGCTGCCCTGAGGGAACAGGG - Intergenic
1091760714 12:3085414-3085436 GCAGATGCACAGAGGAAAGACGG - Intronic
1091923157 12:4321489-4321511 CCAGCAGCCCCGAGGGACGACGG + Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1093103169 12:15052647-15052669 CCAGTTGCTAAGAAGGGAGAAGG + Intergenic
1095749995 12:45699213-45699235 CCAGTTTCCCCAAGGGCAGAGGG - Intergenic
1096497850 12:52048991-52049013 CCAGTGGCCTTGAAGGAAGATGG + Intronic
1097234044 12:57527909-57527931 CCAACTGGCCAGAGAGAAGAGGG - Exonic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1099958074 12:89370617-89370639 GCAAATGCCTAGAGGGAAGAGGG - Intergenic
1100191786 12:92200673-92200695 CCAGATGCCCAGTGGCAGGATGG - Intergenic
1101647785 12:106647103-106647125 ACAGTTTACCAGAAGGAAGATGG - Intronic
1102464530 12:113120683-113120705 CAAGTAGGCAAGAGGGAAGATGG + Intronic
1104048555 12:125181327-125181349 CAAGCTGCCAAGAAGGAAGAGGG + Intergenic
1104209880 12:126678388-126678410 CCAATGGCCCATTGGGAAGATGG + Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1105284789 13:18995089-18995111 CCAGAAGGCCAGAGGGTAGAAGG + Intergenic
1107708154 13:43127299-43127321 CCAGTTGCCCTGTGGGCAGAGGG - Intergenic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1108935394 13:55875403-55875425 CCAGTTTACCAGAGAGAAGAAGG - Intergenic
1109758881 13:66799923-66799945 CCAGTTGACCAGGGCCAAGATGG - Intronic
1110146590 13:72199177-72199199 CCAGATGACCAGAGGGAGGGGGG + Intergenic
1110681637 13:78320471-78320493 CTAGTTCCCCAAAGGGAACATGG + Intergenic
1112094873 13:96121474-96121496 CCACCTGCCCAAAGGGAAGGAGG - Intronic
1112470746 13:99686353-99686375 CCAGATGCTCAGAGGGGAGGTGG - Intronic
1113922943 13:113924355-113924377 CCAGATGCCGGGAGGGAGGACGG + Intergenic
1115887255 14:37986222-37986244 CCTTTTCCCCAGAGGGCAGAGGG + Intronic
1117181913 14:53200272-53200294 CCAGAGGCCCAGGGGGAAAAAGG + Intergenic
1118387780 14:65270777-65270799 CCAGGTGACAAAAGGGAAGACGG + Intergenic
1119048013 14:71338049-71338071 GCTGGTGCCCAGAGGGAAAAGGG - Intronic
1119246157 14:73110263-73110285 CCACTTGCCCAGGAGGCAGAGGG - Intronic
1119259309 14:73228162-73228184 CCAAGTTCCCAGTGGGAAGATGG - Intergenic
1120980028 14:90281027-90281049 GCAGTCTCCCAGAGGGAAGCAGG + Intronic
1121228694 14:92340666-92340688 CCAGATGCCCAGAGGTGAAAAGG - Intronic
1121291215 14:92777140-92777162 CCTTCTGCCCAGAGGCAAGAAGG - Intergenic
1122294821 14:100699455-100699477 CCTGGTGGCCAGTGGGAAGAGGG + Intergenic
1122394571 14:101414424-101414446 ACAGAGGCACAGAGGGAAGAAGG + Intergenic
1123708018 15:22964614-22964636 CCTTTTTCCCAGAGGGAACATGG - Intronic
1125235849 15:37512536-37512558 CCAGTAGACTAGAGGCAAGAAGG - Intergenic
1127318277 15:57817790-57817812 TCAGAGGCCCAGAAGGAAGAGGG - Intergenic
1127484691 15:59408136-59408158 CAAGATGCCAAAAGGGAAGAAGG - Intronic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128759610 15:70207118-70207140 CCAATTGCCCAGAAGGAGAATGG - Intergenic
