ID: 1162101278

View in Genome Browser
Species Human (GRCh38)
Location 19:8340716-8340738
Sequence CTCCATTTCCCACTTCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 291}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162101268_1162101278 20 Left 1162101268 19:8340673-8340695 CCTCCTGACTCATTACCCTACTC 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 291
1162101266_1162101278 25 Left 1162101266 19:8340668-8340690 CCAGCCCTCCTGACTCATTACCC 0: 1
1: 0
2: 2
3: 25
4: 317
Right 1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 291
1162101275_1162101278 -2 Left 1162101275 19:8340695-8340717 CCACCGCTGGGGAAACCGTAACT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 291
1162101264_1162101278 29 Left 1162101264 19:8340664-8340686 CCCACCAGCCCTCCTGACTCATT 0: 1
1: 2
2: 4
3: 92
4: 1272
Right 1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 291
1162101265_1162101278 28 Left 1162101265 19:8340665-8340687 CCACCAGCCCTCCTGACTCATTA 0: 1
1: 0
2: 1
3: 20
4: 279
Right 1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 291
1162101269_1162101278 17 Left 1162101269 19:8340676-8340698 CCTGACTCATTACCCTACTCCAC 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 291
1162101267_1162101278 21 Left 1162101267 19:8340672-8340694 CCCTCCTGACTCATTACCCTACT 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 291
1162101276_1162101278 -5 Left 1162101276 19:8340698-8340720 CCGCTGGGGAAACCGTAACTCCA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 291
1162101273_1162101278 5 Left 1162101273 19:8340688-8340710 CCCTACTCCACCGCTGGGGAAAC 0: 1
1: 0
2: 2
3: 14
4: 180
Right 1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 291
1162101274_1162101278 4 Left 1162101274 19:8340689-8340711 CCTACTCCACCGCTGGGGAAACC 0: 1
1: 0
2: 2
3: 22
4: 227
Right 1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG 0: 1
1: 0
2: 0
3: 29
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162101278 Original CRISPR CTCCATTTCCCACTTCTGTC TGG Intronic
901652217 1:10749581-10749603 CCCCATTTCCCCCTTCAGCCAGG + Intronic
902735463 1:18397855-18397877 CTCCTTTCCCCAACTCTGTCTGG - Intergenic
903447103 1:23429520-23429542 CTCTATTTCCCCCGTCAGTCTGG - Exonic
903521677 1:23955441-23955463 TTCCATTTCACTCTTCTGGCAGG + Intergenic
904385174 1:30136465-30136487 TTCCAGCTCCCACTTCTCTCAGG + Intergenic
904566788 1:31433117-31433139 CTCCTTCTTCCACTTCTGCCTGG + Exonic
904913954 1:33956316-33956338 CTCCATTTCCCCCTCCTCCCAGG + Intronic
905842158 1:41190730-41190752 CCCCATATCACACTTCTGTAAGG - Intronic
906252390 1:44320591-44320613 CTCGCTTTCCCTCTTCTCTCTGG - Intronic
906260144 1:44380703-44380725 CTCCATTTCCCCATTGGGTCAGG - Intergenic
906939279 1:50241762-50241784 CTCCATTTCTTGTTTCTGTCAGG + Intergenic
908498330 1:64717846-64717868 CTCCATTTCAGACTTCTGGCCGG - Intergenic
908768150 1:67572510-67572532 CCCCATCACCCACTCCTGTCCGG + Intergenic
910523937 1:88155892-88155914 CTCCACTTCACACTACTGACTGG + Intergenic
