ID: 1162100248

View in Genome Browser
Species Human (GRCh38)
Location 19:8334800-8334822
Sequence GGCGGACGCGTGGGTGACCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162100248_1162100266 29 Left 1162100248 19:8334800-8334822 CCTCGGTCACCCACGCGTCCGCC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1162100266 19:8334852-8334874 GGCCTCCCGGGTCTCCGGCACGG 0: 1
1: 0
2: 1
3: 18
4: 160
1162100248_1162100255 -7 Left 1162100248 19:8334800-8334822 CCTCGGTCACCCACGCGTCCGCC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1162100255 19:8334816-8334838 GTCCGCCTCCACGGTCTCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 46
1162100248_1162100252 -10 Left 1162100248 19:8334800-8334822 CCTCGGTCACCCACGCGTCCGCC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1162100252 19:8334813-8334835 CGCGTCCGCCTCCACGGTCTCGG 0: 1
1: 0
2: 0
3: 2
4: 67
1162100248_1162100261 17 Left 1162100248 19:8334800-8334822 CCTCGGTCACCCACGCGTCCGCC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1162100261 19:8334840-8334862 AGCCTCCACGCCGGCCTCCCGGG 0: 1
1: 0
2: 9
3: 62
4: 384
1162100248_1162100253 -9 Left 1162100248 19:8334800-8334822 CCTCGGTCACCCACGCGTCCGCC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1162100253 19:8334814-8334836 GCGTCCGCCTCCACGGTCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 110
1162100248_1162100264 24 Left 1162100248 19:8334800-8334822 CCTCGGTCACCCACGCGTCCGCC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1162100264 19:8334847-8334869 ACGCCGGCCTCCCGGGTCTCCGG 0: 1
1: 0
2: 0
3: 16
4: 183
1162100248_1162100259 8 Left 1162100248 19:8334800-8334822 CCTCGGTCACCCACGCGTCCGCC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1162100259 19:8334831-8334853 CTCGGGGGCAGCCTCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 155
1162100248_1162100260 16 Left 1162100248 19:8334800-8334822 CCTCGGTCACCCACGCGTCCGCC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1162100260 19:8334839-8334861 CAGCCTCCACGCCGGCCTCCCGG 0: 1
1: 1
2: 4
3: 49
4: 549
1162100248_1162100254 -8 Left 1162100248 19:8334800-8334822 CCTCGGTCACCCACGCGTCCGCC 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1162100254 19:8334815-8334837 CGTCCGCCTCCACGGTCTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162100248 Original CRISPR GGCGGACGCGTGGGTGACCG AGG (reversed) Exonic