ID: 1162094524

View in Genome Browser
Species Human (GRCh38)
Location 19:8302661-8302683
Sequence CCATGTGTATGGAGCTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162094524_1162094538 30 Left 1162094524 19:8302661-8302683 CCCACCAAGCTCCATACACATGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1162094538 19:8302714-8302736 ACCCACCTCCCCTGAATCCCCGG 0: 1
1: 0
2: 0
3: 31
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162094524 Original CRISPR CCATGTGTATGGAGCTTGGT GGG (reversed) Intronic
906026643 1:42679844-42679866 CAATGTGTATGGAGAGTGGGTGG - Intergenic
906108254 1:43307338-43307360 CCATGTGGGTGGAGCTTGGAGGG + Intronic
919796366 1:201323621-201323643 CCAAATGTATGTAGCTTGGAGGG + Intronic
921046537 1:211481762-211481784 CCATGTGTTTCCAGCTTTGTTGG - Intronic
922486146 1:225974719-225974741 CCACGTGAATGGAGCTGGGGAGG + Intergenic
1066171223 10:32849320-32849342 CCATATGTATGGCGGTTGGCTGG + Intronic
1074747192 10:116546634-116546656 CCATGTGTCAGGTGCTGGGTTGG - Intronic
1075022025 10:118959158-118959180 CTATGTGTATGGGGGGTGGTGGG - Intergenic
1075183038 10:120229226-120229248 CCATATGCCTGGTGCTTGGTAGG + Intergenic
1075611991 10:123861901-123861923 TCATGTGAGTGGAGCATGGTTGG + Intronic
1075899031 10:126023497-126023519 CCATATGTCTTGACCTTGGTTGG - Intronic
1076256368 10:129028674-129028696 CCTTGTGTGTGGAGCTGCGTAGG - Intergenic
1077111820 11:865364-865386 CGGTGTGTCTGCAGCTTGGTGGG + Intronic
1080852913 11:36086576-36086598 CCATGTGCATGCAGCTTGAGGGG + Intronic
1084088029 11:66863684-66863706 CCATGTGCAAGGCCCTTGGTGGG + Intronic
1085346651 11:75772396-75772418 CCATGCGTCTGCAGCATGGTGGG - Intronic
1089962044 11:122624954-122624976 CCCTCTGTATGGAGGTAGGTGGG + Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1096205898 12:49721681-49721703 CCATGTGGAAGGAACCTGGTGGG - Intronic
1100800082 12:98221753-98221775 CCACATGTATTGACCTTGGTAGG + Intergenic
1102553509 12:113710514-113710536 CCATGTGAATCGAGCTTGGGGGG - Intergenic
1103581449 12:121918564-121918586 CCATGGGGACGGAGCTTGGGTGG + Exonic
1104299890 12:127555079-127555101 CCATGTGCATGGAGTTTAGCTGG + Intergenic
1104493790 12:129217926-129217948 TCCTGTGCATGAAGCTTGGTGGG + Intronic
1109855958 13:68128617-68128639 CCATGTGTAAGCAGCTTAGTTGG + Intergenic
1110848966 13:80222782-80222804 TCATATGTATGGTACTTGGTAGG - Intergenic
1112841716 13:103587332-103587354 ACATGTGTCTGGATCTTTGTGGG + Intergenic
1116200210 14:41784027-41784049 CTATATGTAAGGAGCTGGGTAGG + Intronic
1119144577 14:72299764-72299786 CCATGTGTATGTATCTTTCTTGG + Intronic
1123465486 15:20511730-20511752 CTCTGTGAAGGGAGCTTGGTGGG - Intergenic
1123652630 15:22489307-22489329 CTCTGTGAAGGGAGCTTGGTGGG + Intergenic
1123743054 15:23298166-23298188 CTCTGTGAAGGGAGCTTGGTGGG + Intergenic
1124276208 15:28327709-28327731 CTCTGTGAAGGGAGCTTGGTGGG - Intergenic
1124306490 15:28583898-28583920 CTCTGTGAAGGGAGCTTGGTGGG + Intergenic
1125485253 15:40107132-40107154 GTATGTGTAGGGAGCTGGGTTGG - Intronic
1125722364 15:41851442-41851464 CCATGTGTGTGGAGCTTCCCAGG + Intronic
1129065568 15:72901226-72901248 CGATGTGTCTGGAGCTTGGAGGG + Intergenic
1131968910 15:97873136-97873158 CAATGTGTATGCACCTTGGCAGG - Intergenic
