ID: 1162095890

View in Genome Browser
Species Human (GRCh38)
Location 19:8309734-8309756
Sequence GGGCGGTCTCAGCACCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 98}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162095877_1162095890 18 Left 1162095877 19:8309693-8309715 CCTGCTGCCTGTAGCCGTGGCCT 0: 1
1: 0
2: 2
3: 24
4: 226
Right 1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 98
1162095888_1162095890 -9 Left 1162095888 19:8309720-8309742 CCTTCCAGAGGGCAGGGCGGTCT 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 98
1162095879_1162095890 4 Left 1162095879 19:8309707-8309729 CCGTGGCCTTTCCCCTTCCAGAG 0: 1
1: 0
2: 3
3: 38
4: 392
Right 1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 98
1162095878_1162095890 11 Left 1162095878 19:8309700-8309722 CCTGTAGCCGTGGCCTTTCCCCT 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 98
1162095887_1162095890 -8 Left 1162095887 19:8309719-8309741 CCCTTCCAGAGGGCAGGGCGGTC 0: 1
1: 0
2: 3
3: 9
4: 155
Right 1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 98
1162095882_1162095890 -2 Left 1162095882 19:8309713-8309735 CCTTTCCCCTTCCAGAGGGCAGG 0: 1
1: 1
2: 2
3: 61
4: 367
Right 1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 98
1162095886_1162095890 -7 Left 1162095886 19:8309718-8309740 CCCCTTCCAGAGGGCAGGGCGGT 0: 1
1: 0
2: 3
3: 12
4: 167
Right 1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG 0: 1
1: 0
2: 0
3: 14
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162095890 Original CRISPR GGGCGGTCTCAGCACCCTCT TGG Intronic
900298619 1:1965450-1965472 GGGCAGTGTCAGCACACACTGGG + Intronic
900609562 1:3538825-3538847 GGGCTGACACAGCACCCGCTGGG + Intronic
901082517 1:6591637-6591659 GGGTGGGCTCAGCAGCCCCTAGG + Exonic
902876487 1:19343718-19343740 GGGCGCTCTCTGGACCCTCCAGG - Intronic
908090513 1:60680619-60680641 GGGCAGTCTAGGCACCCCCTTGG - Intergenic
908293053 1:62687781-62687803 GGGCGGACCCCGCACCCTCTAGG + Intronic
915444191 1:155965558-155965580 GGGACCTCTCAGCACCCCCTTGG + Intronic
920388301 1:205583002-205583024 GGGCGCTCTCACCAGCCTCTGGG + Intronic
923684798 1:236146549-236146571 GGGGGGTAACAGTACCCTCTGGG - Intronic
1072625447 10:97108163-97108185 GGGTGGCATCAGCACCCTGTGGG + Intronic
1073574182 10:104608107-104608129 TGGCTGTCTCAGTAGCCTCTAGG - Intergenic
1074198301 10:111208397-111208419 GGGAGCCCTCACCACCCTCTGGG - Intergenic
1076486271 10:130820581-130820603 GGACAGTCACAGCACACTCTTGG + Intergenic
1076996276 11:298932-298954 GGGGTGTCTCAGCACCCTGGGGG - Intronic
1077167663 11:1151046-1151068 GCAGGGTCTCAGCTCCCTCTGGG + Intergenic
1081701483 11:45155402-45155424 GGGCGGACTCAGCACCGTCATGG + Intronic
1083173288 11:60935163-60935185 GGGTGCTCCCAGCACCCTCACGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083726621 11:64631755-64631777 GGTAGGCCTCAGCAGCCTCTTGG - Intronic
1085521870 11:77143843-77143865 GGGAGGGCTCAGGACCCTCGAGG + Intronic
1091219442 11:133921289-133921311 GGTGGGGCTCAGCATCCTCTTGG + Exonic
1091838665 12:3603790-3603812 GGGAGGCCTCAGCACCCTGTTGG + Intergenic
1092753977 12:11745627-11745649 GGGCAGACTCAGCTCCTTCTTGG + Intronic