910571828 1:88714046-88714068 CTCCATTTCTTGTTTCTGTCTGG + Intronic
911577097 1:99590743-99590765 CTCCATTTCACATTGCTGCCTGG - Intergenic
912108600 1:106312451-106312473 CCCCATTTCCTGCTTTTGTCTGG + Intergenic
912194645 1:107383222-107383244 CTCCATAGCCCTCTTCTATCAGG - Intronic
912452991 1:109778792-109778814 CTCCATTTGTCTCCTCTGTCTGG + Intergenic
912560302 1:110546758-110546780 CTGCCTAGCCCACTTCTGTCAGG + Intergenic
913599324 1:120407640-120407662 CTCCATTGCCCCTTTCTGCCAGG + Intergenic
914088054 1:144471977-144471999 CTCCATTGCCCCTTTCTGCCAGG - Intergenic
914310557 1:146462229-146462251 CTCCATTGCCCCTTTCTGCCAGG + Intergenic
914591550 1:149110912-149110934 CTCCATTGCCCCTTTCTGCCAGG - Intergenic
914953069 1:152135314-152135336 CTTCTTTTCCCACTTCTTTGAGG - Intergenic
916762486 1:167829903-167829925 CTCCATTGCACACTGCTTTCAGG + Intronic
916869091 1:168893005-168893027 CTCCATGTGTTACTTCTGTCTGG + Intergenic
917159656 1:172043272-172043294 CTCCATTTCCCTCATCTGATGGG - Intronic
917538112 1:175889084-175889106 CTCCATCTCCCATTTCAGTCTGG - Intergenic
918104965 1:181408969-181408991 CTCCATTTCCTATTTTTGCCAGG + Intergenic
918533980 1:185553903-185553925 CTTCCTTCCCCACTTCTCTCTGG + Intergenic
919131845 1:193460968-193460990 TTCCATTTCTCAGTTCTGTCTGG + Intergenic
921047615 1:211488718-211488740 CTGCGTTTCCCTCTTTTGTCTGG + Intronic
921277705 1:213535981-213536003 CTCCATTTCCCTCCTCTTCCAGG - Intergenic
921629820 1:217419849-217419871 CTCCATTTCCTAATCATGTCTGG - Intergenic
921997357 1:221435678-221435700 CCCCATTTCCCACTGCTTTCTGG + Intergenic
1063081607 10:2772892-2772914 TTCCAGATCCCACCTCTGTCGGG - Intergenic
1065649384 10:27871620-27871642 CCCCATTTCCTATTTTTGTCAGG + Intronic
1066307047 10:34155526-34155548 CTCCAATTCCCAAGTCTTTCTGG - Intronic
1068900700 10:62266781-62266803 CTCCAATTCCAACAGCTGTCTGG + Intronic
1070766425 10:79059159-79059181 CCCCATTTCCTGCTCCTGTCTGG - Intergenic
1072619410 10:97069625-97069647 CCTCATTTTCCATTTCTGTCTGG - Intronic
1073113307 10:101075783-101075805 CTCCACTTCCCACCTCTGTTAGG - Intergenic
1074180824 10:111061347-111061369 CTCCATGGCCCACTCCTGGCAGG - Intergenic
1075063658 10:119274307-119274329 CTCTATTTCCCAGTCTTGTCAGG - Intronic
1076112201 10:127869334-127869356 CTCCTTTTCACATTTCTTTCAGG + Intergenic
1077180124 11:1208551-1208573 CTCCCTTTCCCAGTTCTTGCAGG + Intergenic
1077730961 11:4729397-4729419 CCACATTTCCACCTTCTGTCAGG - Intronic
1078649110 11:13170769-13170791 CTGCATTTCCCACTGCTCTTTGG - Intergenic
1078978149 11:16501186-16501208 CCCCATTTCCTATTTTTGTCAGG - Intronic
1079574028 11:21980635-21980657 CTCTCTTTCTCTCTTCTGTCAGG + Intergenic
1080496665 11:32827600-32827622 CTTCATTTCCCACTACTTTGGGG - Intergenic
1081592647 11:44435540-44435562 CTCCCCTTCCCACTTCTGCTGGG + Intergenic
1081601587 11:44498928-44498950 GTACATTTCCCACTTCTCTCTGG - Intergenic
1082118266 11:48350847-48350869 CCCCATTTCTCATTTTTGTCAGG - Intergenic
1083135650 11:60673585-60673607 CCCCTTTTCCCATTTCTCTCTGG + Intergenic
