ID: 1162100136

View in Genome Browser
Species Human (GRCh38)
Location 19:8334333-8334355
Sequence CAAGAGCCTGCAGTTTGTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 169}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162100136_1162100143 -9 Left 1162100136 19:8334333-8334355 CCCCAACAAACTGCAGGCTCTTG 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1162100143 19:8334347-8334369 AGGCTCTTGGGTCCGGAGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 121
1162100136_1162100142 -10 Left 1162100136 19:8334333-8334355 CCCCAACAAACTGCAGGCTCTTG 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1162100142 19:8334346-8334368 CAGGCTCTTGGGTCCGGAGCTGG 0: 1
1: 0
2: 1
3: 13
4: 149
1162100136_1162100144 -5 Left 1162100136 19:8334333-8334355 CCCCAACAAACTGCAGGCTCTTG 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1162100144 19:8334351-8334373 TCTTGGGTCCGGAGCTGGGTTGG 0: 1
1: 0
2: 0
3: 17
4: 143
1162100136_1162100149 29 Left 1162100136 19:8334333-8334355 CCCCAACAAACTGCAGGCTCTTG 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1162100149 19:8334385-8334407 GCCGTCTCTCTTCTTCATGATGG 0: 1
1: 0
2: 1
3: 14
4: 98
1162100136_1162100147 3 Left 1162100136 19:8334333-8334355 CCCCAACAAACTGCAGGCTCTTG 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1162100147 19:8334359-8334381 CCGGAGCTGGGTTGGGCACCAGG 0: 1
1: 0
2: 2
3: 19
4: 245
1162100136_1162100145 -4 Left 1162100136 19:8334333-8334355 CCCCAACAAACTGCAGGCTCTTG 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1162100145 19:8334352-8334374 CTTGGGTCCGGAGCTGGGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162100136 Original CRISPR CAAGAGCCTGCAGTTTGTTG GGG (reversed) Exonic
901147125 1:7072812-7072834 CAGGAGCCTGCTGTCTGTTCAGG + Intronic
904183339 1:28682820-28682842 CAAGAGCTTCCTGTTTGGTGTGG + Intronic
904752545 1:32749898-32749920 CAAGAGAATGCAGATTTTTGGGG - Intronic
907386088 1:54126090-54126112 CATGGGGCAGCAGTTTGTTGGGG + Intergenic
908251762 1:62271488-62271510 AAAGAACCTTCAGTTTGTTGGGG - Exonic
910430291 1:87153286-87153308 CAGGAGTCTGCAGTCTGCTGGGG + Intronic
912606343 1:110993203-110993225 CATGACCCTGCAGTTGGATGGGG + Intergenic
913266081 1:117046105-117046127 CGACATCCTCCAGTTTGTTGAGG - Intergenic
916462137 1:165036391-165036413 CAAGAGTCTGGAGTTAGTTCGGG - Intergenic
916607375 1:166356322-166356344 TAAGAGGCTGCCATTTGTTGAGG + Intergenic
917937018 1:179878357-179878379 CAAGAACATACAATTTGTTGGGG + Intergenic
920445933 1:206016700-206016722 CAAGATACTGCAGTATGTGGAGG - Intronic
921461888 1:215437636-215437658 TACTAGCCTGCAGTTTTTTGGGG + Intergenic
921607096 1:217168657-217168679 AAAGAGGCTGGAGTTTGATGAGG - Intergenic
921904493 1:220482390-220482412 CAAGACCCTGGGGTCTGTTGGGG + Intergenic
922786123 1:228283148-228283170 CAAGAGCCAGAAGTATGATGTGG + Exonic
923561816 1:235047432-235047454 CAGGAGCATGCAGTGGGTTGGGG + Intergenic
1062987217 10:1780079-1780101 CCAGATCATGCAGTTTGTTCTGG - Intergenic