1132677719 16:1127525-1127547 CCGTGTGGATGGAGCTGGGGCGG + Intergenic
1133034919 16:3029176-3029198 CCAGGTATAGGGAGCTTAGTGGG + Intronic
1133203933 16:4221550-4221572 CCATGTCTGAGGAGCTTAGTGGG + Intronic
1136335161 16:29606146-29606168 GCATGTTTAAGGAGCTGGGTGGG - Intergenic
1137684224 16:50374594-50374616 GCATGTGTCTGGGGCTTGGAAGG + Intergenic
1138422539 16:56908880-56908902 CCTTGGGTATGGTGCCTGGTGGG + Intronic
1139283048 16:65786189-65786211 CCATGTGGATGGGGGTAGGTGGG - Intergenic
1142408402 16:89903831-89903853 CCATGTGTGTGGAGGGTGGTGGG + Intronic
1142703658 17:1680086-1680108 CCCAGTGTTTGGAGCTTGGGTGG - Intronic
1151246975 17:72802682-72802704 GCATGTGTATGGGGCGTGGTGGG + Intronic
1151736157 17:75941617-75941639 GCATGTGAATGGATCATGGTTGG - Exonic
1155073144 18:22333631-22333653 CAATGTTTATGGAGATTGATAGG - Intergenic
1159103575 18:63981174-63981196 CCATGGGAATGGAGCGTGATAGG - Intronic
1160037418 18:75314754-75314776 CCATGTGTCTGGCCCATGGTAGG + Intergenic
1162094524 19:8302661-8302683 CCATGTGTATGGAGCTTGGTGGG - Intronic
1167051661 19:47082805-47082827 CCAGGAGTCTGGAGCTGGGTGGG - Intronic
932950461 2:76287217-76287239 CCATGTGCCAGGATCTTGGTGGG - Intergenic
933039654 2:77447417-77447439 CCAGCTGAATAGAGCTTGGTAGG + Intronic
933479347 2:82835426-82835448 CTATGTGTATGGGGTTGGGTGGG + Intergenic
936621806 2:114107953-114107975 CTCTGTGAATGGAGCTTTGTAGG + Intergenic
937475008 2:122207548-122207570 CCATGTGTCTGGGGATTGATAGG + Intergenic
939008070 2:136811886-136811908 CAATGAGTATGGAGGATGGTGGG - Intronic
939865694 2:147469998-147470020 TTATGTGTTTGGAGTTTGGTGGG - Intergenic
940545200 2:155074260-155074282 CGATGTGTATAGAGCCTGGAGGG + Intergenic
945569149 2:211442231-211442253 GCATGTGTCTGTAGCATGGTAGG - Intronic
946507218 2:220314524-220314546 CCATATGAATTGAGGTTGGTAGG - Intergenic
1173379038 20:42520955-42520977 ACATATGTATGTAGGTTGGTGGG - Intronic
1176146214 20:63566668-63566690 TGAGGTGTCTGGAGCTTGGTGGG - Intronic
1177336026 21:19728935-19728957 CCATGTGTATGGACGTGGGTAGG - Intergenic
1181558925 22:23688441-23688463 TCAGGTGTTTGGAGCCTGGTAGG + Intronic
1182532189 22:30969149-30969171 CCATGTGACCGGATCTTGGTTGG + Intergenic
949892614 3:8744618-8744640 CCATGTGTAGGCAGCTAGGAAGG + Intronic
950112892 3:10431768-10431790 CCCAGTGTCTGGCGCTTGGTAGG + Intronic
950238763 3:11348516-11348538 AGATGTGTCTGGAGTTTGGTGGG + Intronic
950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG + Intronic
953110889 3:39937061-39937083 CCAAGTGTATGGGGGTGGGTAGG - Intronic
953791336 3:45950273-45950295 CCAGGTGTTGGGAACTTGGTAGG - Intronic
954776769 3:53026547-53026569 CCATGAACATGCAGCTTGGTAGG - Intronic
958180245 3:90050615-90050637 CTATGTGTGTGGAGGGTGGTAGG + Intergenic
962384219 3:134919976-134919998 GCAGATGTATGGAGCCTGGTAGG - Intronic
962403532 3:135081306-135081328 CCATATGTATGGAGGGTGGAGGG + Intronic
963354250 3:144190370-144190392 GAATGTGAATGGTGCTTGGTAGG + Intergenic
963425965 3:145124091-145124113 CCAGGTGTCTGGAGCATGGCTGG + Intergenic
967168741 3:186807109-186807131 CACTGTGCATGAAGCTTGGTGGG - Intergenic
967290474 3:187914911-187914933 CCATGTGGATGAAGGTTGGAAGG + Intergenic
