ID: 1162096855

View in Genome Browser
Species Human (GRCh38)
Location 19:8315263-8315285
Sequence CCGGTAAAGGGTCTGTGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1138
Summary {0: 1, 1: 8, 2: 556, 3: 333, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162096847_1162096855 -10 Left 1162096847 19:8315250-8315272 CCCCAGCCCGACACCGGTAAAGG 0: 5
1: 360
2: 316
3: 212
4: 153
Right 1162096855 19:8315263-8315285 CCGGTAAAGGGTCTGTGATGAGG 0: 1
1: 8
2: 556
3: 333
4: 240
1162096846_1162096855 -9 Left 1162096846 19:8315249-8315271 CCCCCAGCCCGACACCGGTAAAG 0: 4
1: 350
2: 320
3: 225
4: 156
Right 1162096855 19:8315263-8315285 CCGGTAAAGGGTCTGTGATGAGG 0: 1
1: 8
2: 556
3: 333
4: 240
1162096845_1162096855 -5 Left 1162096845 19:8315245-8315267 CCGTCCCCCAGCCCGACACCGGT 0: 5
1: 305
2: 264
3: 195
4: 773
Right 1162096855 19:8315263-8315285 CCGGTAAAGGGTCTGTGATGAGG 0: 1
1: 8
2: 556
3: 333
4: 240
1162096843_1162096855 0 Left 1162096843 19:8315240-8315262 CCTGACCGTCCCCCAGCCCGACA 0: 308
1: 307
2: 263
3: 120
4: 172
Right 1162096855 19:8315263-8315285 CCGGTAAAGGGTCTGTGATGAGG 0: 1
1: 8
2: 556
3: 333
4: 240
1162096842_1162096855 19 Left 1162096842 19:8315221-8315243 CCTCGTGGGAAAGGAAAGACCTG 0: 3
1: 386
2: 277
3: 262
4: 367
Right 1162096855 19:8315263-8315285 CCGGTAAAGGGTCTGTGATGAGG 0: 1
1: 8
2: 556
3: 333
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162096855 Original CRISPR CCGGTAAAGGGTCTGTGATG AGG Intronic
900201633 1:1410221-1410243 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
900234445 1:1580757-1580779 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
900335236 1:2159550-2159572 CCCATAAAGGGTCTGTGAGTGGG + Intronic
900654761 1:3750808-3750830 CCCATGAAGGGTCTGTGCTGAGG + Intergenic
900860720 1:5227433-5227455 GCTGTACAGGGTCCGTGATGTGG + Intergenic
900907957 1:5574163-5574185 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
901398851 1:9002236-9002258 CCCGTAAAGGGTCTGTGCCGAGG + Intergenic
901601593 1:10427076-10427098 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
901955916 1:12785505-12785527 CCCATTAAGGGTCTGTGCTGAGG - Intergenic
901978336 1:13013008-13013030 CCCGTGAAGGGTCTGTGCTGAGG - Intronic
901991010 1:13113933-13113955 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
902003747 1:13215930-13215952 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
902022972 1:13361674-13361696 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
902248205 1:15135859-15135881 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
902281715 1:15379548-15379570 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
902636726 1:17739632-17739654 CTGCTAAAGGTTCTGAGATGGGG + Intergenic
902968621 1:20030579-20030601 CCCATAAAGGGCCTGTGCTGAGG - Intronic
903746182 1:25588264-25588286 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
903919454 1:26788832-26788854 CCAGTTAAGAGTCTGTGATTTGG + Intronic
904269251 1:29338610-29338632 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
904272532 1:29359740-29359762 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
904797007 1:33063931-33063953 CCCATAAAAGGTCTGTGCTGAGG + Intronic
905227603 1:36489497-36489519 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
905380805 1:37560229-37560251 CCCGTGAAGGGTCTGTGCTGAGG - Intronic
905628520 1:39505147-39505169 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
905751852 1:40472175-40472197 CCCATAAAGAGTCTGTGCTGAGG + Intergenic
905762575 1:40572441-40572463 CCCGTAAAGGGTCTGTGTTGAGG + Intergenic
906404186 1:45528515-45528537 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
906498225 1:46320706-46320728 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
906499347 1:46329958-46329980 CCCGTAAAGGTTCTGTGCTGAGG + Intergenic
906508362 1:46396411-46396433 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
906564495 1:46788965-46788987 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
906601527 1:47133620-47133642 CCCGTAAAGAGTCTGTGCTGAGG + Intergenic
907120834 1:52006658-52006680 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
907465898 1:54636647-54636669 CCCATAAAGGGTCTGTGCTGAGG - Exonic
908022693 1:59914784-59914806 CCCGTGAAGGGTCTGTGCTGGGG + Intronic
908024730 1:59938716-59938738 CCCGTGAATGGTCTGTGCTGAGG - Intergenic
908238753 1:62171537-62171559 CTCGTAAAGGGTCTGTGCTGAGG - Intergenic
908543113 1:65140210-65140232 CCTCTAAAGGGTCTGTGCTGAGG + Intergenic
908660013 1:66425346-66425368 TCCGTAAAGGGTCTGTGCTGAGG - Intergenic
908674855 1:66592117-66592139 TCGGTAAAGGGTCTGTGCTGAGG - Intronic
909023795 1:70460962-70460984 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
909234101 1:73129828-73129850 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
909413198 1:75377500-75377522 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
909413849 1:75382905-75382927 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
909475043 1:76073086-76073108 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
909651775 1:77983401-77983423 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
909793452 1:79702756-79702778 CCCCTAAAGGGTCTGTGCTGTGG + Intergenic
910604369 1:89067394-89067416 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
911010642 1:93277313-93277335 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
911595454 1:99794117-99794139 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
911599865 1:99836335-99836357 CCTGTAAAGGGTATGTGCTGAGG - Intergenic
911947834 1:104135275-104135297 CCGGTAGAGGGTCTGTGCTGAGG - Intergenic
912301065 1:108517860-108517882 ACCATAAAGGGTCTGTGCTGAGG + Intergenic
912450902 1:109767033-109767055 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
912642426 1:111360252-111360274 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
912814380 1:112817336-112817358 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
912942611 1:114058567-114058589 TCCGTAAAGGGTCTGTGCTGAGG + Intergenic
913601445 1:120425166-120425188 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
914085602 1:144451429-144451451 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
914097476 1:144556055-144556077 CCCGTAAAGTGTCTGTGCTGAGG - Intergenic
914191494 1:145415408-145415430 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
914252459 1:145932847-145932869 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
914301518 1:146381563-146381585 CCCGTAAAGTGTCTGTGCTGAGG + Intergenic
914358288 1:146907760-146907782 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
914362632 1:146948726-146948748 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
914379922 1:147106641-147106663 CCCATAAAGGGTCTGTGCTAAGG - Intergenic
914393201 1:147240510-147240532 CCCATAAAGGGTCTGTGCTGAGG + Intronic
914441316 1:147709967-147709989 CCCATAAAAGGTCTGTGCTGAGG - Intergenic
914444042 1:147734372-147734394 CCCGTAAAGGGACTGTGCTGAGG - Intergenic
914489036 1:148138368-148138390 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
914495137 1:148189247-148189269 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
914589422 1:149093412-149093434 CCCATAAAGGGTCTGTGCTGAGG - Intronic
914765609 1:150635327-150635349 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
914773135 1:150709631-150709653 CCCATAAAAGGTCTGTGCTGAGG + Intronic
914924535 1:151872919-151872941 CCCGCAAAGGGTCTGTGCTGAGG + Intergenic
914985734 1:152455644-152455666 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
915052338 1:153088809-153088831 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
915401791 1:155627197-155627219 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
915402696 1:155635409-155635431 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
915480247 1:156179637-156179659 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
915480577 1:156181875-156181897 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
915890422 1:159768210-159768232 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
916005053 1:160652553-160652575 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
916009400 1:160691200-160691222 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
916010292 1:160699463-160699485 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
916034959 1:160913570-160913592 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
916039140 1:160947459-160947481 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
916039384 1:160949354-160949376 CCCACAAAGGGTCTGTGCTGAGG - Intronic
916048299 1:161017250-161017272 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
916103532 1:161413070-161413092 CCCTTAAAGGGTCTGTGATGAGG + Intergenic
916106205 1:161434345-161434367 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
916630335 1:166605926-166605948 CCTATGAAGGGTCTGTGCTGAGG - Intergenic
917291279 1:173474843-173474865 CCAGTAAAGGGTCTGTGCTGAGG + Intergenic
918784856 1:188751767-188751789 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
919326105 1:196109267-196109289 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
919484509 1:198130244-198130266 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
919514123 1:198500570-198500592 ACTGTAAAGGATCTGTGAAGAGG + Intergenic
920629263 1:207635642-207635664 CCCGTAAAGGGTCTGCGCTGAGG - Intronic
920796393 1:209141597-209141619 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
921019409 1:211222663-211222685 CCCATAAAAGGTCTGTGCTGAGG - Intergenic
921821184 1:219619136-219619158 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
922305424 1:224340245-224340267 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
922398542 1:225227152-225227174 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
922484906 1:225966274-225966296 CCCATAAAGGGTCTATGCTGAGG + Intergenic
922682001 1:227606586-227606608 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
922715511 1:227868871-227868893 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
923440316 1:234012372-234012394 CCCATACAGGGTCTGTGCTGAGG - Intronic
923725872 1:236504943-236504965 CCTGTAAAGGGTCTGTGCCGAGG + Intergenic
923936169 1:238762851-238762873 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
924666976 1:246083099-246083121 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
924764164 1:247016314-247016336 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
924829902 1:247582421-247582443 CCTGTGAAGGGTCTGTGCTGAGG + Intergenic
1063114143 10:3061902-3061924 CCCGTAAATGGTCTGTGCTGAGG + Intergenic
1063279239 10:4607157-4607179 CAGGTAAGGCGTCTGTGGTGGGG - Intergenic
1063306236 10:4903512-4903534 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1063530320 10:6824711-6824733 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1063531244 10:6833205-6833227 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1064525392 10:16250404-16250426 CACATAAAGGGTCTGTGCTGAGG + Intergenic
1064834459 10:19510327-19510349 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
1065453390 10:25881662-25881684 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1065500541 10:26377416-26377438 CCCGTAAAGTGTCTGTGCTGAGG - Intergenic
1065553754 10:26893884-26893906 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1065809352 10:29427156-29427178 CCCTTAAAGGGTCTGTGCTGAGG + Intergenic