1129453105 15:75661687-75661709 AGACTTGGCCAGAGGGAAGATGG + Exonic
1129929319 15:79396554-79396576 ACTGGAGCCCAGAGGGAAGATGG - Intronic
1131306885 15:91252834-91252856 CAAGTTGCTCAGGGGGAGGAGGG - Intronic
1131507661 15:93031436-93031458 CCAGGTGCTCAGCGGGCAGATGG - Intergenic
1131666082 15:94572442-94572464 CCAATTGCCCAGGCAGAAGAAGG + Intergenic
1132557176 16:577840-577862 ACAGGTCCCCAGAGGGAGGATGG - Intronic
1133607948 16:7406453-7406475 CCTGTGGCCCAGAGGGTGGATGG + Intronic
1135123169 16:19784313-19784335 ACAGTGGCCCAGAGAGAAGATGG - Intronic
1135563891 16:23497134-23497156 CCAGATGGCCAGAGGGGAGTTGG - Intronic
1135974054 16:27095656-27095678 CCAGTTGCTCAGAGGTAGGAGGG + Intergenic
1138133108 16:54499105-54499127 GCCTTTGCCCAGAGGGAAGCTGG - Intergenic
1138514647 16:57529281-57529303 CCGGTGGCCCAGAGGGAAGCGGG - Exonic
1140481366 16:75264679-75264701 GCAGATGACCAGAGGGAAGCTGG - Intronic
1141148392 16:81547723-81547745 GCACTTCCCCAAAGGGAAGAGGG - Intronic
1141357748 16:83364590-83364612 CCATTGGCCCAGAGGAAAAATGG + Intronic
1141643796 16:85356826-85356848 CCAGTTGCTCAGAGAGGTGAGGG + Intergenic
1141989396 16:87601960-87601982 CAAGCTGCCCGGAAGGAAGAAGG + Intronic
1142138694 16:88463042-88463064 GCAGGTGCCCAGAAGGAAGTGGG - Intronic
1142276301 16:89120644-89120666 CCTGTGACCCAGAGAGAAGATGG - Intronic
1142957504 17:3531645-3531667 ACAGTGGCACACAGGGAAGACGG + Intronic
1143003356 17:3809990-3810012 CCAGAGGCTAAGAGGGAAGAGGG + Intergenic
1143121170 17:4607928-4607950 GCAGTGGCCCAGAGGGAGGGAGG - Exonic
1144437645 17:15255848-15255870 CCAGGTGCCCAAAGGGAGGCAGG - Intronic
1144764727 17:17726148-17726170 CTTGTGGCCCGGAGGGAAGAGGG + Intronic
1144862161 17:18311900-18311922 CCAGATGCCAAAAGGAAAGATGG + Intronic
1144955090 17:19015127-19015149 CCAGATGTCCATAGTGAAGAGGG - Exonic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1148238708 17:45985950-45985972 CCAGTTGTCCATGGGGTAGAGGG + Intronic
1148341196 17:46874505-46874527 CCAGATTCCCAGAGGGCAGCAGG - Intronic
1148852275 17:50561026-50561048 CCAGCTGCGCCGCGGGAAGAGGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150715971 17:67572872-67572894 ACAGAGACCCAGAGGGAAGAAGG + Intronic
1151311508 17:73295447-73295469 CCAATTGCTCAGTGGGAGGAAGG - Intronic
1152119716 17:78411102-78411124 GCAGTTGGCCTGAGTGAAGAGGG + Intronic
1153820640 18:8828657-8828679 CCATCTGCCCAGAGAGAAGAAGG - Intronic
1153835096 18:8956556-8956578 TCAGTTGAACAGAGGGATGATGG - Intergenic
1155517732 18:26640107-26640129 CCAGTGGTCCAGAGGAGAGAGGG + Intronic
1158775994 18:60580593-60580615 CCCATTGCCCAGAGAGAAGGTGG - Intergenic
1158932578 18:62335710-62335732 CGAGATACCCTGAGGGAAGAGGG - Intronic
1162088451 19:8262279-8262301 CCAGTTGCCCAGAGGGAAGAAGG - Exonic
1162775037 19:12974452-12974474 CCAGTTGCAGGGAGGGTAGATGG + Exonic
1163708500 19:18831862-18831884 CCTGGTGCCCAGCAGGAAGACGG - Intergenic