1067563678 10:47321736-47321758 CCACAGGCTGCAGTGTGTTGTGG + Intergenic
1069544893 10:69320743-69320765 CAACAGCCAGCAGTCTGTTGTGG - Intronic
1070228531 10:74538489-74538511 CAAAATTCTGCAGTTTGTTGTGG + Intronic
1070772525 10:79090655-79090677 CAAGAGCCAGCAGTGTGCAGCGG + Intronic
1074267434 10:111918482-111918504 GAAGAGCATGGAGTTTGCTGTGG + Intergenic
1074477305 10:113784745-113784767 CAAGAGGCTGCAGAATGTGGAGG + Intergenic
1075635590 10:124028223-124028245 CAAGATCCCGCAGTGTGTTCCGG - Intronic
1076307432 10:129474984-129475006 GAAGAGCCTGGCCTTTGTTGGGG + Intronic
1076483024 10:130797182-130797204 AAGGAGCCTCCAGTTTGTTGTGG + Intergenic
1077485276 11:2835672-2835694 CAGGAGCCTGCAGCATGCTGGGG + Intronic
1078860410 11:15241263-15241285 CAAGAGCCAGCACTTTCTTCTGG - Intronic
1080101683 11:28466873-28466895 GTAGAGCCTTCAGTCTGTTGGGG + Intergenic
1083730912 11:64652053-64652075 CAAGAGCCTGCAGCTGTCTGTGG - Exonic
1083810558 11:65103275-65103297 CCATTGCCTGCATTTTGTTGGGG - Intronic
1085323496 11:75589147-75589169 CAAGAGCCTGGAAGTTGGTGAGG - Intronic
1088641789 11:111879724-111879746 AATGAGCCTGCAGTCTGGTGGGG + Intronic
1089808154 11:121110208-121110230 CAAAAGCCTGCAGCTTGTTTGGG + Intronic
1090223365 11:125051296-125051318 CTAGAGGCTGCAGTGTTTTGTGG + Intergenic
1091300539 11:134504408-134504430 AATGAGCCTACATTTTGTTGGGG + Intergenic
1092255770 12:6926158-6926180 GAGGAGCCTGCAGTCTGTGGTGG + Intronic
1097507537 12:60494677-60494699 CAAGGTGCTGCAGTTTCTTGGGG + Intergenic
1098974527 12:76888903-76888925 CAAGAGCAGGCAGTTTGGTTTGG + Intergenic
1101477568 12:105065055-105065077 AAGGAGCCTGCAGTTTTATGGGG - Intronic
1102391382 12:112551703-112551725 CAAGAGGCTGCAGTTAGTGCAGG + Intergenic
1103036841 12:117663844-117663866 CACGAGCTTGCAGGTTGTTGGGG + Intronic
1104701303 12:130906279-130906301 CAAGGTTCTGAAGTTTGTTGGGG + Intergenic
1106128234 13:26918852-26918874 CAAGAGCCTACAGTGGGTTTTGG - Intergenic
1106351391 13:28934105-28934127 CAAGAGCCTTCACTTAATTGTGG - Intronic
1109973162 13:69796873-69796895 CAGAAGGCTGCAGTTTGGTGTGG - Exonic
1110819623 13:79899408-79899430 CAAGATCCTGCATTTTTTTCAGG + Intergenic
1111761492 13:92471369-92471391 CAACAGCCTGCAGATGGATGTGG + Intronic
1112418069 13:99221268-99221290 AAAAAGACTGCAGTTTGTGGAGG - Intronic
1115070762 14:29319407-29319429 AAAGAGCCTTCACTTTGTTTGGG - Intergenic
1120380408 14:83771483-83771505 GAAAACCCTGCAGTTTGCTGTGG - Intergenic
1121557981 14:94852647-94852669 AAAGAGGCTGCTGTTTGGTGTGG + Intergenic
1122348425 14:101074289-101074311 CCAGAGCCAGCAGTGTGTGGGGG - Intergenic
1123436935 15:20261614-20261636 CAAGAGGCCACAGTCTGTTGGGG + Intergenic
1128532204 15:68462065-68462087 CCAGAGCCTGCACCTTGGTGTGG + Intergenic
1128889320 15:71316730-71316752 CCAGACCCTGCTGCTTGTTGGGG - Intronic
1129527918 15:76234059-76234081 CAACTGCCTTCAGTTTGTTTTGG - Intronic
1132807066 16:1779734-1779756 AATGGGCCTGCAGTCTGTTGTGG - Intronic
1134182782 16:12061229-12061251 AGGGAGCCTGCAGTCTGTTGGGG - Intronic