1066175072 10:32894901-32894923 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1066635295 10:37493739-37493761 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1066927273 10:41713600-41713622 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1067101449 10:43337617-43337639 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1067574160 10:47397399-47397421 CTCGTAAAGGGTCTGTGCTGAGG - Intergenic
1069071211 10:63992121-63992143 CAGTTAATGGGTCTGGGATGGGG + Intergenic
1069184824 10:65409761-65409783 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1069452096 10:68526083-68526105 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1069677315 10:70257636-70257658 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
1069925597 10:71848406-71848428 CCAGTAAATGGTCTATGATTTGG + Intronic
1070870247 10:79745007-79745029 CCCATAAAGTGTCTGTGCTGAGG + Intergenic
1070998321 10:80806326-80806348 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1071637168 10:87267227-87267249 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1071658077 10:87470727-87470749 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1071938580 10:90560266-90560288 CTGGTACAGGGTCTTTTATGTGG - Intergenic
1072410500 10:95197755-95197777 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1072541778 10:96403684-96403706 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1072669268 10:97417362-97417384 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1072708581 10:97700262-97700284 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1072947287 10:99821368-99821390 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1073106293 10:101034095-101034117 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1073286370 10:102391860-102391882 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1073298330 10:102454901-102454923 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1074108507 10:110406278-110406300 CTGGTAAGGGGACTGTGGTGAGG - Intergenic
1075061294 10:119258794-119258816 CTGGTAAAGGGTATGTCATCAGG + Intronic
1075370458 10:121930476-121930498 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1076100626 10:127774812-127774834 CTGGGAAAGGGTGTGTAATGAGG - Intergenic
1076459248 10:130628367-130628389 CCCGTAAAAGGTCTGTGCTGAGG + Intergenic
1076932440 10:133541587-133541609 CCCATAAATGGTCTGTGCTGAGG - Intronic
1076940167 10:133599946-133599968 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1076941216 10:133610423-133610445 CCCATAAAGGGTCTGTGCCGAGG + Intergenic
1076980536 11:202116-202138 ACCGTAAAGGGTCTGTGCTGAGG + Intronic
1077042812 11:532096-532118 CCGGTCAGGGGTCTGGGCTGTGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077577424 11:3395114-3395136 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1077586336 11:3456512-3456534 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1077597389 11:3545796-3545818 CCCATAAACGGTCTGTGCTGAGG + Intergenic
1077703259 11:4461028-4461050 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
1078216908 11:9319292-9319314 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1078327398 11:10391840-10391862 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1079251719 11:18791946-18791968 GGGGTTAAGGGTCTGTGATCCGG - Intronic
1079262881 11:18900527-18900549 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1079664914 11:23093065-23093087 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1079769988 11:24446500-24446522 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1079851459 11:25541146-25541168 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1080518950 11:33049844-33049866 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
1081014525 11:37859348-37859370 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1081019773 11:37931011-37931033 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1082267178 11:50131698-50131720 CCCATAAATGGTCTGTGCTGAGG - Intergenic
1082288911 11:50346870-50346892 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1082621721 11:55431409-55431431 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1082672971 11:56058068-56058090 CCCATAAAGGGTCTGGGCTGAGG + Intergenic
1082706874 11:56503133-56503155 CCCGTAAAGGGTCTGTGATGAGG - Intergenic
1082716366 11:56618881-56618903 CCCGTGAAGGGTCTGTGCTCGGG - Intergenic
1083040584 11:59681573-59681595 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1083139952 11:60713699-60713721 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1083146029 11:60759524-60759546 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1083285393 11:61655540-61655562 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1083372805 11:62195075-62195097 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1083388057 11:62327011-62327033 CCTGTAAAGCGTCTGTGCTGAGG + Intergenic
1083393034 11:62369017-62369039 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1083394755 11:62382637-62382659 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1083467593 11:62859047-62859069 CCCGTAAAGCGTCTGTGCTGAGG - Intronic
1083543110 11:63528502-63528524 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1083543407 11:63530845-63530867 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1084207398 11:67603885-67603907 CCCGTAAAGGGTCTGTGCTGAGG - Exonic
1084226375 11:67717050-67717072 CCAGTAAAGGGTCTGTGCTGAGG - Intergenic
1084229378 11:67739899-67739921 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1084231715 11:67758298-67758320 CCCGTAAACGGTCTGTGCTGAGG + Intergenic
1084242329 11:67830544-67830566 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1084247388 11:67868495-67868517 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1084259822 11:67968810-67968832 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1084799721 11:71535111-71535133 CCCATGAAGGGTCTGTGCTGAGG + Intronic
1084812954 11:71626442-71626464 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1084819388 11:71674222-71674244 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1084830769 11:71767476-71767498 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1084845923 11:71899798-71899820 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1084880102 11:72164788-72164810 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1085463914 11:76711531-76711553 TCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1087314142 11:96586544-96586566 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1087686857 11:101274749-101274771 CTGGTGGAGGGTCTGTGAGGAGG + Intergenic
1087723736 11:101695477-101695499 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1087724667 11:101703975-101703997 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1088032230 11:105265266-105265288 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1088858393 11:113777482-113777504 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1089472103 11:118729737-118729759 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1089512469 11:119008664-119008686 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
1089517047 11:119039800-119039822 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1090039741 11:123280126-123280148 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1090095603 11:123739854-123739876 CTGGTAATAGGTCTGTGCTGGGG - Intronic
1090532530 11:127605932-127605954 ATGGTAAATGGTCTGTAATGAGG - Intergenic
1091009517 11:131985872-131985894 CCTGTAAAGAGTCTGTCATCAGG + Intronic
1091963862 12:4721763-4721785 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1092049439 12:5457380-5457402 CCAGAGAAGGGTCTGTGATAAGG - Intronic
1092059573 12:5537432-5537454 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1092142246 12:6191832-6191854 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1092234514 12:6797948-6797970 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1092249680 12:6886385-6886407 CCCGTAAAGGTTCTGTGCTGAGG - Intronic
1092405684 12:8220622-8220644 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1092412571 12:8265246-8265268 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1092431116 12:8409780-8409802 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1092434018 12:8431969-8431991 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1092437538 12:8462346-8462368 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1092455108 12:8636078-8636100 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1092559838 12:9600880-9600902 CCCGTAAAGGTTCTGTGCTGAGG + Intronic
1092645907 12:10571799-10571821 CCCATAAATGGTCTGTGCTGAGG - Intergenic
1093454088 12:19347551-19347573 ATGGTAAAGGGGCTGGGATGTGG + Intronic
1093650960 12:21645379-21645401 CTGGTAAAGGGTCTGTGCCGAGG + Intronic
1094091476 12:26654908-26654930 CTGGCTCAGGGTCTGTGATGGGG - Intronic
1094389351 12:29932585-29932607 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1094623222 12:32099925-32099947 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1094815635 12:34180835-34180857 CCAGTAAGGGGTCTGTGCTGAGG - Intergenic
1094874836 12:34628851-34628873 CCTGTAAATGATCTGTGCTGAGG - Intergenic
1095451006 12:42330337-42330359 CCCATGAAGGGTCTGTGCTGAGG - Intronic
1095456143 12:42388132-42388154 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1096125449 12:49116089-49116111 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1096420682 12:51454818-51454840 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1096940058 12:55333845-55333867 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1097076791 12:56400892-56400914 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1097132453 12:56822553-56822575 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1097149919 12:56969153-56969175 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1097330512 12:58327990-58328012 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1097331447 12:58336479-58336501 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1097350517 12:58543692-58543714 CCCGTAAAGGGTCTGAGCTGAGG - Intergenic
1097399164 12:59108636-59108658 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1098563465 12:71903946-71903968 CAGGTAAATGGTGTGTCATGGGG - Intronic
1098654359 12:73009259-73009281 ACCGTAAAGGGTCTGTGCTGAGG - Intergenic
1098680556 12:73348485-73348507 CCCGTAAAAGGTCTGTGCTGAGG - Intergenic
1098806294 12:75023797-75023819 CAGGTAAAAGATCTGGGATGGGG - Intergenic
1100276306 12:93074816-93074838 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1101520644 12:105479091-105479113 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1101780039 12:107826984-107827006 CCTGTAAAAGGTCTGTGCTGAGG - Intergenic
1101798241 12:107997598-107997620 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1102135460 12:110570452-110570474 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1103092372 12:118106390-118106412 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1103688427 12:122751398-122751420 CCTGTAAAGGGTCTGTGCTCAGG - Intergenic
1103794329 12:123493020-123493042 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
1103956244 12:124578405-124578427 CCGATGAAGGGTGTGCGATGTGG + Intergenic
1104238084 12:126959234-126959256 CCCGTGAAGGGTCTATGCTGAGG - Intergenic
1105055608 12:133096029-133096051 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1105349138 13:19600632-19600654 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1105688719 13:22814184-22814206 CCCATAAACGGTCTGTGCTGAGG - Intergenic
1105879531 13:24591977-24591999 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1105920306 13:24957077-24957099 CCCATAAATGGTCTGTGCTGAGG - Intergenic