1164883948 19:31761162-31761184 GGAGTTCCCCAGGGGGAAGATGG - Intergenic
1165216083 19:34273836-34273858 CCAGGTGGCGAGAAGGAAGATGG + Intronic
1165742445 19:38211910-38211932 CCACTTGCACAGAGGGGAGGGGG + Exonic
1166337258 19:42115906-42115928 ACAGGTGCACAGAGAGAAGATGG + Intronic
1166782868 19:45351449-45351471 CCAGGTACCCAGAGGCAAGGGGG - Exonic
1167118017 19:47499362-47499384 CCAGTTTCCCAGGGAGCAGAAGG + Intronic
1168497678 19:56867660-56867682 CCAGTTCTCCATAGGAAAGAAGG - Intergenic
925214334 2:2081367-2081389 GCATTTGCCAAGAGGGAAGTAGG - Intronic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
928995227 2:37282335-37282357 ACAGGTGGCCAGAGGAAAGACGG + Intronic
930195772 2:48508405-48508427 CCAGTTGCTAAAAGTGAAGAGGG + Intronic
931589400 2:63865315-63865337 CCAGCTGCCTAGAGGGCTGAAGG + Intronic
931636322 2:64343802-64343824 CCAGAGTCCCAGAAGGAAGATGG - Intergenic
932097456 2:68864138-68864160 CCAGTTGCAAAATGGGAAGATGG + Intergenic
933997653 2:87681532-87681554 CCAGCTGCCAAGAGAGATGAAGG + Intergenic
936296199 2:111269338-111269360 CCAGCTGCCAAGAGAGATGAAGG - Intergenic
936721715 2:115259163-115259185 CCTGGTGCCCAAAGGGAGGAAGG + Intronic
936790204 2:116142293-116142315 CCAGGTACCCAGAGGAAACATGG + Intergenic
938727888 2:134122710-134122732 CGAGTGTCCCAGAGTGAAGAAGG - Intronic
938958267 2:136318562-136318584 CCAGTCTCCCAAAGGGATGATGG - Intergenic
941359375 2:164532886-164532908 CTCGTTTCCCAGAGGGCAGAGGG - Intronic
941652932 2:168112863-168112885 CCAGCTGCCCTGAGGGATCAGGG + Intronic
942463945 2:176188917-176188939 GCCGTTGCCCAGAGGGAAGGCGG - Exonic
943953442 2:194158393-194158415 CCAGTTTACCAGAGAGGAGAAGG - Intergenic
946269361 2:218577607-218577629 CCTGATGCCCACAGAGAAGATGG - Intronic
947115115 2:226761540-226761562 ACAGTTGACCAGAGTGGAGAAGG - Intronic
947572307 2:231245829-231245851 ACATTTGCCCAGGGGGAACAGGG - Intronic
948728289 2:239947751-239947773 CCAGATGGCAAGAGGGATGAGGG + Intronic
948797383 2:240411944-240411966 CAGGTTGCCAAGAGGGAATAGGG + Intergenic
1168771391 20:419197-419219 CCACTTGGCCAGATGGAAGCTGG + Intronic
1168880057 20:1198827-1198849 GGAGGTGCCCAGAGGGAAGGTGG - Intergenic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169298102 20:4417317-4417339 ACAGATGCACAGAGGGCAGATGG + Intergenic
1170070161 20:12357904-12357926 CCAGTTTCCCAGCATGAAGAAGG - Intergenic
1170718323 20:18851526-18851548 CCAGTTCCTCAGAAGGAAGAAGG + Intergenic
1171014914 20:21531316-21531338 CTATTTTCCCTGAGGGAAGATGG + Intergenic
1171293441 20:23995591-23995613 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1172174190 20:32962229-32962251 CCAGCTGCCAAGAGGGCTGATGG - Intergenic
1172184973 20:33025876-33025898 CTCCTTGCCCAGAAGGAAGATGG + Intergenic
1173347545 20:42214784-42214806 CCATGTACCCAGAGGGAGGAGGG - Intronic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1173914481 20:46696773-46696795 CTAGTTGCCCAGAGTGGAAATGG - Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175757973 20:61541884-61541906 CCAGGTGCCCTGAGGGAGGGAGG - Intronic
