ID: 1162100575

View in Genome Browser
Species Human (GRCh38)
Location 19:8336126-8336148
Sequence GAGGGGACTTTCCTGTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162100565_1162100575 15 Left 1162100565 19:8336088-8336110 CCCGATTTAGCGTTTGGTTGCCA 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1162100575 19:8336126-8336148 GAGGGGACTTTCCTGTGGAGTGG 0: 1
1: 0
2: 0
3: 20
4: 214
1162100566_1162100575 14 Left 1162100566 19:8336089-8336111 CCGATTTAGCGTTTGGTTGCCAG 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1162100575 19:8336126-8336148 GAGGGGACTTTCCTGTGGAGTGG 0: 1
1: 0
2: 0
3: 20
4: 214
1162100570_1162100575 -5 Left 1162100570 19:8336108-8336130 CCAGGGAAGCTTTCCTGTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1162100575 19:8336126-8336148 GAGGGGACTTTCCTGTGGAGTGG 0: 1
1: 0
2: 0
3: 20
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162100575 Original CRISPR GAGGGGACTTTCCTGTGGAG TGG Intronic
900467801 1:2834230-2834252 AAGGGGACTGTGCTGTGGAGTGG + Intergenic
900708689 1:4097094-4097116 GAGGGGACTGTCCTGTGGGATGG - Intergenic
903162161 1:21496977-21496999 GAGGGGACTGGCCTGTGAATGGG - Intergenic
903802088 1:25976722-25976744 GATGGGACATTCATTTGGAGGGG - Exonic
904341154 1:29835755-29835777 GGGGGGACTTTCCTGTTGGGTGG + Intergenic
907582447 1:55584252-55584274 GAGGGAACTTCCCTGAGGTGGGG + Intergenic
908561236 1:65309283-65309305 GAGGGGAGGTTCGTGAGGAGGGG - Intronic
911042073 1:93599027-93599049 GATGTGGCTTTCCTGGGGAGTGG - Intronic
912536031 1:110371828-110371850 GAAGGGACTTTGGGGTGGAGTGG + Intronic
913237730 1:116799326-116799348 GAGGGGAGATTCCTGGGGATTGG + Intergenic
914910761 1:151784285-151784307 GATGGGACTATCCAGTAGAGAGG - Intronic
917197513 1:172482056-172482078 ATGGGGTCTTTCCTGAGGAGTGG - Intergenic
918441308 1:184569844-184569866 GAGGTCACTGTGCTGTGGAGAGG + Intronic
919741502 1:200983893-200983915 GAAGGGGCATTTCTGTGGAGAGG + Intronic
922613426 1:226946275-226946297 GAGATGACTTGCCTATGGAGGGG + Intronic
922803758 1:228375516-228375538 GAGGGGCCTCTCCTGGCGAGGGG - Intronic
923136144 1:231121415-231121437 AATGGGACTTTCTTGGGGAGGGG - Intergenic
1063441314 10:6075605-6075627 GAGGGGACTGTGGGGTGGAGGGG - Intergenic
1063575571 10:7259290-7259312 GTGGGCACTTTCCAGTGGGGAGG - Intronic
1065838332 10:29679400-29679422 GAGGAGACTTGCATGTGGAAAGG - Intronic
1067017436 10:42768722-42768744 GACGCGACTTTCCTGAGGCGGGG - Intergenic
1069060444 10:63889072-63889094 GAGGCGACTTTGCTGTCTAGGGG + Intergenic
1069847746 10:71384446-71384468 CAGGGGATTTTCCTGTGGCTGGG + Intergenic
1070920188 10:80179847-80179869 GAGGGGACTTACATATGGGGCGG - Intronic
1072438786 10:95436300-95436322 GAGGGGCAGTGCCTGTGGAGTGG - Intronic
1073099251 10:100998353-100998375 GAGGGGGCTCTGCTGGGGAGAGG + Intronic
1073116211 10:101093386-101093408 CAGGGGGATTACCTGTGGAGGGG - Intronic
1073706447 10:105989613-105989635 CAAGGGACTTTCCTGTGGTTAGG - Intergenic