1107667850 13:42711219-42711241 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1107700348 13:43041070-43041092 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
1108352435 13:49599437-49599459 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1108813892 13:54267329-54267351 CCCATAAATGGTCTGTGCTGAGG - Intergenic
1109959795 13:69615407-69615429 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1110710641 13:78647212-78647234 CCCGTGAACGGTCTGTGCTGAGG + Intronic
1112007730 13:95268433-95268455 ACCCTAAAGGGTCTGTGCTGAGG + Intronic
1112367127 13:98764767-98764789 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1113970160 13:114182471-114182493 CCGGTAAAGGGTCTGTGCTGAGG - Intergenic
1113991719 14:16032947-16032969 CCCGTTAAGGGTCTGTGCTGAGG + Intergenic
1114006561 14:18319893-18319915 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1114154459 14:20085002-20085024 CCCATGAAGGGTCTGTGCTGAGG + Intergenic
1114170604 14:20269337-20269359 CCCGTAAATGGTCTGTGCTGAGG + Intronic
1114438136 14:22725216-22725238 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1114603233 14:23973132-23973154 CCCATAAAGGGTCTGTGCTCTGG - Intronic
1114604079 14:23982053-23982075 CCCATGAAGGGTCTGTGCTGAGG - Intronic
1114607601 14:24010253-24010275 CCCATAAAGGGTCTGTGCTGCGG - Intergenic
1114608211 14:24015615-24015637 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1115000531 14:28415880-28415902 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
1115898535 14:38118514-38118536 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1116464331 14:45214135-45214157 CCCATAAAGGGTCTGTTTTGAGG + Intronic
1116481304 14:45393999-45394021 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1117335405 14:54753155-54753177 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1117365637 14:55024950-55024972 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1118099454 14:62580335-62580357 CCAGAAAAGAGTCTGTGAAGGGG - Intergenic
1118352030 14:64979119-64979141 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1119549695 14:75499562-75499584 CCGGGAAAGTTCCTGTGATGTGG - Intergenic
1119823127 14:77635808-77635830 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1119826609 14:77661929-77661951 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1119841311 14:77795205-77795227 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1120641639 14:87020553-87020575 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1120733126 14:88024755-88024777 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1121295737 14:92820543-92820565 CCTGTCAAGGGTCTGTACTGAGG - Intronic
1121506628 14:94482619-94482641 CCCATGAAGGGTCTGTGCTGAGG + Intergenic
1121527077 14:94626565-94626587 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1121673212 14:95729668-95729690 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1122232232 14:100312321-100312343 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1122689548 14:103525468-103525490 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1122997614 14:105273892-105273914 CCCGTGAAGGGTCTGTGCTGAGG + Intronic
1123052635 14:105553487-105553509 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1123052862 14:105555236-105555258 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
1123077444 14:105675624-105675646 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
1123088883 14:105732843-105732865 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1123136448 14:106031791-106031813 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1202919334 14_KI270723v1_random:16529-16551 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1202925297 14_KI270724v1_random:18465-18487 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1123390487 15:19866531-19866553 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1123723729 15:23082268-23082290 CCCATAAAGGGTCTATGCTGAGG - Intergenic
1125562303 15:40644504-40644526 CCCGTAAATGGTCTGTGCTGAGG - Intronic
1126002943 15:44229026-44229048 CTCGTAAAGGGTCTGTGCTGGGG + Intergenic
1126743211 15:51799148-51799170 ATGGGGAAGGGTCTGTGATGGGG + Intronic
1127403009 15:58610477-58610499 CCAGTACAGGGTCTGTGCAGTGG - Exonic
1127423622 15:58833861-58833883 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1128131003 15:65227073-65227095 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1128193966 15:65734068-65734090 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
1129485857 15:75871385-75871407 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1129773923 15:78221601-78221623 CCTGTAAGGGGTCTGTGCTGAGG - Intronic
1130439706 15:83940644-83940666 ACAATACAGGGTCTGTGATGTGG - Intronic
1130461678 15:84163967-84163989 CCCATAAAGGGTCTGTGTTGAGG - Intergenic
1130944519 15:88540966-88540988 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1131194808 15:90347123-90347145 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1131434317 15:92411120-92411142 CCTCTAAAGAATCTGTGATGGGG + Intronic
1131946670 15:97629664-97629686 CCCGTAAAGGGTTTGTGCTGAGG - Intergenic
1132440583 15:101860508-101860530 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1132831660 16:1931273-1931295 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1133013514 16:2928291-2928313 CCTGTGAAGGGTCTGTGCTGAGG - Intronic
1133432994 16:5754919-5754941 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1133687416 16:8179292-8179314 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1134007842 16:10830018-10830040 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1134483291 16:14636670-14636692 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1135577867 16:23599890-23599912 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1136272042 16:29154028-29154050 CTGGGAAAGGCTCTTTGATGAGG + Intergenic
1136355223 16:29740654-29740676 ACCGTAAAGGGTCTGTGCTGAGG + Intergenic
1136479724 16:30534016-30534038 CCTAGAAAGGGGCTGTGATGGGG - Intronic
1136633651 16:31505109-31505131 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
1136648099 16:31640478-31640500 CCGGCAAAGGAGCTATGATGAGG + Intergenic
1136930359 16:34412588-34412610 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1136974215 16:34999220-34999242 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1136991484 16:35153872-35153894 CCTGTAAAGGGTCTGTGCTAAGG + Intergenic
1136998103 16:35204989-35205011 CCTGTAAAAGGTCTGTGCTAAGG + Intergenic
1137042844 16:35629224-35629246 CCCATAAAGGCTCTGTGCTGAGG + Intergenic
1137075474 16:35956086-35956108 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1137366600 16:47864873-47864895 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1139394337 16:66628289-66628311 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1139439135 16:66955938-66955960 CCCATAAGGGGTCTGTGCTGAGG - Intergenic
1140418879 16:74799924-74799946 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1140436503 16:74951222-74951244 CCGGGATATGGTCTGGGATGGGG + Intronic
1140546606 16:75815826-75815848 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1141416522 16:83879747-83879769 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
1142075641 16:88116009-88116031 CTGGGAAAGGCTCTTTGATGAGG + Intronic
1143195759 17:5075210-5075232 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1143401405 17:6646791-6646813 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
1143459057 17:7088738-7088760 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1143468974 17:7159484-7159506 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1143996748 17:11013037-11013059 GAGGTAAATCGTCTGTGATGAGG + Intergenic
1144078334 17:11738718-11738740 TCAGTAAAGGGTCTGGGGTGTGG + Intronic
1144571230 17:16400547-16400569 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1144624020 17:16835418-16835440 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1144861173 17:18303376-18303398 CTCGTAAAGGGTCAGTGCTGAGG + Intronic
1144882408 17:18437298-18437320 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1145031033 17:19505485-19505507 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1145033096 17:19520119-19520141 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1145149826 17:20507088-20507110 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1145363323 17:22230082-22230104 CCCGTAAAGGGTCTATGCTGAGG + Intergenic
1146161764 17:30563725-30563747 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1146166656 17:30594997-30595019 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1146181417 17:30700572-30700594 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1146839485 17:36140467-36140489 CCCGTAAAGGGTCAGTGCTGAGG + Intergenic
1147838773 17:43355360-43355382 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1148273706 17:46284145-46284167 CCCTTAAAGGGTCTGTGCTGAGG - Intronic
1148795337 17:50194281-50194303 CCCGTGTAGGGTCTGGGATGAGG - Intronic
1149202366 17:54201988-54202010 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1149767360 17:59290467-59290489 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1150409354 17:64930436-64930458 CCCTTAAAGGGTCTGTGCTGAGG + Intergenic
1150686780 17:67327378-67327400 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1150840909 17:68604523-68604545 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1152360234 17:79829772-79829794 CAGGTAAAGGTTCTCTGGTGAGG + Intergenic
1152480897 17:80551739-80551761 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1152869575 17:82745060-82745082 CCCATAAAGGGTCTGTACTGAGG - Intronic
1152962943 18:90763-90785 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1153143453 18:2001345-2001367 CCCTTAAAGGGTCTGTGCTGAGG - Intergenic
1153422079 18:4917811-4917833 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1154530910 18:15344306-15344328 CCCATAAACGGTCTGTGCTGAGG - Intergenic
1155472111 18:26202365-26202387 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1155547167 18:26927803-26927825 CCCATAAATGGTCTGTGCTGAGG - Intronic
1155942230 18:31810916-31810938 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1156806117 18:41184283-41184305 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1157250194 18:46088727-46088749 CTCGTAAAGGGTCTGTGCTGAGG + Intronic
1157777169 18:50404740-50404762 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1159091359 18:63852748-63852770 CCCGTAAAGGGTCTGTACTGAGG + Intergenic
1159336717 18:67077315-67077337 CCTGTAAAGGGTCTGTGCCGAGG - Intergenic
1159349949 18:67259477-67259499 ACTGTAAAGGGTCTGAGATTTGG + Intergenic
1159413008 18:68105774-68105796 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1159477547 18:68942800-68942822 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
1159484920 18:69043383-69043405 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1159606465 18:70479566-70479588 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1160675187 19:387086-387108 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1161629944 19:5348861-5348883 CAGGGAAAGGGTCTTTTATGGGG - Intergenic
1162096855 19:8315263-8315285 CCGGTAAAGGGTCTGTGATGAGG + Intronic
1162278560 19:9677327-9677349 CCCATGAAGGGTCTGTGCTGAGG - Intergenic
1162291528 19:9784600-9784622 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1162292381 19:9789890-9789912 CCCCTAAAGGGTCTGTGCTGAGG - Intronic
1162626696 19:11890171-11890193 CCCCTAAAGGGTCTGTGCTGAGG - Intronic