1175828493 20:61949966-61949988 CCAGAGGCCCACAGGGAAGGCGG - Intergenic
1175962494 20:62644185-62644207 CCAGCAGCACAGAGGGAAGTCGG - Intronic
1177658708 21:24054329-24054351 GCACATGCACAGAGGGAAGAAGG - Intergenic
1178430016 21:32510630-32510652 CCAGGTGCCTGCAGGGAAGATGG + Intronic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179278798 21:39916158-39916180 CCATGTGCTCAGAGAGAAGAAGG + Intronic
1179738681 21:43404293-43404315 CCAGCTGTCCAGAGGGCATAGGG - Intergenic
1179935256 21:44599968-44599990 CTAAGTGCCCAGATGGAAGAGGG + Intronic
1180062123 21:45390870-45390892 ACAGGAGCTCAGAGGGAAGAGGG + Intergenic
1180182047 21:46122424-46122446 AAAGCTGCCCAGAGGGAGGAAGG + Intronic
1180824495 22:18853307-18853329 GCAGCTGCGCAGAGGGAAGCAGG - Intronic
1181124918 22:20696462-20696484 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181183749 22:21086582-21086604 CCAGCTGCCCAGGAGGATGAAGG - Intergenic
1181188239 22:21121241-21121263 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1181210957 22:21289252-21289274 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181398543 22:22637636-22637658 GCAGCTCCCCAGAGGGAAGCAGG + Intergenic
1181464534 22:23103794-23103816 CCAGCTGACCTGAGGGAGGAAGG - Intronic
1181501280 22:23316994-23317016 GCAGCTGCCCAGAGGGAAGCAGG + Exonic
1181650872 22:24258424-24258446 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1181706509 22:24652315-24652337 GCAGCTGCCCAGAGGGAAGCAGG + Intergenic
1183322699 22:37174852-37174874 CCTGTGGCCCTGAGGGAAGCTGG + Intronic
1184044707 22:41965647-41965669 CCTGGGTCCCAGAGGGAAGAGGG + Intergenic
1184855014 22:47142111-47142133 CCAGGTTCCCAGTAGGAAGATGG + Intronic
1184856138 22:47147796-47147818 CCAGTGGCCAGGAGGGAGGATGG + Intronic
1185151019 22:49164041-49164063 CCCGTGGCCAAGAGGCAAGAGGG - Intergenic
1185241508 22:49749909-49749931 CCGGTTGGCCAGAGGGGAGCAGG - Intergenic
1203215988 22_KI270731v1_random:6178-6200 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1203274634 22_KI270734v1_random:79212-79234 GCAGCTGCACAGAGGGAAGCAGG - Intergenic
949419253 3:3848343-3848365 CCAGTTCCACAAAGGGCAGAGGG + Intronic
951365998 3:21783346-21783368 CCAGTGGAACAGAGGGAAAAAGG + Intronic
952430556 3:33219056-33219078 CCAGGTGCCCAGCGCGAAGGCGG - Exonic
952882168 3:37991745-37991767 GGAGTTCCCCAGAGGAAAGAGGG + Intronic
953687376 3:45088552-45088574 CCTGTGGCCCAGAGGAAGGAAGG - Intronic
953811240 3:46114656-46114678 CCAGTTTACCAGAGAGGAGAAGG - Intergenic
954611767 3:51948116-51948138 CAAGTTTCCCAGAGAGAAGTCGG + Intronic
955239976 3:57169744-57169766 CCAGTCTCCCAGAGGGCTGAGGG + Intronic
956253847 3:67263215-67263237 CCAGCAGCACAGAGGGAAGGGGG + Intergenic
957499350 3:81033839-81033861 CCTTTTGCCCAGATGGATGATGG - Intergenic
959909499 3:111747928-111747950 CCAGTTGCCCACAGGGAATCAGG - Intronic