1134828844 16:17307048-17307070 TATGAGCCTGCAGTTTTGTGGGG + Intronic
1135040862 16:19115580-19115602 CAAGTGCCTGCAGTTGCTTAAGG + Exonic
1136847632 16:33589222-33589244 CAAGAGGCCACAGTCTGTTGGGG - Intergenic
1137528672 16:49261848-49261870 CAAGTGCCTACAGTATGGTGGGG - Intergenic
1138108091 16:54301496-54301518 CAAGAGCCTGGCTTTTGTTTTGG - Intergenic
1138459930 16:57142163-57142185 CCAGAGCCTGCAGTCTAGTGAGG + Intronic
1140574956 16:76156874-76156896 CAAGAGCCTGCAGTCTTTACTGG + Intergenic
1140813003 16:78596355-78596377 CAAGAGCATGTAGTGTGGTGGGG + Intronic
1141217111 16:82034985-82035007 CAAGAGCCTGCAGTATGTCTGGG - Intronic
1141412470 16:83845016-83845038 CAAGAGACTTCAGTTTGGAGAGG - Intergenic
1203109340 16_KI270728v1_random:1437877-1437899 CAAGAGGCCACAGTCTGTTGGGG - Intergenic
1143745629 17:8992055-8992077 CCAGAGCCTGCAGTGTCTTGTGG - Intergenic
1144265154 17:13561780-13561802 GAAGTGCCTGCAGTTGGGTGTGG - Intronic
1146480021 17:33197613-33197635 CAAGGGGTTGCAGTTTGATGTGG + Intronic
1151327258 17:73386915-73386937 AAAGAGATGGCAGTTTGTTGGGG - Intronic
1151820926 17:76496420-76496442 CAAGAGGCTGCAGAGTGTGGAGG - Intronic
1155425470 18:25702101-25702123 AAAGAGGCTCCAGTTTGGTGAGG + Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156736289 18:40263469-40263491 CAAGAGCCTGCAGCTTTTCCAGG - Intergenic
1157735121 18:50040787-50040809 GAAGAACGTGCAGTTAGTTGGGG - Intronic
1159269149 18:66126510-66126532 CAAGAGACTGCAGTGATTTGAGG + Intergenic
1160851871 19:1196541-1196563 ACAGAACCTGCAGTTTGGTGAGG + Intronic
1160852295 19:1198355-1198377 ACAGAACCTGCAGTTTGGTGAGG + Intronic
1162100136 19:8334333-8334355 CAAGAGCCTGCAGTTTGTTGGGG - Exonic
1162303071 19:9855153-9855175 CCAGGGGCTGCAGTTTCTTGGGG + Intronic
1163582213 19:18145638-18145660 CAAGAGGCAGCAGCTTGCTGGGG + Intronic
1164896311 19:31880435-31880457 CAAGGGCTTGCAGGTTGATGAGG - Intergenic
1168484358 19:56748257-56748279 CAAGTGCCTGCATTTTATGGCGG - Intergenic
926359455 2:12072011-12072033 CAAGAGCCTACAGACTTTTGAGG + Intergenic
926751160 2:16199658-16199680 AAAGAGCCTACAGTTTATTGTGG + Intergenic
937177456 2:119954500-119954522 TAAGAGGCTACAGTTTGTGGAGG + Intronic
938691909 2:133799674-133799696 AAACACCCTGCAGTTTGGTGGGG - Intergenic
940788338 2:158005788-158005810 CAGGACCCTGAAGTTTGTTTAGG - Intronic
942639389 2:178045512-178045534 CCAGAGACAGCAGTTTGTGGTGG + Intronic
945116880 2:206416695-206416717 CAGGAGCCAGAAGCTTGTTGGGG - Intergenic
948997368 2:241589363-241589385 TAAGAGCCTGTTGTTTGTTCTGG - Intronic
1169026945 20:2379641-2379663 CAGCAGCCTGCAGGGTGTTGAGG + Intergenic
1169180905 20:3565993-3566015 CAAGAGCATGCTTTTTGGTGTGG + Intronic
1169268650 20:4182622-4182644 CAACAGCCTACAGTTTGTGTGGG + Exonic
1172828998 20:37815954-37815976 CAGCAGCCTGCAGGTTGCTGGGG + Intronic
1173575613 20:44111438-44111460 CAAGAGCCTGCCCTTTGAGGTGG - Intergenic
1177707095 21:24720522-24720544 CCAGAGACTGCAGTTAGTTAGGG - Intergenic
1180161988 21:46002224-46002246 CAAGAGCCTGCAGTGGATGGCGG + Exonic