1162668125 19:12232354-12232376 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1163203243 19:15783162-15783184 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1163289166 19:16367614-16367636 CCGGGATCGGGGCTGTGATGGGG + Intronic
1163628197 19:18402883-18402905 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
1163678909 19:18669454-18669476 CCGGCAAAGCGTCTGACATGTGG + Exonic
1163884774 19:19955919-19955941 CCAGTAAAGGGTCTGTGCTGAGG + Intergenic
1163885594 19:19962007-19962029 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1163898828 19:20082753-20082775 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1163907049 19:20156863-20156885 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1163919711 19:20277000-20277022 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1163920725 19:20286166-20286188 CCCATAAAGGGTCTGTGCCGAGG + Intergenic
1163937907 19:20466741-20466763 CCCATAAAGGGTCTGTGCTGGGG + Intergenic
1163986898 19:20961973-20961995 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1164049039 19:21568358-21568380 CCCATGAAGGGTCTGTGCTGAGG + Intergenic
1164055740 19:21620773-21620795 CCCGTAAAGAGTCTGTGCTGAGG - Intergenic
1164122854 19:22283950-22283972 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1164154367 19:22581206-22581228 CCCGTAAAGGGTCTGTGATGAGG + Intergenic
1164208626 19:23078154-23078176 TGGGTAAAGGGTCTGTCCTGAGG + Intronic
1164229915 19:23278106-23278128 CCTGTAAACGGTCTGTGCTTAGG - Intergenic
1164276600 19:23724172-23724194 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1164370345 19:27638121-27638143 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1164390432 19:27815009-27815031 CCCGTAAAGTGTCTGTGCTGAGG + Intergenic
1164424721 19:28131044-28131066 CCCGTAAATGGTCTGTGCTGAGG + Intergenic
1164457536 19:28421151-28421173 TCGCTACAGGGGCTGTGATGTGG + Intergenic
1164489011 19:28689843-28689865 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1165295131 19:34920593-34920615 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1165328803 19:35129769-35129791 CCTGTAAAGGATCTGTGCTGAGG + Intronic
1165506438 19:36233895-36233917 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1165508075 19:36247496-36247518 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1165523522 19:36332697-36332719 CCCGAAAAGGGTCTGTGCTGAGG - Intergenic
1165574166 19:36799969-36799991 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1165595107 19:37006573-37006595 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1165606237 19:37107151-37107173 CCCGAAAAGGGTCTGTGCTGAGG - Intronic
1165607175 19:37115728-37115750 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1165621613 19:37252921-37252943 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1165633484 19:37321201-37321223 CCTGTAAAGGGTCCGTGGTGAGG + Intronic
1165634820 19:37331819-37331841 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1165652330 19:37502280-37502302 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1165655698 19:37530334-37530356 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1165666199 19:37630476-37630498 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1165691417 19:37866591-37866613 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1165814233 19:38631664-38631686 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1165952055 19:39479899-39479921 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1165977421 19:39688916-39688938 CCTGTAAATGGTCTGTGCTGAGG - Intergenic
1166013263 19:39959760-39959782 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1166144185 19:40823027-40823049 CCAGTAAATGGCCTGTGCTGAGG + Intronic
1166157209 19:40922757-40922779 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1166172186 19:41036606-41036628 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1166248045 19:41545023-41545045 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1166596367 19:44053659-44053681 CCCATAAGGGGTCTGTGCTGAGG - Intronic
1166619270 19:44281127-44281149 CCCATACAGGGTCTGTGCTGAGG - Intronic
1166653655 19:44594510-44594532 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1166659834 19:44639470-44639492 CCCATAAAAGGTCTGTGCTGAGG + Intergenic
1167004835 19:46768792-46768814 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
1167336588 19:48890050-48890072 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167336908 19:48892153-48892175 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1167344064 19:48934384-48934406 CCAGTAAAGGGTCTGTGCTGAGG + Intronic
1167576509 19:50320404-50320426 CAGGTGAAGGGTCAGTGGTGAGG + Intronic
1167814641 19:51869124-51869146 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1167818614 19:51906107-51906129 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167818953 19:51908721-51908743 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1167819054 19:51909409-51909431 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167820283 19:51921566-51921588 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1167824307 19:51958199-51958221 CCCATAAAGGGTCTGGGCTGAGG + Intergenic
1167827047 19:51983372-51983394 CTCGTAAAGGGTCTGTGCTGAGG + Intronic
1167831305 19:52024907-52024929 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167831500 19:52026624-52026646 CCTGTAAAGGGTCTCTGCTGAGG + Intronic
1167833132 19:52043547-52043569 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167834069 19:52052137-52052159 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1167867379 19:52339296-52339318 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1167876910 19:52421488-52421510 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1167883821 19:52484381-52484403 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1167884061 19:52485951-52485973 CCCATAAATGGTCTGTGCTGTGG + Intronic
1167888224 19:52519328-52519350 CCTGTAAAGGGCCTGTGCTGAGG + Intergenic
1167888331 19:52520148-52520170 CCAGTAAACGGTCTGTGCTGAGG - Intergenic
1167893205 19:52559109-52559131 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1167910510 19:52698270-52698292 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1167913744 19:52724110-52724132 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1167916125 19:52741457-52741479 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1167916230 19:52742271-52742293 CCAGTGAAGGGTCTGTGCTGAGG - Intergenic
1167928894 19:52847464-52847486 CCTGTAAAGAGCCTGTGCTGAGG + Intronic
1167939308 19:52933488-52933510 CCCATAAGGGGTCTGTGCTGAGG - Intronic
1167939666 19:52936477-52936499 CCTGTAAACGGTCTGTGCTGAGG + Intronic
1167951102 19:53028441-53028463 CCCGTAAAGGGTATGTGCTGAGG - Intergenic
1167991388 19:53364215-53364237 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
1167997845 19:53420937-53420959 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1168000757 19:53444190-53444212 CCCGTAAAGAGTCTGTGCTGAGG + Intronic
1168002506 19:53460479-53460501 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1168003734 19:53468889-53468911 CCCGTAAAGAGTCTGTGCTGAGG - Intronic
1168006975 19:53498054-53498076 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1168052371 19:53839040-53839062 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1168219569 19:54950813-54950835 CCAGTAAAGGGTCTGTGCTGAGG - Intronic
1168235440 19:55060117-55060139 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1168358527 19:55718308-55718330 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1168461168 19:56559855-56559877 CCGGTAAAGGGTCTGTGCTGAGG - Intergenic
1168477398 19:56686566-56686588 CCCTTAAAGGGTCTGTGCTGAGG - Intergenic
1168612250 19:57810712-57810734 CCAGTAAAGGGGCTGTGCTGAGG + Intronic
1168614121 19:57824041-57824063 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
1168614849 19:57829369-57829391 CCCTTAAAGGGTCTGTGCTGAGG + Intronic
1168638504 19:58014666-58014688 CCTGTAAAGGGTCTATGCTGAGG - Intergenic
1168670972 19:58240825-58240847 CCTGTAATGTGTGTGTGATGTGG + Intronic
924967859 2:94477-94499 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
925037647 2:703111-703133 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
925142685 2:1560826-1560848 CCCGTGAGGGGTCTGTGCTGAGG - Intergenic
925336847 2:3105016-3105038 CTCGTAAAGGGTCTGTGCTGAGG - Intergenic
927188811 2:20501731-20501753 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
927891143 2:26750276-26750298 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
927992848 2:27460393-27460415 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
928355857 2:30614003-30614025 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
928540011 2:32276113-32276135 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
928990248 2:37225732-37225754 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
929041730 2:37751004-37751026 TCCGTGAAGGGTCTGTGTTGAGG + Intergenic
929097531 2:38278206-38278228 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
929208114 2:39321575-39321597 CCCATAAAGGGTCTGTAATGAGG + Intronic
930786847 2:55279687-55279709 CCAATAAAGGGTCTGTGCTGAGG + Intergenic
932600322 2:73119741-73119763 CCCGTAAAGGGTCTCTGCTGAGG - Intronic
932798694 2:74720394-74720416 CCCGTAAAGGGTCTGTGTTGAGG + Intergenic
933838062 2:86261714-86261736 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
934123859 2:88867059-88867081 CCCGTGAAGGGTCTGCGCTGAGG - Intergenic
934489009 2:94745193-94745215 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
934542985 2:95191785-95191807 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
934554680 2:95281115-95281137 CCTCTAAAGGCTCTGTGCTGGGG + Intronic
934592261 2:95565554-95565576 CAGGTAAAGTGTGTGTCATGGGG - Intergenic
934897352 2:98130399-98130421 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
935180458 2:100685281-100685303 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
935656169 2:105425472-105425494 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
936107479 2:109637398-109637420 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
936157278 2:110056486-110056508 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
936187416 2:110314958-110314980 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
936378507 2:111963373-111963395 CCCGTAAAGGATCTGTGCTGAGG - Intronic
936487016 2:112934669-112934691 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
937970156 2:127543107-127543129 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
938235381 2:129701795-129701817 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
938270100 2:129962496-129962518 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
938487012 2:131721639-131721661 CCCGTGTAGGGTCTGTGCTGAGG + Intergenic
938530000 2:132175579-132175601 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
939476661 2:142695640-142695662 CCCATAAAGGGTCTGGGCTGAGG - Intergenic
940358327 2:152769639-152769661 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
940756015 2:157684276-157684298 TCGGTAAAGGGTGTTTGATTAGG - Intergenic
941552550 2:166935221-166935243 CAGGGAACAGGTCTGTGATGTGG + Intronic
941842758 2:170105410-170105432 CCGGCCAAGGGTCTCTCATGAGG - Intergenic
941859459 2:170263840-170263862 CCGGTAAAGGGTCTGTGCTGAGG - Intronic
943327734 2:186521936-186521958 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
943838212 2:192542472-192542494 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
943880936 2:193142836-193142858 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