1076736429 10:132461211-132461233 GAGGGAACTTGACAGTGGAGGGG - Intergenic
1077061406 11:619294-619316 AGGGGGGCTTACCTGTGGAGGGG + Exonic
1077094187 11:792447-792469 AAGGGGACATCCCTGTGGGGAGG + Exonic
1077351901 11:2096945-2096967 CAGGGCAGCTTCCTGTGGAGTGG - Intergenic
1078518761 11:12047100-12047122 GAAAGGACTTTGCAGTGGAGGGG - Intergenic
1078850488 11:15158681-15158703 GAGGAGACTTTTGTTTGGAGAGG - Intronic
1080075064 11:28139187-28139209 GAGGGGAGTGTCCTGTGGTATGG + Intronic
1081541584 11:44038499-44038521 GACAGGGCTTTCCAGTGGAGAGG + Intergenic
1081660130 11:44882963-44882985 GAGGGCACTTTCCTGGGTGGAGG + Intronic
1083459885 11:62804117-62804139 GAGGGTTCTTTCCTGTGGATAGG - Intronic
1084560306 11:69901526-69901548 GAGGGGATTTCCCTGGGAAGGGG - Intergenic
1084580518 11:70020272-70020294 GTGGGGGATTTCCTGTGGATAGG - Intergenic
1084711267 11:70845313-70845335 GAGAGGACTTTCCACTGGAGTGG + Intronic
1084935282 11:72583651-72583673 GTGGGGTCTTTACTGTGGACTGG - Intronic
1084979636 11:72822314-72822336 GCGGGGCCTTTCCTCAGGAGGGG - Intronic
1085483127 11:76838962-76838984 GAGGGGAGTTTGCTGGGGAGTGG + Intergenic
1088411632 11:109540595-109540617 GAGGGGATTTGTCTGTGGAGGGG - Intergenic
1089419758 11:118322709-118322731 GAGGCGACTGTACGGTGGAGAGG - Intergenic
1089614658 11:119688442-119688464 GGGGGGACTGTCCTGTTGTGGGG + Intronic
1089910250 11:122091683-122091705 GGGGAGACATTCCTGAGGAGGGG + Intergenic
1092143896 12:6201483-6201505 GAGCGGACGTTCATCTGGAGAGG + Intronic
1094633760 12:32203717-32203739 GAGGGGACTTACATATGCAGCGG - Intronic
1099979645 12:89583772-89583794 GAGGTGATTTTCCTTTGGCGGGG + Intergenic
1102514153 12:113435318-113435340 GCGTGGCCTTTCCTGGGGAGGGG - Exonic
1102960120 12:117087034-117087056 GAGGGTAGTCCCCTGTGGAGTGG - Intronic
1103200743 12:119085978-119086000 TGTGGGACTTTCATGTGGAGAGG + Intronic
1104779821 12:131412948-131412970 GGGAGGACTTTCCTGTGAGGAGG + Intergenic
1106485711 13:30170899-30170921 CAGGGAAATTTCCTGCGGAGGGG - Intergenic
1108598590 13:51971724-51971746 GAGTGGGCATTCATGTGGAGTGG - Intronic
1111202789 13:84961750-84961772 GAGATGACTTTCCTGTGGGAAGG - Intergenic
1112383431 13:98915631-98915653 GGGGGGGCTTTCATGAGGAGGGG - Intronic
1114139719 14:19895691-19895713 TAGGGGACTTTCCTGTGCTCAGG + Intergenic
1114871353 14:26663083-26663105 GAGGTGACTTATTTGTGGAGTGG + Intergenic
1116674361 14:47886791-47886813 GAGTGGTCTTTCCTGTGTATGGG + Intergenic
1119137309 14:72232668-72232690 GAGGGGACTCTCCTGTGAAAGGG + Intronic
1119616885 14:76104683-76104705 GAGGGGACTGACCTGGAGAGGGG + Intergenic
1122414377 14:101541863-101541885 GAGGGGGCTGGCCTGGGGAGGGG - Intergenic
1122904720 14:104796322-104796344 AGGGGGACTTTGCTGGGGAGTGG + Intergenic
1126101565 15:45121058-45121080 GAGGGCTCTTACCTGTGGTGGGG - Intronic
1127612307 15:60648980-60649002 GAGGAGAGTTGACTGTGGAGTGG - Intronic
1128177931 15:65573125-65573147 CAGGGGACTTTCCTATTGTGAGG - Intronic