1095133572 12:38571601-38571623 GGGCGATGCCAGCACTCTCTTGG - Intergenic
1102951918 12:117036826-117036848 GGGGCATCTCAGCACCATCTGGG + Intergenic
1103676683 12:122661352-122661374 GGGCAGTCCCAGCAACCTCAGGG - Intergenic
1112325120 13:98438818-98438840 GGGCAGCCTCAGCAAGCTCTCGG + Exonic
1113634421 13:111910014-111910036 GGGGGGTCCCATCACCCTTTTGG - Intergenic
1114616923 14:24073252-24073274 GGTCAATCTCAGGACCCTCTGGG - Intronic
1117757415 14:58990094-58990116 TGGCTGTCTCAGTACCCTCTGGG - Intergenic
1118963396 14:70556452-70556474 GGGAGTTCTCAGCACCCCTTTGG + Intergenic
1122449825 14:101796712-101796734 GGTCAGTCTCAGCTCTCTCTGGG + Intronic
1122891164 14:104732913-104732935 TGGGGGTCACAGCACCCTCCTGG - Intronic
1122903290 14:104790769-104790791 GGCCAGCCTCAGCAGCCTCTGGG - Intronic
1123119484 14:105910127-105910149 GGGTGGGCCCAGGACCCTCTGGG + Intergenic
1123187145 14:106530844-106530866 GGGAGCTCTCAGAACCATCTGGG - Intergenic
1124252233 15:28114276-28114298 GGGCTGTCTCAACCCCCTCCAGG - Intronic
1125759916 15:42089297-42089319 GGGCTGGCTCAGCACCCACGGGG + Intronic
1128287852 15:66453188-66453210 GGGAGGTTTCAGCACACTCCTGG + Intronic
1132864236 16:2085745-2085767 GGGCAGCCTCAGCGCCCTATAGG + Intronic
1138419969 16:56892718-56892740 GGGCAGTCCCAGAGCCCTCTGGG - Intronic
1141020540 16:80491922-80491944 GGGCTGACTCAGAACCCCCTGGG - Intergenic
1143552678 17:7640753-7640775 GCTCGCTCTCAGCACCTTCTCGG + Intergenic
1143656315 17:8295676-8295698 GGGCGGTCCCAGCACCCCAGTGG - Intergenic
1143683292 17:8493639-8493661 GGGCTGTCTCAGCTCCATTTGGG - Intronic
1143710121 17:8728590-8728612 GGGCAGTCTGAGGGCCCTCTAGG + Intergenic
1144330765 17:14222086-14222108 GTGTGGTCTCAGCACCCCCGGGG - Intergenic
1146568295 17:33932039-33932061 GGCCTGGCTCAGCTCCCTCTTGG - Intronic
1147122435 17:38343612-38343634 GGGCGGCCTCGGCCCCCTCTAGG + Exonic
1148602991 17:48908359-48908381 GGGCGGAGCCAGCACCGTCTGGG + Exonic
1148888817 17:50793090-50793112 GGGCGCTCCCAGCACCCACCTGG + Intergenic
1151486646 17:74405086-74405108 GGCAGGTCTGAGCACCCTTTAGG + Intergenic
1153989719 18:10385508-10385530 AGGCTGTCTCAGCACCCTCAGGG + Intergenic
1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG + Intronic
1164523164 19:28994367-28994389 GGTCTGTCTGAGCACCCTGTGGG - Intergenic
1164639222 19:29812270-29812292 CCGCGCTCTCAGCACCCTCCCGG - Intronic
1166107485 19:40604467-40604489 GGGCGGGGTCAGCGCCGTCTGGG + Intronic
1168301799 19:55408947-55408969 GTGCGGTCGCAGTGCCCTCTCGG + Intergenic
926061585 2:9808130-9808152 GGGCCGGCTCAGCCCCCTTTTGG + Intergenic
927422548 2:22948429-22948451 GGGCAGGCTCAGCGCCCTCAAGG + Intergenic
930446487 2:51480166-51480188 GGGAGATCTCAGCACCTTATTGG + Intergenic
931762696 2:65431679-65431701 CGGCGGTCTCCGCTCCCTCTCGG - Intronic
932590558 2:73064168-73064190 GGGCGGTGTCAGCTTCTTCTGGG - Intronic
942109984 2:172672473-172672495 GGGAGGTCTCAGCAGCCTTTTGG - Intergenic
946339171 2:219057345-219057367 GGGCGGGCTCTTCACCTTCTCGG + Intronic
1170968838 20:21100778-21100800 GGGCGGTTTCTGCACCCAGTTGG + Intergenic
1171141554 20:22748058-22748080 GGGCACTCTCAGCAGCCTCCCGG - Intergenic
1171490004 20:25510229-25510251 GGGCAGTCTCAGCACCCACCAGG - Intronic