943977674 2:194504843-194504865 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
944581997 2:201139416-201139438 CCCATAAAGGGTCTGTGCTGAGG + Intronic
945175223 2:207037240-207037262 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
945299178 2:208199972-208199994 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
945305786 2:208257307-208257329 CCCGTGAAGGGTCTGTGCTGAGG - Intronic
945832400 2:214803299-214803321 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
946234093 2:218311790-218311812 CCCATAAAGGGTCTGTGCTGAGG - Intronic
946550881 2:220800923-220800945 CCCGTAAAGTTTCTGAGATGGGG + Intergenic
946640895 2:221782557-221782579 CTGGGAAGGGGTGTGTGATGTGG - Intergenic
946780687 2:223190892-223190914 CCCATAAAGGGTCTGTGCTGAGG + Intronic
947273403 2:228364173-228364195 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
947520735 2:230844168-230844190 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
947619094 2:231577190-231577212 CCCGGGAAGGGTCTGTGCTGAGG + Intergenic
947730110 2:232423420-232423442 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
947953542 2:234168596-234168618 CCTGTAAAGGGTCTGTACTGAGG - Intergenic
948480780 2:238249008-238249030 CCCTAAAAGGCTCTGTGATGGGG - Intronic
948843470 2:240671790-240671812 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
949052606 2:241905209-241905231 CCGGGGAAGGGACTGTGACGAGG - Intergenic
1168825730 20:812385-812407 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1169247417 20:4034520-4034542 CCCGTAAAAGGTCTGTGCTGAGG - Intergenic
1169470986 20:5885419-5885441 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
1169658870 20:7956614-7956636 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1170397847 20:15947226-15947248 CCTGTGAAGGGTCTGTGCTGAGG - Intronic
1170569618 20:17625435-17625457 CCGGGAAAGGTTCTGCTATGTGG - Intronic
1171256807 20:23694889-23694911 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1171264157 20:23756810-23756832 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1171272857 20:23829882-23829904 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1171276573 20:23861129-23861151 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1171291033 20:23983057-23983079 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1171450745 20:25234369-25234391 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1171451900 20:25241663-25241685 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1171495321 20:25550893-25550915 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
1171770147 20:29316715-29316737 CCCGTTAAGGGTCTGTGCTGAGG - Intergenic
1171812856 20:29759510-29759532 CCCGTTAAGGGTCTGTGCTGAGG - Intergenic
1171817911 20:29804837-29804859 CCTGTAAATGGTCTGTGCTGAGG + Intergenic
1171824718 20:29884546-29884568 CCGATAAAGGGTCTGTGCTGGGG - Intergenic
1171900323 20:30850443-30850465 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1172337317 20:34127952-34127974 CCCGTAAAGGGTCTGTGCTAAGG + Intergenic
1172338447 20:34136005-34136027 CCCGTAAAGGGTCTGTGCTAAGG + Intergenic
1172352304 20:34252677-34252699 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1172374399 20:34425414-34425436 CCTGTGAAGGGTCTGTGCTGAGG + Intronic
1172479494 20:35262655-35262677 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1172716509 20:36968249-36968271 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1173319076 20:41971310-41971332 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1173428236 20:42961536-42961558 TCTGTGAAGCGTCTGTGATGTGG - Intronic
1175057605 20:56212344-56212366 CCCGTAAAGTGTCTCTGCTGAGG - Intergenic
1175573470 20:60041712-60041734 CCTGTGAAGGGTCTGTGCTGAGG - Intergenic
1176163412 20:63660243-63660265 CCCGTGAAGGGTCTGTGCTGAGG - Intronic
1176424426 21:6539346-6539368 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1176766501 21:13024156-13024178 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1176838771 21:13820295-13820317 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1176888149 21:14281475-14281497 CCAGTAAAGGGTCTGCGCTGAGG - Intergenic
1176938354 21:14893585-14893607 CTGGGGAAGGGACTGTGATGAGG - Intergenic
1177175145 21:17694747-17694769 CCCGTAAATGGTCTGTGCTGAGG - Intergenic
1177199069 21:17933251-17933273 CCCATAAATGGTCTGTGCTGAGG - Intronic
1177249103 21:18569208-18569230 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1177290395 21:19103754-19103776 TCTGTGAAGGGTCTGTGCTGAGG + Intergenic
1178483019 21:32996705-32996727 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1179061635 21:37984681-37984703 CCTGTAAAGAGGGTGTGATGAGG + Intronic
1179123768 21:38573298-38573320 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1179444443 21:41421400-41421422 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1179699919 21:43147661-43147683 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1179878457 21:44283385-44283407 ACCGTAAAGGGTCTGTGCTGAGG - Intergenic
1180315551 22:11274580-11274602 CCCGTTAAGGGTCTGTGCTGAGG - Intergenic
1180321357 22:11324319-11324341 CCTGTAAATGGTCTGCGCTGAGG + Intergenic
1180333029 22:11550077-11550099 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1180333689 22:11556434-11556456 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1180431070 22:15250704-15250726 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1180513627 22:16118604-16118626 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1180606033 22:17059578-17059600 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1180766380 22:18348030-18348052 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1180779935 22:18514348-18514370 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1180812649 22:18771669-18771691 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1180837743 22:18939088-18939110 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1181184582 22:21093749-21093771 TCCATAAAGGGTCTGTGCTGAGG + Intergenic
1181198808 22:21205917-21205939 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1181400932 22:22649882-22649904 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1181534892 22:23536476-23536498 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1181535168 22:23538153-23538175 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1181594846 22:23907498-23907520 CCCGTAAAGGGTCCGTGCTGAGG + Intergenic
1181601875 22:23957707-23957729 CCCCTGAAGGGTCTGGGATGGGG - Exonic
1181606634 22:23983600-23983622 CCCCTGAAGGGTCTGGGATGGGG + Exonic
1181642601 22:24211420-24211442 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1181702910 22:24630974-24630996 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1183627249 22:39012068-39012090 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1183713869 22:39522240-39522262 CTGGTAGAGGGGCTGTGCTGAGG - Exonic
1183998547 22:41654822-41654844 CAGGTAAAGGGTCTTTGCTGGGG + Intronic
1203227997 22_KI270731v1_random:88920-88942 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1203287834 22_KI270734v1_random:164387-164409 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
949547158 3:5082127-5082149 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
949804689 3:7942119-7942141 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
950030380 3:9848213-9848235 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
950031085 3:9854160-9854182 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
950387932 3:12674531-12674553 CCTTTAAAGGGTCTGTGCTGAGG + Intergenic
950607104 3:14091716-14091738 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
950629553 3:14273258-14273280 CCCTTAAAGGGTCTGTGCTGAGG + Intergenic
950753045 3:15146083-15146105 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
951514641 3:23545194-23545216 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
951886700 3:27531686-27531708 CCTGTGAAGGGTCTGTGCTGAGG + Intergenic
952685364 3:36141640-36141662 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
952905133 3:38134893-38134915 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
952905246 3:38135797-38135819 CCCGTAAAGGGTCGGTGCTGAGG - Intronic
952905255 3:38135855-38135877 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
953059933 3:39418830-39418852 CCCGTAAATGGTCTGTGCTGAGG - Intergenic
953428007 3:42811605-42811627 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
953481869 3:43258835-43258857 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
953709126 3:45255130-45255152 CCGGCACAGGGTCTGTCATGAGG - Intergenic
953767785 3:45757288-45757310 CCTGTAAAGGGTCGGTGCTGAGG - Exonic
953960096 3:47259948-47259970 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
954267637 3:49482321-49482343 CCTGTAAAGGGTCTATGCTGAGG + Intronic
954378383 3:50206442-50206464 TCTGTAAAAGGTCTGGGATGGGG + Intronic
954440679 3:50520296-50520318 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
954896287 3:53978045-53978067 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
955257121 3:57343629-57343651 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
957045947 3:75374726-75374748 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
957048344 3:75393605-75393627 CCCATAAAAGGTCTGTGCTGAGG + Intergenic
957067559 3:75538165-75538187 ACCATAAAGGGTCTGTGCTGAGG + Intergenic
957069897 3:75559414-75559436 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
957074769 3:75593233-75593255 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
957082178 3:75645743-75645765 CCCATAAAGGGTATGTGCTGAGG + Intergenic
958765569 3:98363118-98363140 CCCGTAAAGTGTCTGCGCTGAGG - Intergenic
958937538 3:100273024-100273046 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
958943246 3:100336857-100336879 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
958975763 3:100666671-100666693 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
959069883 3:101692308-101692330 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
959070789 3:101700462-101700484 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
959071291 3:101704364-101704386 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
959791500 3:110367468-110367490 CGCATAAAGGGTCTGTGCTGAGG + Intergenic
959948564 3:112152561-112152583 CCAATACAGGGTCTGTGCTGAGG - Intronic
959985269 3:112564610-112564632 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
960027423 3:113024808-113024830 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
960028336 3:113033007-113033029 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
960510181 3:118540401-118540423 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
960809124 3:121611666-121611688 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
961276435 3:125730884-125730906 CCAGTAAAGGGTCTGTGCTGAGG + Intergenic
961279334 3:125753477-125753499 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
961296756 3:125890865-125890887 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
961297574 3:125899199-125899221 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
961512584 3:127412193-127412215 CCCTTAAAGGGTCTGTGCTGAGG - Intergenic
961875066 3:130016134-130016156 CCAGTAAAGGGTCTGTACTGAGG - Intergenic
961878003 3:130038849-130038871 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
961890135 3:130123898-130123920 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
962128638 3:132649210-132649232 CCCGTAGGGGGTCTGTGCTGAGG + Intronic
962334662 3:134516464-134516486 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