1181453178 22:23037600-23037622 CAGGACCCTGGAGTTTGTTCTGG - Intergenic
1181830307 22:25555214-25555236 GAAGAGCCCACAGTTGGTTGTGG - Intergenic
950609772 3:14118603-14118625 CAAAAGCCTCCAGTGGGTTGGGG - Intronic
950668561 3:14511785-14511807 AAAGAGCTCGCAGTTTGCTGGGG - Intronic
953231087 3:41065618-41065640 CAAGTGCATGCAGTTTATTGAGG - Intergenic
956729234 3:72181539-72181561 CAAGAAATTGCAGTTTATTGGGG + Intergenic
957014363 3:75045524-75045546 CAATAACTTGCAGTTGGTTGTGG + Intergenic
963041954 3:141076639-141076661 GAAGAGCCAGCAGTTGCTTGGGG + Intronic
963604795 3:147405084-147405106 CAAGCGCCAGGAGTTTGCTGAGG + Intronic
963857044 3:150265565-150265587 CAAGAGCCTGCAGTTTCAGAAGG + Intergenic
968383290 4:112879-112901 CAGGAGCTGGCAGTCTGTTGGGG - Intergenic
969502314 4:7560573-7560595 GAAGAGCCTGTGGTTTGCTGGGG - Intronic
971209614 4:24603103-24603125 CAAGAGCCTGCAGTTGTTCCAGG + Intergenic
971791016 4:31169960-31169982 CAAGAACATGAAGTTTCTTGGGG - Intergenic
974070177 4:57115964-57115986 CAAGGGCCTGAAGTCAGTTGTGG + Intergenic
975984407 4:80189388-80189410 CAAGAGCAATCAGTTTGCTGCGG - Intronic
976488356 4:85636844-85636866 TAAGAGCCTACAGTTTGGTTTGG - Intronic
977759135 4:100710015-100710037 AAAGAGCATGGAGTGTGTTGAGG - Intronic
977850807 4:101825616-101825638 CAACTTCCTGCAGTTTGGTGAGG + Intronic
980251952 4:130327992-130328014 CAAGACCCTGCATTTTGTAAGGG + Intergenic
986545784 5:8895115-8895137 CAAGGGCCTCCAGTTATTTGTGG - Intergenic
986560909 5:9060174-9060196 CAAGATTCTGCAGAGTGTTGTGG - Intronic
986565755 5:9112015-9112037 TAAAAGTCTGCAGTGTGTTGGGG - Intronic
987372735 5:17207912-17207934 CAAGGGCCTGCAAATTGCTGGGG - Intronic
988564172 5:32307817-32307839 CAAGAGTCAGCACTTTGTGGTGG - Intronic
988973956 5:36496824-36496846 GAAGAGTCTCCAGTTTGTTAAGG - Intergenic
994058437 5:95446476-95446498 AAAAAGTCTGCAGTTTTTTGAGG - Intronic
994626855 5:102230881-102230903 GAAGAGCCTGGAGTATCTTGTGG + Intergenic
995228035 5:109725404-109725426 CAAGAGGCTGTAGTTTGTAGGGG - Intronic
996746767 5:126852850-126852872 CAAAAGCCTGCTGTTTGAAGGGG + Intergenic
996759527 5:126973360-126973382 TATCAGCCTGCAGTTTGTGGAGG + Intronic
997382231 5:133446135-133446157 CGAGAGCCTGCAGGTTTTGGTGG - Intronic
999433666 5:151545216-151545238 CAAAAGCTTGCAGTTTGATCAGG - Exonic
999687619 5:154117005-154117027 AAAGAGGCTGCAGTGGGTTGAGG - Intronic
1000172198 5:158713066-158713088 CAAGGGCCGGGAGTTGGTTGTGG + Exonic
1002150416 5:177224702-177224724 CTAGAGCCTCCAGTGTGATGCGG + Intronic
1005917167 6:30363287-30363309 CAGGAGCCTGCAGTATGTGTGGG + Intergenic
1009828169 6:68894930-68894952 CAAAAGCATGCAGTTAGTTAGGG - Intronic
1011338554 6:86286529-86286551 CAAGGGCCTGCAGTCTTTTGGGG - Intergenic
1012162544 6:95904323-95904345 GAATAGCCTGCACTTTGATGAGG + Intergenic
1016249471 6:142022386-142022408 CCAGTTCCTGCAGTTAGTTGAGG + Intergenic
1016604215 6:145900487-145900509 CCAGAGGCTGGAGTTTGTGGGGG + Intronic
1017604486 6:156119307-156119329 CAAGAGCCTGCAATTTGCAGTGG + Intergenic
1017810376 6:157979933-157979955 CAAGAGCCTGCTGGGTTTTGGGG - Intergenic