1128455848 15:67830934-67830956 GATGGGTCATTCCTGTAGAGGGG + Intronic
1129120615 15:73394222-73394244 GCGGGGAGTCTCCTGTTGAGGGG - Intergenic
1131682759 15:94741484-94741506 GAGGAGACTGTCCTCTAGAGAGG - Intergenic
1132154385 15:99485455-99485477 GTGGGGACATTCCTAGGGAGGGG + Intergenic
1132552575 16:559615-559637 GAGGGGACTCCCGTGGGGAGGGG + Intergenic
1132801514 16:1756848-1756870 TATGGGACTTTCCTGTGCTGAGG - Intronic
1136279828 16:29201713-29201735 GAGTGGTCTGTCCTGGGGAGCGG - Intergenic
1136419477 16:30123015-30123037 GAGGGGGCGTTCCGGGGGAGGGG - Intronic
1136626066 16:31462854-31462876 CCTGGGACTTTCCTGAGGAGAGG + Exonic
1139658766 16:68405786-68405808 GAGGGGGCTTCACTGTGAAGGGG - Intronic
1141136350 16:81468168-81468190 GAGCGGGCTTTCCTGGGCAGGGG + Intronic
1141294929 16:82758662-82758684 GAGGGCATCTTCCTCTGGAGGGG + Intronic
1141720423 16:85752386-85752408 GAGGGCACATCCCTGGGGAGGGG + Intergenic
1142075913 16:88117699-88117721 GAGGGGCTTTTCCTGGGGAAGGG + Intronic
1142169736 16:88615289-88615311 GGGGAGACTTCCCTGTGCAGAGG - Intronic
1143548397 17:7614159-7614181 AAGGGGTCTCTCCTGCGGAGCGG + Intronic
1145924615 17:28636945-28636967 GAGGTAATGTTCCTGTGGAGAGG - Exonic
1147313607 17:39608371-39608393 AAGGGGACCCTCCTGGGGAGTGG - Intronic
1147739560 17:42663202-42663224 GTGGGGGTTTACCTGTGGAGGGG + Intronic
1148979746 17:51562287-51562309 TAGGGGACCGTCCTGTGGACAGG - Intergenic
1150809937 17:68348323-68348345 GAGGGCATATTCCTGTGGTGAGG + Intronic
1152533539 17:80937023-80937045 GAGGGGACTTTATTGTTCAGTGG + Intronic
1157160869 18:45313185-45313207 GAGGGGATTTTCCTCTGGTGAGG + Intronic
1157324388 18:46658184-46658206 AAGGGGAATTTCAGGTGGAGAGG + Intergenic
1157953181 18:52063865-52063887 GAGGAGCCTTTCCCATGGAGGGG - Intergenic
1160204906 18:76823754-76823776 GAACGGACTTTCCTGCGCAGGGG + Intronic
1161543644 19:4867177-4867199 GAGGGGGCTTTGCGGTGGCGGGG + Intronic
1161643132 19:5436524-5436546 GAGGGGACCTTCCTGGGAGGGGG + Intergenic
1162100575 19:8336126-8336148 GAGGGGACTTTCCTGTGGAGTGG + Intronic
1162588579 19:11576577-11576599 CTGGGGAAGTTCCTGTGGAGGGG + Exonic
1162763082 19:12900069-12900091 GTGGGGACTTTCCCCTAGAGTGG + Exonic
1165435304 19:35791889-35791911 GAGGGGGCTTTCCCTGGGAGGGG + Intergenic
1166687987 19:44807515-44807537 GAGGGGACTTCCTGGAGGAGGGG + Intergenic
1168072555 19:53961018-53961040 GAGGGGATTTTCCGGGGCAGAGG + Intergenic
926466116 2:13190953-13190975 GAGGGGACTGTCGTGGGGTGGGG - Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928419942 2:31130540-31130562 GAGGGGACATCTCTGTGGTGTGG - Intronic
932122558 2:69115066-69115088 GAGGGGCCTGTCCTGTGCATTGG + Intronic
932368238 2:71166747-71166769 GAGGTGACTTTCTTGAAGAGTGG - Intergenic
932609906 2:73191180-73191202 GAGGACACTTTCCTCTGCAGAGG - Intergenic
933905445 2:86887862-86887884 CAGGGGAATCTCCTTTGGAGAGG - Intergenic
935331996 2:101984135-101984157 GAGGGAACTGTCCAGTGCAGAGG + Intergenic