960050606 3:113235513-113235535 CTACTTGCTCAGAGGGAAAAAGG - Intronic
961000516 3:123371100-123371122 ACAGCGGCCCAGAGGAAAGAAGG + Intronic
961081398 3:124032320-124032342 CCAGTTGGCCAGGAGGAAGGAGG - Intergenic
961556044 3:127697214-127697236 CCAGGAGCCCTGAGGGAAGGAGG + Intronic
968658141 4:1787383-1787405 CCAGGTGCCCAGCGGCATGAGGG - Intergenic
968791135 4:2663190-2663212 CCAGGGGCCCCGAAGGAAGATGG + Exonic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969186251 4:5476825-5476847 CCAATGGCACATAGGGAAGAAGG + Intronic
969576453 4:8038816-8038838 CCAATTTCCCAGAAGGCAGAGGG - Intronic
969716167 4:8869299-8869321 GCACTTGCCCAGATTGAAGAGGG + Intronic
970133547 4:12897035-12897057 TCTCTTCCCCAGAGGGAAGAGGG + Intergenic
970612731 4:17740660-17740682 GCAGTTGCCCAGTTGGAAGCTGG + Intronic
970701504 4:18745969-18745991 CCAGGGGCTGAGAGGGAAGAAGG - Intergenic
971102743 4:23485895-23485917 CCACTTGGCCAGAAGGAAGCAGG - Intergenic
974395467 4:61329113-61329135 CTAGCTGCTCAGAAGGAAGAGGG - Intronic
977188936 4:93976118-93976140 ACAGATACACAGAGGGAAGATGG - Intergenic
980478679 4:133356372-133356394 TCATCAGCCCAGAGGGAAGATGG - Intergenic
981157420 4:141455891-141455913 CCAGCTGCCCTGAGGGAAGAGGG + Intergenic
981300274 4:143178935-143178957 TCAGTTTACCAGAGAGAAGAAGG - Intergenic
981901479 4:149870204-149870226 GCAGATGTACAGAGGGAAGACGG - Intergenic
983276379 4:165622521-165622543 CCAGTTTTCCAAAGAGAAGATGG + Intergenic
983367191 4:166807587-166807609 CCAGTTGAGCAGAGTGAAGGAGG + Intronic
984700198 4:182814174-182814196 CTAGCTGCCCAGATGGAAGTAGG + Intergenic
985654566 5:1123243-1123265 CCACTTCCCCAGAGGGAATGTGG - Intergenic
986024956 5:3842078-3842100 CCAGTTCCCCAGAAGGAAGGAGG - Intergenic
986461687 5:7979282-7979304 GCAATAGCCCAGGGGGAAGATGG + Intergenic
986992178 5:13567297-13567319 CCAGTTGCCCTCATGGAACAGGG + Intergenic
987089473 5:14498295-14498317 CCAGTTGCCAAGTGACAAGATGG - Intronic
987190091 5:15468654-15468676 CCAGATGCACAAAAGGAAGAGGG + Intergenic
988309902 5:29543510-29543532 CAAATTGCCCTTAGGGAAGAGGG - Intergenic
988650420 5:33142794-33142816 CCAGTTTACCAGAAGGAACAAGG + Intergenic
997472444 5:134124425-134124447 CCAGTTCCCCAGGGAGTAGAGGG + Intronic
997800355 5:136854508-136854530 GAAGTTGCCCAGTGGGAGGAAGG - Intergenic
998182507 5:139955353-139955375 GCAGAGGCCCAGAGGGGAGAGGG + Intronic
999039583 5:148392652-148392674 ACAATTGCCCAGGGAGAAGAGGG + Intronic
999197502 5:149792375-149792397 GCAGCTCCCCAGAGGCAAGAAGG + Intronic
999268632 5:150283333-150283355 AGAGTTAACCAGAGGGAAGAGGG - Intronic
999637742 5:153640294-153640316 CCTGATGCCCAGTTGGAAGATGG - Intronic
999694680 5:154178631-154178653 CCAGTGACACAGAGGGAAGAAGG - Intronic
999751131 5:154628909-154628931 CCAGATGCCCAGTGGGATGGAGG + Intergenic
999829536 5:155305626-155305648 CCAGATGCCCAGGGGAAGGAGGG - Intergenic
1000117350 5:158166109-158166131 CCAGCTGCCCAGAGGACCGAGGG + Intergenic