963216311 3:142752607-142752629 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
963468185 3:145709781-145709803 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
963535456 3:146522675-146522697 CCCGTAAAGGGTCTGCACTGAGG + Intronic
966073347 3:175906081-175906103 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
966733578 3:183170423-183170445 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
966771896 3:183511484-183511506 CCCGTGAAGGGTCTGTGCTGAGG - Intronic
967025855 3:185563079-185563101 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
967026764 3:185571291-185571313 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
967176538 3:186866024-186866046 CCCGTAAAAGGTCTGTGCTGAGG - Intergenic
967179092 3:186887405-186887427 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
967179744 3:186893634-186893656 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
967418895 3:189251902-189251924 CCCATAAAGGGTCTGTGCTGAGG - Intronic
967720133 3:192807491-192807513 TGGGCAAAGGGTCAGTGATGGGG - Intronic
968061388 3:195728661-195728683 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
968095602 3:195928056-195928078 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
968224144 3:196962461-196962483 CCCATAAAAGGTCTGTGCTGAGG + Intronic
968373725 4:19447-19469 CCCATAAAGAGTCTGTGCTGAGG + Intergenic
968375879 4:41069-41091 CCCATAAATGGTCTGTGCTGAGG - Intergenic
968387232 4:152273-152295 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
968393021 4:208329-208351 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
968396281 4:241613-241635 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
968695234 4:2021767-2021789 CCAGTAAAGGGTCTGTGCTGAGG + Intronic
968987417 4:3883911-3883933 CCCGTAAATGTTCTGTGCTGAGG - Intergenic
968992809 4:3926055-3926077 CCCGTAAAGGGTCTGTGCTGGGG + Intergenic
969000606 4:3977886-3977908 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
969001530 4:3986463-3986485 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
969012134 4:4074735-4074757 CCTGTAAAAGGTCTGTGCTGAGG + Intergenic
969018375 4:4120871-4120893 CCAGTAAAGGGTCTGTGCTGAGG - Intergenic
969023059 4:4151072-4151094 CCAGTAAAGGGTCTGTGCTGAGG - Intergenic
969292505 4:6249112-6249134 AATTTAAAGGGTCTGTGATGAGG - Intergenic
969741949 4:9034974-9034996 CCCATAAAAGGTCTGTGCTGAGG - Intergenic
969752490 4:9122228-9122250 CCTGTAAAAGGTCTGTGCTGAGG + Intergenic
969753410 4:9130787-9130809 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
969760435 4:9177361-9177383 CCCGTAAAGAGTCTGCGCTGCGG - Intergenic
969786918 4:9465640-9465662 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
969794828 4:9519302-9519324 CCAGTAAAGGGTCTGTGCTGAGG + Intergenic
969801323 4:9567874-9567896 CCCGTAAAAGGTCTGTGCTGAGG - Intergenic
969812387 4:9658397-9658419 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
969813312 4:9666969-9666991 ACCTTAAAGGGTCTGTGCTGAGG + Intergenic
969822665 4:9732306-9732328 CCCATAAAGGGTCTGTGCTGGGG - Intergenic
969825099 4:9751483-9751505 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
969874755 4:10127886-10127908 CCTATAAAGGGTCTGTGCTGAGG - Intergenic
970418090 4:15878972-15878994 CCCGTAAAGGGTCTGTGCTAAGG + Intergenic
970440449 4:16077079-16077101 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
971026940 4:22598321-22598343 CCCATAAAAGGTCTGTGCTGAGG - Intergenic
971720055 4:30233446-30233468 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
972846924 4:43002194-43002216 CCCATAAAGGGTCTGTGCTGAGG - Intronic
973273572 4:48285894-48285916 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
973343439 4:49029517-49029539 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
974517969 4:62941292-62941314 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
974766930 4:66359289-66359311 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
974924631 4:68281989-68282011 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
974945901 4:68528684-68528706 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
974952371 4:68598444-68598466 CCCGTGAAGGGTCTGTGCTGAGG + Intronic
974952815 4:68602921-68602943 CCCATGAAGGGTCTGTGCTGAGG + Intronic
974960522 4:68693882-68693904 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
975106138 4:70571340-70571362 AGGATGAAGGGTCTGTGATGTGG + Intergenic
975246826 4:72129755-72129777 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
976680175 4:87746868-87746890 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
978048933 4:104171412-104171434 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
978342049 4:107729262-107729284 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
978619384 4:110623176-110623198 CCGGAGAAGGGTCTGGGAGGAGG - Intronic
979128007 4:117001311-117001333 CCGGAAGAGAGTCTGTCATGAGG - Intergenic
979141663 4:117183527-117183549 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
979322724 4:119343065-119343087 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
979327485 4:119396779-119396801 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
979497212 4:121396970-121396992 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
979501594 4:121446580-121446602 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
979996708 4:127440033-127440055 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
980530493 4:134046548-134046570 CCCGTAAGGGGTCTGTGCTGAGG - Intergenic
980638269 4:135538448-135538470 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
982512840 4:156305293-156305315 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
982518783 4:156386915-156386937 CCCGTAAAGGGTCTGCGCTGAGG - Intergenic
982823775 4:159977018-159977040 CCCTTAAAGGGTCTGTGCAGAGG - Intergenic
982876604 4:160659200-160659222 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
983001384 4:162418887-162418909 CCCGTGAAGGGTCTGTGCTGCGG + Intergenic
983205447 4:164906045-164906067 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
983212764 4:164975800-164975822 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
983214509 4:164990796-164990818 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
983215187 4:164996100-164996122 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
983215906 4:165002364-165002386 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
983224530 4:165073545-165073567 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
983313259 4:166093625-166093647 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
983977426 4:173952572-173952594 CAGGTATAGGGACTGTGATTAGG - Intergenic
984011770 4:174380440-174380462 GCAGTAAAGGGTCTGTGCTGAGG + Intergenic
984012132 4:174383444-174383466 CCAGTAAAGGGTCTGTGCTGAGG + Intergenic
984423420 4:179553707-179553729 CCCCTAAAGGGTCTGTGCTGAGG - Intergenic
984802359 4:183726821-183726843 CCTGAAAAGGGTCTGTGCTGAGG - Intergenic
985057812 4:186050464-186050486 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
985461009 4:190106820-190106842 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
985461660 4:190113104-190113126 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
985738072 5:1596508-1596530 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
986130496 5:4925343-4925365 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
986549633 5:8938155-8938177 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
987490865 5:18578869-18578891 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
987936052 5:24466183-24466205 ACCGTAAAGGATCTGTGCTGAGG + Intergenic
988063006 5:26197849-26197871 CCTGTAAAGGGTCTGTGCCGAGG + Intergenic
988379978 5:30487184-30487206 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
988380900 5:30495680-30495702 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
988850612 5:35176800-35176822 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
989085514 5:37672307-37672329 CCCGTGAAGCGTCTGTGCTGAGG + Intronic
989296119 5:39828603-39828625 CCCGTAAAGGGTCTGTGTTGAGG - Intergenic
989583816 5:43058552-43058574 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
989586444 5:43077571-43077593 CCCATAAAGGGTCCGTGCTGAGG - Intronic
989640764 5:43580835-43580857 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
989737911 5:44731018-44731040 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
989836519 5:46000570-46000592 CCCATAAAGGCTCTGTGCTGAGG - Intergenic
989837399 5:46009466-46009488 CCCATAAAGGCTCTGTGCTGAGG - Intergenic
990058668 5:51618911-51618933 CCGGAAAGGGCTCTCTGATGAGG + Intergenic
990414299 5:55571486-55571508 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
990475392 5:56157412-56157434 CATGTAAAGGGTCTGTGCTGAGG + Intronic
990619755 5:57547082-57547104 CCTGTAAAGGATCTGTGCTGAGG + Intergenic
990639746 5:57769359-57769381 CAGGCAAAGTGTCTGTGATCAGG + Intergenic
990789757 5:59464201-59464223 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
992320198 5:75606364-75606386 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
992459326 5:76945365-76945387 CCCATGAAGGGTCTGTGCTGAGG + Intergenic
992655959 5:78909781-78909803 CCCGTGAAGGGTCTGTGCTGAGG + Intronic
992779107 5:80112129-80112151 CCCGTGAAGGGTCTGTGCTGAGG + Intronic
993889555 5:93457141-93457163 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
994091247 5:95811426-95811448 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
994404603 5:99328838-99328860 CGCGTAAAGGGTCTGTGCTGAGG + Intergenic
994503213 5:100606468-100606490 CCCATAAAGGGTCTCTGCTGAGG + Intergenic
994531987 5:100983565-100983587 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
994936507 5:106259700-106259722 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
995740071 5:115346991-115347013 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
995750478 5:115448799-115448821 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
995878863 5:116821545-116821567 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
996163405 5:120195215-120195237 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
998533266 5:142904643-142904665 TGGGGAAAGGCTCTGTGATGGGG + Intronic
999216917 5:149943025-149943047 CCCGTAAAGGGTCTATGCTGAGG - Intronic
999295070 5:150454286-150454308 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
999361636 5:150991037-150991059 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
999419240 5:151426701-151426723 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
999454713 5:151705604-151705626 CTGGGAAAAGGTATGTGATGGGG + Intergenic
999752180 5:154636516-154636538 CCCGTAAAAGGTCTGTGCTGAGG - Intergenic
999753030 5:154644210-154644232 CCTGTAAAAAGTCTGTGCTGAGG - Intergenic
999951698 5:156658237-156658259 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
999952601 5:156666449-156666471 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
999989276 5:157034550-157034572 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1000527023 5:162370547-162370569 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1001232098 5:169997406-169997428 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1002377471 5:178798491-178798513 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1002482792 5:179514494-179514516 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1002666252 5:180827680-180827702 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1002722021 5:181267391-181267413 CCCGTAAAGAGTCTGTGTCGAGG - Intergenic
1002802491 6:538520-538542 GCGCTAAAGGGTCACTGATGGGG + Intronic