935589068 2:104829075-104829097 GATGGAACTTTACTTTGGAGAGG - Intergenic
935766279 2:106371028-106371050 CAGGGGAATCTCCTTTGGAGAGG - Intergenic
936366713 2:111863784-111863806 CAGGGGAATCTCCTTTGGAGAGG + Exonic
936921415 2:117692357-117692379 GAGGGGATTTTTCCCTGGAGAGG - Intergenic
937267480 2:120625552-120625574 GAGGGGCCTTCCATGTAGAGGGG - Intergenic
938683167 2:133712598-133712620 GAGGGGACACTCCTGAGGAGGGG - Intergenic
943191054 2:184680287-184680309 GGGAGGACTTGCCTATGGAGAGG + Intronic
943191065 2:184680357-184680379 GGGAGGTCTTGCCTGTGGAGAGG + Intronic
943906253 2:193503321-193503343 GAGGGGACTGTCCTGTAGTATGG + Intergenic
946722430 2:222624131-222624153 GAGAGGCATTTGCTGTGGAGAGG - Intronic
947625315 2:231614909-231614931 GAGCCCACTTTCCCGTGGAGGGG - Intergenic
948046688 2:234951400-234951422 GAGGAGAGTTTCCTGCGAAGCGG - Intergenic
1169781525 20:9315557-9315579 GAGGGGACATTGCTGTGGGTTGG + Intronic
1170306226 20:14941282-14941304 GAGCAGAGTTTCCTGGGGAGGGG + Intronic
1171235699 20:23522708-23522730 GATGGCACTTTCCTGTAAAGAGG - Intergenic
1172182225 20:33010601-33010623 GAGGGGACGTCCCTTGGGAGGGG - Intronic
1173440309 20:43069614-43069636 GAAGAGACTTTGCTGGGGAGGGG + Intronic
1174559936 20:51423823-51423845 GAAGGGACTTTCTTGTGGTTTGG + Intronic
1174733425 20:52940526-52940548 GAGGGGACTTGGGTGTGGAATGG - Intergenic
1175501411 20:59453553-59453575 GTGGGGAATTCCCTGTGGTGTGG + Intergenic
1175722629 20:61296532-61296554 GTGGGGACGTTTCTGTGGGGAGG - Intronic
1175761077 20:61562400-61562422 AGGGGGACCTTCGTGTGGAGAGG + Intronic
1176157133 20:63627438-63627460 GAGGGGACTCCCCTGCGGGGCGG + Intergenic
1179543949 21:42101870-42101892 GAGGGTCCTTTCCCGTGGGGTGG - Intronic
1179786683 21:43734224-43734246 GACGGGGCTTTCGTGTGGACGGG + Intronic
1180353448 22:11821884-11821906 GAGGGCACTTTCGTCTGTAGGGG + Intergenic
1181130266 22:20727162-20727184 GAGGGGTCTTACCTGGTGAGAGG - Intronic
1181588517 22:23868029-23868051 GAGGGGACAGTCTTGTGGAATGG + Intronic
1181641289 22:24200867-24200889 GAGGGGACATACCAGTGCAGTGG - Intergenic
1183101278 22:35585641-35585663 GAGTGGGCTTTCCTGTGGGGTGG - Intergenic
1183979649 22:41532028-41532050 GTGGGGACCTTCCTTTGGAGAGG + Intronic
1184119250 22:42439819-42439841 CAGGGGAGTTTCCTGGGGAGGGG - Intergenic
1184282647 22:43447029-43447051 CAGGTGACTTTCCTGTGTAATGG + Intronic
1184555051 22:45228668-45228690 GAGGGATCTTTCCGGTGAAGAGG - Intronic
1185172370 22:49301530-49301552 TAGGGGAGTTTCCTGAGAAGTGG - Intergenic
950008594 3:9706358-9706380 GGGGGAGCTTCCCTGTGGAGAGG - Intronic
950558167 3:13707426-13707448 GAGGGGACCCTCGTGTGGAGAGG + Intergenic
950559133 3:13711883-13711905 GAGGGGACCTTTATGTGGGGAGG + Intergenic
952991766 3:38836691-38836713 CAGAGGACATTCCAGTGGAGGGG + Intergenic
954213283 3:49110253-49110275 GGCGGAACTCTCCTGTGGAGAGG - Exonic
954855117 3:53637581-53637603 GAGTGGAATTGCCTGTGGAAAGG + Intronic