1000397793 5:160794298-160794320 TCAGTTGTCCAGAGGAAACAGGG - Intronic
1001239183 5:170055393-170055415 CTCGTTGTCCACAGGGAAGAAGG + Intronic
1001881324 5:175246710-175246732 CCAGTGGTCCAGCAGGAAGAGGG - Intergenic
1002551436 5:179995702-179995724 ACACTTCCCCAGTGGGAAGATGG + Intronic
1003949428 6:11104260-11104282 CCCGTTGCCCAGGGTGAGGAGGG - Exonic
1005967170 6:30734943-30734965 TCATCTGCTCAGAGGGAAGAAGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006216423 6:32447288-32447310 CCAATGGCTCAGAGGGAGGAAGG - Intergenic
1007092571 6:39193395-39193417 CCTTTTGCCCAGAGGGCAGTGGG - Intronic
1009718729 6:67435679-67435701 CCTGTTGCCCAGAAGGAAACAGG + Intergenic
1011433618 6:87314628-87314650 CCACTTGCCCAGAATGAAGGTGG - Intronic
1012213204 6:96550250-96550272 CCAGTTGCCTAGAGGAAGAAAGG + Intronic
1013544704 6:111144638-111144660 GCAGTTGCCTGGAGGCAAGAGGG + Intronic
1017678753 6:156842279-156842301 GCAGTTGCCTGGGGGGAAGAGGG - Intronic
1017821027 6:158049222-158049244 CCCTTTGCCCAGAGGGGAGGAGG + Intronic
1019283478 7:211825-211847 CCACGTGCCCTGTGGGAAGACGG - Intronic
1019812442 7:3174683-3174705 CCAGCAGGCCAGAGGGAAGGTGG - Intergenic
1020087031 7:5316064-5316086 CCAGTAACCCTGTGGGAAGAGGG + Exonic
1020260735 7:6529497-6529519 CCAACTGCACAGATGGAAGAAGG + Intronic
1020757074 7:12215992-12216014 GGAGATACCCAGAGGGAAGAAGG + Intronic
1021522428 7:21551195-21551217 CTAGTTTACCAGAGAGAAGAAGG - Intronic
1021566740 7:22023842-22023864 CCAGTTTCCCCAAGGCAAGAAGG - Intergenic
1023988895 7:45116162-45116184 CCAGCAGCCCAGATGGAATAAGG + Intergenic
1025005537 7:55351448-55351470 ACAGCTGCCCAGAGCCAAGAAGG + Intergenic
1025782606 7:64615224-64615246 GCACCTGCCCACAGGGAAGATGG + Intergenic
1026181312 7:68043540-68043562 ACAGTGGCCCAAAGGAAAGAAGG - Intergenic
1026431081 7:70347810-70347832 CAAGTCTCCCAGAGGGTAGAAGG - Intronic
1026567142 7:71498651-71498673 ACATTTGCCCAGAGTCAAGATGG + Intronic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1027343298 7:77232753-77232775 ACAGCTGCCCATGGGGAAGAAGG + Intronic
1028161559 7:87491764-87491786 CCATTACCCCAGAGGGAAGTGGG + Intergenic
1030648503 7:112091385-112091407 GCAGTCTCCCAGAGTGAAGACGG - Intronic
1031014716 7:116560532-116560554 CCCTTTGCCCAGAAAGAAGATGG + Exonic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1031994111 7:128217271-128217293 CCAGATGCCAAGAGAGAAGTTGG + Intergenic
1032537605 7:132677888-132677910 CCTGCTCCCCAAAGGGAAGATGG - Intronic
1033466208 7:141592342-141592364 CCAGCTGCGAAGATGGAAGAAGG - Intronic
1034424235 7:151006206-151006228 GCATATGCCCGGAGGGAAGATGG + Intronic
1034655876 7:152729529-152729551 CCAGGAGCCCACCGGGAAGAAGG - Intergenic
1038437104 8:27543880-27543902 ACGGGTGCTCAGAGGGAAGACGG + Intronic
1038616717 8:29102356-29102378 ACAGTTACACAGAGGGAAGCTGG + Intronic
1039949918 8:42162300-42162322 ACAGCTGCCCAGTGGGAAGCTGG - Exonic