1002937502 6:1686115-1686137 CCAGCAAAGGGTCTGTAATGAGG - Intronic
1003066601 6:2909078-2909100 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1003068653 6:2926277-2926299 CCGGTAAAGGGTCTGTGCTGAGG - Intergenic
1003893461 6:10584488-10584510 TCCGTAAAGGGTCTGTGCTGAGG - Intronic
1004716966 6:18227154-18227176 CCCTTAAAGGGTCTGTGCTGAGG + Intronic
1005293391 6:24400583-24400605 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1005321719 6:24662232-24662254 CCCAAAAAGGGTCTGTGTTGAGG + Intronic
1005430248 6:25749046-25749068 CCTGTGAAGGGTCTGTGCTGAGG - Intergenic
1005453804 6:25999644-25999666 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1005525318 6:26641905-26641927 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1005534864 6:26745088-26745110 GCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1005618398 6:27597284-27597306 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1005638738 6:27774991-27775013 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1005644204 6:27826187-27826209 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1005729444 6:28682791-28682813 CCCACAAAGGGTCTGTGCTGAGG + Intergenic
1005730010 6:28687779-28687801 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1005748730 6:28864017-28864039 CCAGAGAAAGGTCTGTGATGGGG + Intergenic
1006238551 6:32657657-32657679 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1006250397 6:32778598-32778620 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1006289325 6:33122489-33122511 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1006399772 6:33810491-33810513 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1006538450 6:34719991-34720013 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1007571462 6:42894233-42894255 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
1007572484 6:42903193-42903215 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
1007624898 6:43240057-43240079 CTCGTAAAGGGTCTGTGCTGAGG - Intergenic
1007793521 6:44328573-44328595 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1008563896 6:52748838-52748860 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1008565308 6:52762244-52762266 CCCATAAACGGTCTGTGCTGAGG + Intronic
1008578462 6:52883679-52883701 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1008582994 6:52923086-52923108 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1008585857 6:52948260-52948282 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1009193318 6:60655428-60655450 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1009193732 6:60660399-60660421 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1009540178 6:64944636-64944658 CCCTTAAAGGGTCTGTGCTGAGG + Intronic
1010260090 6:73805555-73805577 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1010569034 6:77455764-77455786 TCAGTAACTGGTCTGTGATGGGG - Intergenic
1010591451 6:77717476-77717498 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1010592389 6:77725938-77725960 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1010686423 6:78859202-78859224 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1010839741 6:80635086-80635108 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1010850654 6:80772373-80772395 CCAATATAGGGTCTGAGATGAGG + Intergenic
1011536562 6:88382002-88382024 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1011693493 6:89891234-89891256 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1011967180 6:93173777-93173799 CCCGTAAGGGGTCTGTGCTGAGG + Intergenic
1012120588 6:95361762-95361784 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1012136284 6:95561152-95561174 CCTGTAAAGTGTCTGTGCTGAGG - Intergenic
1012458150 6:99429785-99429807 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1013555779 6:111255629-111255651 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1014396652 6:120931868-120931890 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1014800822 6:125776380-125776402 CCGGTAAAGGGTCTGTGCTGAGG - Intergenic
1015285233 6:131479073-131479095 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1015394770 6:132721337-132721359 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
1015574774 6:134659641-134659663 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1015878142 6:137844884-137844906 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1016177320 6:141096771-141096793 CCCATAAAGGGTCTGTGCTCAGG - Intergenic
1017102579 6:150861878-150861900 CCCATGAAGGGTCTGTGCTGAGG + Intergenic
1017171105 6:151455741-151455763 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1017785390 6:157752744-157752766 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1018024667 6:159795262-159795284 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1018060100 6:160083474-160083496 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1018597673 6:165500666-165500688 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1019071234 6:169346816-169346838 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1019574912 7:1732857-1732879 CGGGGAAAGGCTGTGTGATGAGG + Intronic
1019687527 7:2389936-2389958 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1019976125 7:4582957-4582979 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1019977059 7:4591461-4591483 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1019977995 7:4599964-4599986 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1020310112 7:6860796-6860818 CCAGTAAAGGGTCTGTGCTGAGG - Intergenic
1020313054 7:6883936-6883958 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1020315458 7:6902410-6902432 CCTGTAAAGCGTCTGTGCTGAGG + Intergenic
1020329371 7:7002304-7002326 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1021067791 7:16198136-16198158 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1021671599 7:23040270-23040292 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1021747543 7:23757742-23757764 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1022164299 7:27742184-27742206 TCCGTAAAGGGTCTGTGCTGAGG - Intronic
1022477178 7:30719140-30719162 CCTGTAAAGGGTCTGTGCTGAGG - Intronic
1022677574 7:32514158-32514180 CCTGTAAAGGGTCAGTGCTGAGG - Intronic
1023248339 7:38231404-38231426 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1024313267 7:47990087-47990109 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1024932215 7:54675741-54675763 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1025075958 7:55943438-55943460 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1025574549 7:62619643-62619665 CCCATAAAGGGTCTGTGCAGAGG + Intergenic
1025853641 7:65260679-65260701 CCCGTAAAAGGTCTGTGCTGAGG - Intergenic
1025966630 7:66278982-66279004 CCGGTAAATTGTCTGTCACGGGG + Intronic
1026008645 7:66619489-66619511 CCCATAAAGGGTCGGTGCTGAGG - Intergenic
1026188647 7:68104313-68104335 CCCGTAAAGGGTCTGTACTGAGG - Intergenic
1026736411 7:72951617-72951639 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1026855379 7:73750248-73750270 CCAAAAAAGGGTCTGTGCTGAGG - Intergenic
1027107322 7:75413445-75413467 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1029076862 7:97941579-97941601 CCAGTAAAGGGTCTGTGCTGAGG - Intergenic
1029280461 7:99432182-99432204 CCCATAAAGGGTCTGTGCTGAGG + Intronic
1029534756 7:101150384-101150406 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1029790571 7:102838926-102838948 CCCGTGAAGGGTCTGTGCTGAGG + Intronic
1029966727 7:104748335-104748357 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1030760295 7:113342048-113342070 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1031230608 7:119100773-119100795 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1031606994 7:123781051-123781073 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1031724588 7:125221701-125221723 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1031779113 7:125940118-125940140 CCCATAAAAGGTCTGTGATGAGG + Intergenic
1031795434 7:126168574-126168596 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1033212137 7:139467820-139467842 CCAGTAAAGGGTCTGTGCTGAGG + Intronic
1033349867 7:140553508-140553530 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1033481972 7:141751548-141751570 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
1033715411 7:143996676-143996698 CCCATGAAGGGTCTGTGCTGAGG - Intergenic
1034428435 7:151027440-151027462 CCCATAAAGGGTCTGTACTGAGG + Intergenic
1035349668 7:158237205-158237227 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1035406901 7:158604535-158604557 CCCGCAAAGGGTCTGTGTTTCGG + Intergenic
1035518027 8:253199-253221 CCTGTAAAGCGTCTGTGCTGAGG + Intergenic
1036247140 8:7127541-7127563 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1036253651 8:7186821-7186843 CCCATAAAGTGTCTGTGCTGAGG + Intergenic
1036261135 8:7241216-7241238 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1036262763 8:7253471-7253493 CCCGTAAAGGGTCTGTGCCGAGG - Intergenic
1036264068 8:7261103-7261125 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036265364 8:7268725-7268747 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036266665 8:7276347-7276369 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036267971 8:7283969-7283991 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036269275 8:7291591-7291613 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036270549 8:7299201-7299223 CCGGTAAAGCGTCTGTGCTGAGG - Intergenic
1036291673 8:7498406-7498428 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1036292605 8:7506909-7506931 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1036297318 8:7547833-7547855 CCCGCAATGGGTCTGTGCTGAGG + Intergenic
1036298621 8:7555488-7555510 CCCGCAATGGGTCTGTGCTGAGG + Intergenic
1036299926 8:7563138-7563160 CCCGCAATGGGTCTGTGCTGAGG + Intergenic
1036301231 8:7570784-7570806 CCCGCAATGGGTCTGTGCTGAGG + Intergenic
1036302530 8:7578433-7578455 CCCGCAATGGGTCTGTGCTGAGG + Intergenic
1036303822 8:7586087-7586109 CCCGTAAAGGGTCTGTGCCGAGG + Intergenic
1036305470 8:7598331-7598353 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1036313174 8:7699760-7699782 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1036314803 8:7712010-7712032 CCCGTAAAGGGTCTGTGCCGAGG - Intergenic
1036316108 8:7719642-7719664 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036317417 8:7727290-7727312 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036318725 8:7734938-7734960 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036320032 8:7742585-7742607 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036321341 8:7750233-7750255 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036322650 8:7757881-7757903 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036323956 8:7765530-7765552 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036325261 8:7773186-7773208 CCCGCAATGGGTCTGTGCTGAGG - Intergenic
1036350800 8:8011143-8011165 CCGGTAAAGCGTCTGTGCTGAGG + Intergenic
1036352085 8:8018777-8018799 CCCGCAATGGGTCTGTGCTGAGG + Intergenic
1036353384 8:8026423-8026445 CCCGCAATGGGTCTGTGCTGAGG + Intergenic
1036354679 8:8034079-8034101 CCCGTAAAGGGTCTGTGCCGAGG + Intergenic
1036356320 8:8046328-8046350 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1036363841 8:8100659-8100681 CCCATAAAGTGTCTGTGCTGAGG - Intergenic
1036375704 8:8197623-8197645 CCCATAAAGGGTCTGTGGTGAGG + Intergenic