955429928 3:58832127-58832149 GAGGGGACTTGCATGTGCACAGG - Intronic
957392434 3:79594117-79594139 TAGGGGACTTTCTTGTTGAGAGG - Intronic
958842795 3:99228505-99228527 GAGAAGACTTTCCTGTGGCTTGG + Intergenic
959109897 3:102110478-102110500 GAGGGGACTAACATTTGGAGTGG + Intronic
959860236 3:111207822-111207844 CAGGGGAGTTTCCTGTGATGTGG - Intronic
960354963 3:116640325-116640347 TAGAGGACTTTCCAGGGGAGGGG - Intronic
960518454 3:118628161-118628183 GAGGGAAATTTAATGTGGAGAGG - Intergenic
960873701 3:122276007-122276029 GAGGAGAAAATCCTGTGGAGTGG + Exonic
962469091 3:135689226-135689248 GAGAGGACTTTCCTTTTGTGAGG + Intergenic
964372746 3:156018034-156018056 GAGATGACCTTCCTGTGGAAGGG + Intergenic
964691783 3:159458290-159458312 GAGTGGACTTTTCTCAGGAGAGG - Intronic
966913663 3:184573181-184573203 GTGGGGACTGTCCTGGGGAAAGG + Intronic
968867010 4:3219511-3219533 GAGAGGGCTTTCCTGTGGTGAGG + Intronic
968869593 4:3234943-3234965 GAGGGGACTGGCCTGGGGTGTGG + Intronic
969249835 4:5959910-5959932 GAGCGGGCGTTCCTGTAGAGTGG + Intronic
970368972 4:15389103-15389125 CAGGGGACTTTGCTGATGAGCGG + Intronic
971696978 4:29917693-29917715 CAGGGCACTTTCTAGTGGAGTGG - Intergenic
973631681 4:52825902-52825924 GATGGGATGTTCCTGTGGAAAGG - Intergenic
973845057 4:54903303-54903325 GAGGAGACTTTCCTGTTGGGTGG - Intergenic
975963961 4:79946563-79946585 GAGGGGAATTTCCTGAAGAGGGG + Intronic
976133448 4:81909368-81909390 GAGGAGAGTTTGCGGTGGAGTGG + Intronic
976317647 4:83676002-83676024 GAGGGTTCTGTGCTGTGGAGGGG + Intergenic
977802910 4:101259445-101259467 GTGGGGACTGGTCTGTGGAGTGG - Intronic
980254818 4:130365397-130365419 GAAGGGACCTTGCTGTTGAGAGG - Intergenic
984340439 4:178450091-178450113 TAAGTGACTTTCCTGTGTAGGGG + Intergenic
987041630 5:14068423-14068445 GAGAGGAATTTCCCTTGGAGTGG - Intergenic
989207803 5:38828923-38828945 CAGGGAACTTTCCTGTGCTGTGG - Intergenic
998231167 5:140362218-140362240 GAAGGGTCTTTACTGAGGAGGGG + Intronic
998415256 5:141941358-141941380 GAAGGGCCTCTCCTGTGGAAAGG + Exonic
1000490079 5:161901880-161901902 TAGGAGACTTACCTGGGGAGTGG + Intergenic
1001190631 5:169627517-169627539 GAAGGGACTTTACTATGGATAGG + Intergenic
1001688524 5:173614771-173614793 GAGGGGACTACCCTCTTGAGCGG - Intronic
1002662675 5:180802543-180802565 GAGGGGGCTTGGCTGGGGAGCGG - Intronic
1006202151 6:32303562-32303584 GAGGTGACTTTCTTGTAGATAGG + Intronic
1006260149 6:32861153-32861175 GAGGGGCCCCTCCTGGGGAGTGG + Intergenic
1006397089 6:33794698-33794720 GAGGGGAATTTGCTTTGGAAAGG + Exonic
1006470235 6:34224426-34224448 AAAGGGACTGCCCTGTGGAGGGG - Intergenic
1008304832 6:49888319-49888341 GAGGGGACATGCCTGTGAATTGG + Intergenic
1008943560 6:57072991-57073013 GAGGGGACATGCCTGTGAATTGG - Intergenic
1015671069 6:135690087-135690109 GAGGAAAGTTTCATGTGGAGAGG - Intergenic
1016874524 6:148851687-148851709 GACTGGGCTTTCCTGTGGTGAGG + Intronic
1019307180 7:341260-341282 GAGGGGACGCCCCTCTGGAGTGG - Intergenic