1040414197 8:47182433-47182455 CCAATTGCCCAGAGAGAACAGGG - Intergenic
1040946714 8:52892817-52892839 GGAGTTGCCCAGCGGGAAGATGG + Intergenic
1040946723 8:52892859-52892881 GAAGTTGCCCAGTGGGAAGATGG + Intergenic
1040946732 8:52892901-52892923 GAAGTTGCCCAGCGGGAAGATGG + Intergenic
1040946744 8:52892943-52892965 GAAGCTGCCCAGCGGGAAGATGG + Intergenic
1040946767 8:52893043-52893065 CGGGTTGCCCAGCAGGAAGACGG + Intergenic
1040950385 8:52933439-52933461 ACAGTTGCACATAAGGAAGAGGG + Intergenic
1044856021 8:96476790-96476812 CCAATTGCCCAGTGGGTGGAGGG - Intergenic
1045009574 8:97945880-97945902 CCAGTGTCCCAGAGGGGTGATGG + Intronic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1048267582 8:133001041-133001063 ACACGTGCACAGAGGGAAGATGG - Intronic
1048274656 8:133057095-133057117 ATAGTTGCCCAGTGGAAAGAAGG - Intronic
1049519264 8:143079971-143079993 TCAGTTGCCCAGAGGAAAGCAGG - Intergenic
1051589036 9:18757514-18757536 ACAGATGCGCAGAGGGATGAAGG - Intronic
1056361567 9:85862739-85862761 CCAGCTGCCCTGAGGGCTGAGGG - Intergenic
1057047450 9:91897344-91897366 CCACTTGTACAGAGGAAAGAAGG + Intronic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1057900714 9:98945827-98945849 CCAGTTTCCCAAAAGGAAGATGG + Intronic
1057928191 9:99171064-99171086 ACAGTTGCCCTGGGGAAAGAAGG - Intergenic
1058205483 9:102100670-102100692 CTAGTGGCCAAGAGGGGAGATGG - Intergenic
1059487615 9:114638753-114638775 CAAATTCCCCCGAGGGAAGATGG - Intronic
1060250688 9:121984606-121984628 CCAGTCACCCCAAGGGAAGAAGG - Intronic
1060289253 9:122285274-122285296 CCAGCTTCCCAGAGGTAAGATGG + Exonic
1061650422 9:132043868-132043890 CCAGTTGCCCTGAAGGAAGGTGG - Intronic
1061680247 9:132239517-132239539 CCAGTTGCCCAGAGAGGGAAGGG - Intronic
1061680500 9:132240617-132240639 CTAGTTGCCCAGAGAGGGGAAGG + Intronic
1061973980 9:134059216-134059238 GAAGCTGCTCAGAGGGAAGAGGG + Intronic
1062114685 9:134802048-134802070 TCACTTGCCCACAGGGAAGAGGG + Intronic
1062201624 9:135305949-135305971 CCAGTGGCCGAAAGGGCAGAGGG - Intergenic
1062504230 9:136865298-136865320 CCTGTTGCACAGGTGGAAGATGG - Intronic
1187049429 X:15680986-15681008 CCAATAACCTAGAGGGAAGAGGG - Intergenic
1187408949 X:19030778-19030800 CCCGTTGCCTAGTGAGAAGATGG - Intronic
1187829999 X:23371386-23371408 CCAGTTGCCCACAGAGTAGCTGG - Intronic
1188340723 X:28998000-28998022 CCAGCTGCACTGAGGGAAAAGGG - Intronic
1188650623 X:32627267-32627289 CCAGATGCACAGAGGTAACATGG + Intronic
1189088400 X:38051194-38051216 GGAGATGACCAGAGGGAAGAGGG + Intronic
1192248589 X:69392597-69392619 CCATTTGCCCACAGGAAAGAAGG + Intergenic
1195465635 X:105176270-105176292 CCCATTTCCCAGAGGGAAAAAGG + Intronic
1197232853 X:124024693-124024715 CCAGTTGCCCAGAGGCTATGAGG - Intronic
1198932790 X:141879051-141879073 TCAGTTGCACAGAGGCAGGAAGG + Intronic
1199713354 X:150488131-150488153 CCAGCTTCCCAGAGAGAAGGGGG - Intronic
1200237183 X:154473295-154473317 CCAGGTGCTCAGAGAGAATAGGG - Exonic