1018722864 6:166587026-166587048 TAAGGGCCTGCAGTTAGCTGTGG - Intronic
1018795602 6:167183050-167183072 CAACAGCCTCCTGTTTGATGGGG - Intronic
1018820715 6:167372013-167372035 CAACAGCCTCCTGTTTGATGGGG + Intronic
1022624304 7:32018905-32018927 GAAGAGCCAGCAGTTTATAGTGG + Intronic
1023377056 7:39566804-39566826 GAACAGTTTGCAGTTTGTTGAGG + Intronic
1026240558 7:68571141-68571163 CAAAAGCAGGCAGTTTGTGGAGG + Intergenic
1026842148 7:73675653-73675675 CAAGAGCCTGCACTTTATGCAGG - Intergenic
1030549756 7:110943686-110943708 CAATAGCCTGCAGTTAATAGAGG - Intronic
1030968104 7:116018861-116018883 CAAGAATCTGCAAGTTGTTGTGG + Intronic
1031411961 7:121450013-121450035 CAATTGCCTTCACTTTGTTGTGG - Intergenic
1031785783 7:126029504-126029526 CAAGACCCTGAACTTTGTTTGGG - Intergenic
1032185092 7:129717892-129717914 AAAGAAACTGCATTTTGTTGGGG + Intronic
1034634168 7:152554132-152554154 CAAGAGGCAGGAGTTTGTTGGGG - Intergenic
1037995676 8:23350730-23350752 AAAGAGCCGGTAGTCTGTTGGGG + Intronic
1039553940 8:38463482-38463504 AAGGAGCCTGCAGTTTCGTGGGG - Intronic
1039822582 8:41146856-41146878 CATGAAACTGCAGTTTGTGGAGG + Intergenic
1041040186 8:53838908-53838930 AAAGAGCTTACAGATTGTTGGGG - Intronic
1043374307 8:79631058-79631080 CAAGAGCCTGCAAGATGTAGCGG + Intronic
1043674751 8:82937135-82937157 GAAGAGACTGCAGTGGGTTGAGG - Intergenic
1045677730 8:104626742-104626764 AAAGAGCTTACAGTTTGGTGGGG + Intronic
1047724092 8:127669435-127669457 CAAGAGCTCCCTGTTTGTTGTGG + Intergenic
1048854405 8:138674115-138674137 CAAGAGCAAGGAGTTTGTTTGGG - Intronic
1049110888 8:140642505-140642527 CAAGAGCCTGCATTTCCCTGCGG + Intergenic
1049525795 8:143126312-143126334 CAAGAGCTTGCAGCGTCTTGGGG - Intergenic
1049932940 9:473627-473649 CAGGTGCCTGTGGTTTGTTGGGG - Intronic
1053433433 9:38059083-38059105 TGAGAGCCTGCTGTGTGTTGGGG - Intronic
1056383267 9:86074816-86074838 CAAGAGCAAGCAGTGTGGTGGGG - Intronic
1057201366 9:93142113-93142135 CAAGAGCCTGCAGTGGGGTGGGG + Intergenic
1057599877 9:96449019-96449041 CCAGAGCCTGTATTTTGTTCAGG - Intergenic
1057800172 9:98186079-98186101 CTTGAGCCTGGAGTTTGTAGGGG - Intronic
1058567193 9:106298803-106298825 CAAGAGCCTACAGTTTCTTGGGG - Intergenic
1060194721 9:121616229-121616251 GAAGAGCCTTCTGTTTATTGAGG + Intronic
1060765701 9:126293805-126293827 GAAGAGAATGCAGTTTGTTCAGG + Intergenic
1061779916 9:132989365-132989387 TAAGAGTCTGAAGTTTGTTAAGG - Intronic
1062320941 9:135990295-135990317 CAGGAGCCTGCAGGGTGTGGGGG - Intergenic
1186290611 X:8093710-8093732 GAGGAGCCTGCAGTTTGCTGTGG + Intergenic
1186452349 X:9684146-9684168 GAAGGGCCTGCAGTATGTAGAGG + Exonic
1186778602 X:12891002-12891024 CAAGTGTCTGCAGTTTGTAGAGG + Intergenic
1187631175 X:21174418-21174440 TAAGTGTCTGCAGTGTGTTGTGG + Intergenic
1198159632 X:133994737-133994759 CAAGAGCCAGCACAGTGTTGTGG + Intergenic
1199095454 X:143733387-143733409 CAAGAGCCAGTAGTATATTGAGG + Intergenic
1201271996 Y:12264534-12264556 CAATAGCCTGGGGTTTTTTGTGG + Intergenic