1036376621 8:8206118-8206140 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1036846076 8:12171571-12171593 CCCGTAAAGCGTCTGTGCTGAGG + Intergenic
1036852916 8:12217020-12217042 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1036853826 8:12225521-12225543 CCCATAAAGGGTCTGTGGTGAGG - Intergenic
1036867441 8:12413890-12413912 CCCGTAAAGCGTCTGTGCTGAGG + Intergenic
1036874289 8:12459542-12459564 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1036875201 8:12468031-12468053 CCCATAAAGGGTCTGTGGTGAGG - Intergenic
1036902243 8:12678966-12678988 CCCGTAAATGGTCTGTGCAGAGG - Intergenic
1037429457 8:18794363-18794385 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1039212788 8:35235714-35235736 CCGGGAAAGGGTCGGCGATGAGG - Exonic
1039392637 8:37193899-37193921 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1039674582 8:39647546-39647568 CCCGTAAATGGTCTGTGCTGAGG - Intronic
1039674860 8:39651326-39651348 CCCGTAAAGGGTCTGTGCTAAGG - Intronic
1040027611 8:42796225-42796247 CCCGTAAAGGGTCTCTGCTGAGG - Intronic
1040126150 8:43740070-43740092 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1040316644 8:46264592-46264614 CCCATAAAGGGTCTATGCTGAGG - Intergenic
1040317329 8:46271593-46271615 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1040339163 8:46431538-46431560 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1040340932 8:46440478-46440500 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1040343222 8:46456068-46456090 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1040413292 8:47176564-47176586 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1041060737 8:54032212-54032234 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1041374532 8:57200134-57200156 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1041513052 8:58672272-58672294 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1042204381 8:66313614-66313636 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1044310182 8:90684446-90684468 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1044310314 8:90685293-90685315 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1046334892 8:112772589-112772611 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
1046939554 8:119917709-119917731 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1048728859 8:137414879-137414901 CCAGTAAAGGGTCTGTGCTGAGG - Intergenic
1048902180 8:139049445-139049467 CCAGTAAAGGATCTGTGCTGAGG - Intergenic
1048947202 8:139460437-139460459 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1049481943 8:142829255-142829277 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1049506272 8:143001198-143001220 CCCGTAAAGGGTTTGTGCTGAGG + Intergenic
1049517367 8:143068019-143068041 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
1049557008 8:143287815-143287837 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1049663641 8:143832403-143832425 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1049667106 8:143850234-143850256 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1049725905 8:144146146-144146168 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1049776972 8:144410645-144410667 CCTATAAAGGGTCTGTGCTGAGG + Intronic
1049845030 8:144796308-144796330 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1049867733 8:144949871-144949893 CCCGTAAAGGGTCTGTGTTGAGG + Intronic
1049876084 8:145021806-145021828 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1049876763 8:145028386-145028408 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1050366011 9:4874481-4874503 CAGGCAAAGTGTCTCTGATGAGG + Intronic
1050385223 9:5082567-5082589 TCCGTGAAGGGTCTGTGCTGGGG - Intronic
1051471291 9:17445775-17445797 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1052279362 9:26715682-26715704 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1052469874 9:28880636-28880658 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1052676572 9:31633410-31633432 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1052871887 9:33515398-33515420 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1053668778 9:40339156-40339178 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1053708609 9:40782053-40782075 CCCATAAACGGTCTGTGCTGAGG - Intergenic
1053736394 9:41105606-41105628 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1053918577 9:42965429-42965451 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1054322230 9:63682140-63682162 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1054379914 9:64479193-64479215 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1054418520 9:64902848-64902870 CCCATAAACGGTCTGTGCTGAGG - Intergenic
1054515833 9:66037138-66037160 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1054691979 9:68325794-68325816 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1054843102 9:69763668-69763690 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1055157940 9:73087738-73087760 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1055540881 9:77303985-77304007 CTCGTAAAGGGTCTGTGCTGAGG - Intronic
1056211337 9:84368001-84368023 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1056567307 9:87785494-87785516 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1056859471 9:90166656-90166678 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1057685715 9:97232557-97232579 CCGGTAAAGGGTCTGTGCTGAGG + Intergenic
1058806263 9:108595019-108595041 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1059042160 9:110826662-110826684 CACGTAAAGGGTCTGTGCTGAGG + Intergenic
1060167371 9:121429520-121429542 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1060309724 9:122448490-122448512 CCCGTGAAGGGTCTGTGATGAGG - Intergenic
1060831061 9:126716943-126716965 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1061154671 9:128850661-128850683 CCTGTAAAGGGTCTGTGCTGAGG + Intronic
1061155289 9:128856877-128856899 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1061554260 9:131357125-131357147 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1061674586 9:132208529-132208551 CAGGGACAGGGGCTGTGATGTGG + Intronic
1061829731 9:133283818-133283840 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1061904186 9:133688252-133688274 CCGGGAAAGGGACTGGGATGCGG - Intronic
1061955286 9:133958187-133958209 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1061979501 9:134092967-134092989 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1062098515 9:134715455-134715477 CCCATGAAGGGTCTGTGCTGAGG - Intronic
1062235067 9:135503932-135503954 CGGGTACAGGGTAGGTGATGAGG - Exonic
1062486743 9:136780862-136780884 CCCATAAAGGGTCTGTACTGAGG - Intergenic
1062487806 9:136789342-136789364 ACCATAAAGGGTCTGTGCTGAGG - Intergenic
1062489288 9:136796944-136796966 CCAGTAAAGGGTCTGTGCTGAGG + Intronic
1062556838 9:137116667-137116689 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1062735201 9:138133365-138133387 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1203443330 Un_GL000219v1:31694-31716 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1203456784 Un_GL000219v1:175625-175647 CCCGTAAATGGTCTGTGCTGAGG + Intergenic
1203363835 Un_KI270442v1:240502-240524 CCCGGTAAGGGTCTGTGCTGAGG - Intergenic
1203369575 Un_KI270442v1:290099-290121 CCTGTAAACGGTCTGCGCTGAGG + Intergenic
1203377779 Un_KI270442v1:390919-390941 CCGATAAATGTTCTGTGCTGGGG - Intergenic
1203514138 Un_KI270741v1:150603-150625 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1203573349 Un_KI270744v1:153081-153103 CCCATAAATGGTCTGTGCTGAGG + Intergenic
1185444732 X:251690-251712 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1185575813 X:1171355-1171377 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1185682502 X:1900035-1900057 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1187198857 X:17115541-17115563 CCCGTAAAGGGTCTGTGCTGAGG - Intronic
1187403140 X:18980295-18980317 CCCGTGAAGGGTCTGTGCTGAGG + Intronic
1187707803 X:22025096-22025118 CCCGTAAGGGGTCTGAGCTGCGG - Intergenic
1187833619 X:23408247-23408269 CCGCTAAAGGGTGGCTGATGCGG + Intergenic
1187858570 X:23660395-23660417 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1188139055 X:26526003-26526025 CCTGTAAAGGGTCTGTGCTGAGG - Intergenic
1191018486 X:55835772-55835794 CCAGTGAAGGGTCTGTGCTGAGG - Intergenic
1191033321 X:55998301-55998323 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1191161613 X:57335686-57335708 CCCGTAAACGGTCTGTGCTGAGG - Intronic
1191228001 X:58065867-58065889 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1192626445 X:72733599-72733621 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1193170367 X:78329051-78329073 CCCGTAAAGGGTCTCTGCTGAGG + Intergenic
1193964815 X:87972469-87972491 TCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1194141316 X:90213746-90213768 CCTGTAAAGGGTCTGTGCTGAGG + Intergenic
1194200772 X:90951030-90951052 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1197383860 X:125779925-125779947 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1197509548 X:127354366-127354388 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1198268206 X:135030760-135030782 CCTGTAAAGGGCCTGTGCTGAGG + Intergenic
1198297681 X:135303268-135303290 CCCATGAAGGGTCTGTGCTGAGG - Intronic
1198308582 X:135406513-135406535 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
1198602251 X:138296313-138296335 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1198605633 X:138333901-138333923 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1198696313 X:139342451-139342473 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1199256209 X:145721372-145721394 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1199612088 X:149627070-149627092 CCCGTAAAGTGTCTGTGCTGAGG - Intronic
1199874553 X:151920260-151920282 CCGGTCCAGGCTCTGTGAGGTGG + Intronic
1199896199 X:152130033-152130055 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1200245439 X:154521601-154521623 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1200257144 X:154589076-154589098 CCCGTGAAGGGTCTGTGCTGAGG + Intergenic
1200259939 X:154608979-154609001 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
1200260625 X:154615326-154615348 CCCGTGAAGGGTCTGTGCTGAGG - Intergenic
1200294987 X:154910748-154910770 CCCGTAAAGGGTCTGTGCTGAGG + Intronic
1200487071 Y:3782848-3782870 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1200731656 Y:6749302-6749324 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1200752447 Y:6958960-6958982 CCCATAAAGGGTCTGTGCTGAGG - Intronic
1200777221 Y:7180290-7180312 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1200833641 Y:7711753-7711775 CCTGTAAAGGCTCTGTGCTGAGG + Intergenic
1201068720 Y:10124926-10124948 CCTGTAAACGGTCTGTGCTGAGG - Intergenic
1201074480 Y:10176335-10176357 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1201356699 Y:13104353-13104375 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1201452708 Y:14133617-14133639 CCCATAAAGGGTCTGTGCTGAGG + Intergenic
1201604910 Y:15773697-15773719 CCCGTAAATGGTCTGTGCTGAGG - Intergenic
1201962735 Y:19700010-19700032 CCCATAAAGGGTCTGTGCTGAGG - Intergenic
1202253145 Y:22893570-22893592 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1202377588 Y:24251183-24251205 CCCATAAAGGGTCTGTATTGAGG + Intergenic
1202406135 Y:24527319-24527341 CCCGTAAAGGGTCTGTGCTGAGG - Intergenic
1202464647 Y:25142762-25142784 CCCGTAAAGGGTCTGTGCTGAGG + Intergenic
1202493193 Y:25418939-25418961 CCCATAAAGGGTCTGTATTGAGG - Intergenic