970353169 4:15226679-15226701 TTATGTCTATGGGGCTTGGTGGG + Intergenic
976805944 4:89047056-89047078 CCCTGTGTTCGGAGCCTGGTTGG - Intronic
978612172 4:110554509-110554531 CCATCTCTATGAAGATTGGTTGG + Intronic
981854330 4:149269557-149269579 CCATGTATATGCATCTGGGTAGG + Intergenic
982079057 4:151769695-151769717 CCATGTGGATGGGTTTTGGTGGG - Intergenic
986767927 5:10944693-10944715 CCATGTGGATGGATCTGGGATGG - Intergenic
992071113 5:73150539-73150561 CCCAGTGGTTGGAGCTTGGTTGG + Intergenic
992350665 5:75925513-75925535 CTATGTGTATGGAGATTGGAAGG - Intergenic
997726748 5:136127348-136127370 CCATGTGGAGGGAGTTTGCTTGG - Intergenic
997726765 5:136127539-136127561 CCATGTGGAGGGAGTTTGCTTGG - Intergenic
997823711 5:137088065-137088087 CCATGTGTGTGAAGATTGCTGGG + Intronic
999253939 5:150199169-150199191 CCATGTCTGTGGAGCCTGGTGGG + Intronic
1000156889 5:158561062-158561084 CCATCTGTCTGTAGCCTGGTTGG + Intergenic
1001349224 5:170940974-170940996 CCAAGTGTATGGGGTTTTGTGGG - Intronic
1001912548 5:175533071-175533093 CCATATGAATGGAGCCTGTTGGG + Intergenic
1004021857 6:11783173-11783195 AGATGTGTTTGAAGCTTGGTGGG - Intronic
1013875283 6:114819277-114819299 TCATGAGTATGCAGTTTGGTGGG + Intergenic
1019714007 7:2530087-2530109 CCCTGTGTGTGGAGCGGGGTGGG + Intergenic
1022180404 7:27913488-27913510 CCACGTGAACAGAGCTTGGTGGG + Intronic
1023504033 7:40881474-40881496 ACATGTTTATGGAACTTGGGAGG + Intergenic
1029932396 7:104386262-104386284 CCCTGTGAATGGAGCTTTTTAGG - Intronic
1030802748 7:113873012-113873034 TCATGTGTATGCTGCTGGGTGGG + Intergenic
1033022448 7:137739963-137739985 CCATGTCTTTGAAGGTTGGTAGG + Intronic
1034321211 7:150184420-150184442 CCATGTCTATGGACCTTGACTGG + Intergenic
1034336912 7:150329825-150329847 GCATTTGGATAGAGCTTGGTTGG + Exonic
1034771536 7:153782844-153782866 CCATGTCTATGGACCTTGACTGG - Intergenic
1041968976 8:63715053-63715075 CCTTGTGAATGGAGCTGGGTAGG - Intergenic
1044260255 8:90111292-90111314 CCATATGTAAAGTGCTTGGTGGG + Intergenic
1045984931 8:108239057-108239079 CCTTGGGCATGGAGCTTGGAAGG + Intronic
1049325542 8:142019631-142019653 CCATGAGGGTGGAGCCTGGTGGG + Intergenic
1051055568 9:12981009-12981031 CCATGTTTATGGAGGGTGGAGGG - Intergenic
1055018235 9:71642303-71642325 CCATGTGGCTAGAGCTTAGTGGG + Intergenic
1055099148 9:72445345-72445367 GGATGTGTATGGAGGTTGATTGG + Intergenic
1062013616 9:134280332-134280354 ACCTGTGTCTGGATCTTGGTGGG - Intergenic
1203769321 EBV:40871-40893 CCAGGTGGGTGGAGCTAGGTAGG + Intergenic
1203789599 EBV:143790-143812 CCAGGTGGGTGGAGCTAGGTAGG + Intergenic
1185569734 X:1124365-1124387 CCATGTGTGTGGAGGCTGGAAGG - Intergenic
1185801404 X:3014632-3014654 CCAGGTATCTGGAGCTTGCTAGG - Intronic
1189005349 X:36988238-36988260 TCAGGTGTCTGGAGGTTGGTTGG + Intergenic
1192762001 X:74103888-74103910 ACCTGTGTATGGAGCTTAGAGGG - Intergenic
1197764994 X:130054493-130054515 TCATGTGGCTGGTGCTTGGTAGG + Intronic
1198753541 X:139959207-139959229 CCAGGATGATGGAGCTTGGTGGG + Intronic
1201650094 Y:16275675-16275697 CCATTTGAATGGAGCTTTTTGGG - Intergenic
1201761644 Y:17545943-17545965 CTCTTTGTATGGAGATTGGTAGG - Intergenic
1201839908 Y:18360047-18360069 CTCTTTGTATGGAGATTGGTAGG + Intergenic