1019370376 7:660112-660134 GAGGGAACTGTCCTGGGGAGGGG - Intronic
1023818611 7:43968282-43968304 GAGGGGAGATTCCTGGAGAGAGG + Intergenic
1024045131 7:45580618-45580640 GAGGCGGCTTCCCTGTGGACTGG + Intronic
1024879782 7:54072033-54072055 AAGAGGACGTTCATGTGGAGAGG - Intergenic
1028601724 7:92608299-92608321 CAGGGGATTTTCATGTTGAGAGG - Exonic
1029650378 7:101887145-101887167 GAAGGGGCTTTGCTGGGGAGGGG + Intronic
1031717435 7:125125998-125126020 GAGTGCATTTTCCTGTGGATGGG + Intergenic
1035737252 8:1897937-1897959 GAGGGGGCTGTGCAGTGGAGAGG - Intronic
1036172774 8:6506328-6506350 GAGTGGTCTTGCCTGTGAAGAGG - Intronic
1036294562 8:7525501-7525523 GAGGTGACTTTCATTTAGAGAGG - Intergenic
1036328000 8:7795490-7795512 GAGGTGACTTTCATTTAGAGAGG + Intergenic
1041356013 8:57001116-57001138 GATGGTACTTTCCTTTGCAGAGG + Intergenic
1042329862 8:67567561-67567583 TAGTTGATTTTCCTGTGGAGGGG - Intronic
1042815034 8:72868915-72868937 GAAGAGACTTTCCTGTTGAAGGG - Intronic
1046775406 8:118158793-118158815 GGGATGACTTACCTGTGGAGAGG + Intergenic
1049703036 8:144023660-144023682 GAGGGGAGTTTCAAGGGGAGAGG - Intronic
1049703270 8:144024470-144024492 GAGGGGAGTTTCAAGGGGAGAGG - Intronic
1051823843 9:21197216-21197238 GAGTGGAATTGCCTGTGGAAAGG + Intergenic
1055309517 9:74964370-74964392 GAGGGGGCTCTCCTGTGGTTAGG - Intergenic
1056662277 9:88553022-88553044 GATGGGTTTTTCATGTGGAGTGG - Intronic
1056731513 9:89170046-89170068 TAGGGGCCTTTCCTGCTGAGTGG + Intronic
1057819124 9:98317781-98317803 GAGGGTACATTCCAGTGGAACGG + Intronic
1058176265 9:101738790-101738812 GAGAGGACTTTCCAGGGGCGCGG - Intergenic
1059423303 9:114205938-114205960 GAGGGGGCTTTCCAGGGGACTGG + Intronic
1059698978 9:116757049-116757071 GAGGGGACTGGCCTGTGGACAGG - Intronic
1060032128 9:120224032-120224054 GAGAGGCCTCTCCTATGGAGAGG - Intergenic
1060256627 9:122036271-122036293 GAGGGGGCTTTCTGCTGGAGAGG - Intronic
1060511871 9:124240392-124240414 GAGAGGTGTTTCCTGTGGACTGG - Intergenic
1062083441 9:134636538-134636560 GAGGGCAATTTGCTGTGGGGAGG + Intergenic
1185761035 X:2690468-2690490 GACGGGGGTTGCCTGTGGAGCGG + Intergenic
1189475767 X:41354294-41354316 GATGGAACTGTTCTGTGGAGGGG - Intronic
1192615850 X:72621283-72621305 GAGGGGACTTTGGTGAGGAAGGG + Intronic
1192784283 X:74322190-74322212 GAGGGATCTTTCCTGAGCAGGGG - Intergenic
1194174521 X:90629666-90629688 CATGGGACTTTCTTGGGGAGAGG - Intergenic
1194486670 X:94494688-94494710 GAGGGGACTTGCCTGTGAGCTGG - Intergenic
1195405538 X:104509040-104509062 GAGGGGACTTACCTTAGGGGAGG + Intergenic
1197038983 X:121911552-121911574 AAGGGGAGTTTCTTGTGGATAGG + Intergenic
1202191591 Y:22251465-22251487 GAGGGGACATGCCTGTGAACTGG + Intergenic
1202258692 Y:22946636-22946658 GAGGGGACTTACCTGTGAGCTGG - Intergenic
1202411681 Y:24580394-24580416 GAGGGGACTTACCTGTGAGCTGG - Intergenic
1202459101 Y:25089678-25089700 GAGGGGACTTACCTGTGAGCTGG + Intergenic