1172006592 20:31822636-31822658 GGGGGGTGTCAGGACACTCTGGG - Intronic
1172855165 20:37996101-37996123 GAGAGGACTCAGCACCCTCCTGG - Intronic
1181298320 22:21860175-21860197 GCGCTGTCTCTGCTCCCTCTAGG - Intronic
1181311384 22:21946662-21946684 GGGTGGCCCCAGCAGCCTCTGGG - Intronic
1181555645 22:23670361-23670383 GGACTGTCTCAGTAGCCTCTGGG - Intergenic
1181620077 22:24085017-24085039 GGGAGGGGTCAGCCCCCTCTGGG - Exonic
1185178942 22:49348309-49348331 GGGCGCTCTCTGCACCCTGGAGG + Intergenic
1185213407 22:49584950-49584972 GGGCTCTCCCTGCACCCTCTGGG - Intronic
1185344971 22:50307125-50307147 GGGCCGTCCCCGCACCCCCTGGG - Intronic
949445024 3:4125782-4125804 CTCCTGTCTCAGCACCCTCTGGG + Intronic
950456148 3:13093824-13093846 GTCCGTTCTCAGCACCCTCTAGG + Intergenic
954843451 3:53533596-53533618 CTGCGGTCCCTGCACCCTCTGGG - Intronic
962753583 3:138451883-138451905 GTGCGCTCTCCGCACCCACTCGG - Intronic
967511952 3:190322539-190322561 GGGCGCTCCCGGCGCCCTCTCGG - Intronic
968706098 4:2078530-2078552 GTGCGATCTCAGCTCACTCTAGG + Intronic
972856456 4:43113647-43113669 GGGTGATGTCAGCACTCTCTTGG - Intergenic
985537633 5:473749-473771 GGGCTTTCTGAGCTCCCTCTGGG - Intronic
986004905 5:3659461-3659483 GGGCTGAGTGAGCACCCTCTAGG - Intergenic
990981426 5:61605649-61605671 CTGGGGTCTCAGCACCTTCTGGG - Intergenic
999640945 5:153672717-153672739 CAGCGGTCCCAGCTCCCTCTTGG - Intronic
1000629292 5:163573510-163573532 GCGCGATCTCAGCACCCCCCAGG - Intergenic
1007120488 6:39376732-39376754 GAGCTATCTCAGCTCCCTCTGGG - Intronic
1010011301 6:71051200-71051222 GGGCAGCCTCAGCAAGCTCTCGG - Intergenic
1016989802 6:149921458-149921480 GGGTGGGCTCCTCACCCTCTAGG + Intronic
1019525564 7:1478963-1478985 GGCAGGTCTCAGCAGCCTCACGG - Intronic
1019938658 7:4272343-4272365 TGGCGGCCTCAGCACCCCCATGG + Intergenic
1021949163 7:25757374-25757396 TGGCTGGCTCAGCACTCTCTGGG - Intergenic
1022035101 7:26526575-26526597 GGGCTGTCCCAGCACCCACTGGG - Intergenic
1026360204 7:69597148-69597170 GCCCGCTCTCAGCAGCCTCTTGG - Intergenic
1032942386 7:136810115-136810137 GGGTGGTATAAGCACTCTCTTGG - Intergenic
1037579252 8:20234970-20234992 GGGCGGTTTAAACAACCTCTCGG + Intergenic
1038778569 8:30552002-30552024 GGGAGGGCTCAGGAGCCTCTGGG - Intronic
1045305222 8:100951959-100951981 GGACGGGCTCAGCAGTCTCTGGG + Exonic
1046494328 8:114994533-114994555 GGTCGCTCTCATCACCTTCTTGG + Intergenic
1047767932 8:128004468-128004490 GGGTGGGCTCAGGACTCTCTCGG - Intergenic
1048685003 8:136894892-136894914 GGGCAGTCACAGCAACATCTAGG - Intergenic
1052990574 9:34517253-34517275 GGTCGGTGTCAGCACACTCAGGG - Intronic
1056725763 9:89114623-89114645 GAGTGGTTTCAGGACCCTCTAGG - Intronic
1061076238 9:128343173-128343195 GGGCAGTTTCAGCACCAGCTTGG - Exonic
1061295804 9:129676089-129676111 GGGCTGGGTCTGCACCCTCTGGG + Intronic
1061992384 9:134166465-134166487 GGGAGGCCACAGCACCCTCTCGG + Intergenic
1062010238 9:134263234-134263256 GGGCGCCCTGAGCACCCCCTGGG - Intergenic
1062092850 9:134687611-134687633 GGTCGGTCTCAGGAACCTCTGGG + Intronic
1062592815 9:137281659-137281681 GGGAGTCCTCAGGACCCTCTGGG - Exonic
1192940863 X:75910208-75910230 GGGTGATACCAGCACCCTCTTGG + Intergenic