1083181268 11:60987336-60987358 CCAAATTTCCCACTTCTGTGAGG + Intronic
1083522606 11:63329355-63329377 CCCCATTTCCTATTTTTGTCAGG + Intronic
1083830224 11:65226835-65226857 TCCCATCTCCCATTTCTGTCAGG + Intergenic
1087056685 11:93943894-93943916 CTCCATTTCTGCCTTATGTCTGG + Intergenic
1088769398 11:113018330-113018352 TTTCATTCCCCACTTCTTTCAGG - Intronic
1088885027 11:113999479-113999501 CACCATCTCCCGCTTGTGTCTGG + Intergenic
1089193288 11:116671578-116671600 CTCCATTTCTTATTTTTGTCAGG - Intergenic
1089255191 11:117190396-117190418 CTCCCCTCCCCAGTTCTGTCTGG + Intronic
1089644211 11:119867462-119867484 CTCCATTTCCCCCTCCTCCCAGG - Intergenic
1089700396 11:120240782-120240804 CTCCATTTCACACATATGCCCGG - Intronic
1090487896 11:127130690-127130712 CTACATTTCCTCCTTCAGTCTGG - Intergenic
1091216102 11:133903092-133903114 TTCCTTTCCCCACTTCTGTATGG - Intergenic
1091341099 11:134814641-134814663 CTCCATGGCCCACTTCTGGAAGG + Intergenic
1092742531 12:11643934-11643956 CTCCTCTTTCCACTTCAGTCAGG - Intergenic
1093037664 12:14348035-14348057 CTCCATTCCCCACTTCCCCCAGG + Intergenic
1093777247 12:23090214-23090236 CCCCATTTCTCATTTTTGTCAGG + Intergenic
1094524632 12:31223362-31223384 CTCTATTTCCCTCTTCAGCCAGG - Intergenic
1096699313 12:53371657-53371679 GTCCTTTTCCCACACCTGTCTGG + Intergenic
1096753166 12:53776220-53776242 CTCCTGTTCCCACCTCTGTCTGG + Intergenic
1097180710 12:57170185-57170207 CCCCATTTCCCCTTTCTGTGAGG + Intronic
1097278836 12:57831882-57831904 TTCCATTACCCACTTCTGCAAGG - Intronic
1098540885 12:71655912-71655934 ATCCATTTCCCAATTATGTTTGG - Intronic
1101004092 12:100384788-100384810 CTCCATTCAGCACTTCTGGCAGG - Intronic
1101779095 12:107819495-107819517 CTCCATCTCCCACTTATCTTTGG - Intergenic
1101847708 12:108375908-108375930 CTCTAATTCCAACTTCTGCCAGG + Intergenic
1103749115 12:123147147-123147169 CTTCAAGTCCCACTTCTTTCAGG + Intronic
1103930963 12:124450605-124450627 CTCCCTTTCTCACTGCTGTGTGG - Intronic
1106544789 13:30721031-30721053 CTCCATTTCCCCCATGTGTGTGG - Intronic
1106721890 13:32443281-32443303 ATCCATTGCCCCCTGCTGTCAGG + Exonic
1107358480 13:39593842-39593864 CCCCATTTCTCATTTTTGTCAGG - Intronic
1107395183 13:40008000-40008022 CTCCATTGCTCATTTTTGTCAGG + Intergenic
1109314334 13:60732520-60732542 CTGCATGCCCCTCTTCTGTCTGG + Intergenic
1110534925 13:76639765-76639787 CACCATTTCCAACCTCTGCCTGG - Intergenic
1110565550 13:76954322-76954344 GTGCATTTCCCACTGCTTTCAGG - Intronic
1110635294 13:77760671-77760693 TTCCATTTCTCAGTGCTGTCTGG + Intronic
1111864028 13:93745309-93745331 CACCATTTCCTTCTTCTGCCTGG + Intronic
1112580171 13:100671672-100671694 CATCATTTCCCAGTTCTGGCTGG + Intronic
1114246616 14:20920383-20920405 CTCCATTTCCCACAAGTCTCGGG - Intergenic
1114258614 14:21022357-21022379 ATTCATCTCCCACTCCTGTCTGG - Intronic
1115673585 14:35644472-35644494 CCCCCTTTCCCACTTCAGTATGG - Intronic
1116175090 14:41459075-41459097 CCCCAATACCCAGTTCTGTCTGG + Intergenic
1116196855 14:41738222-41738244 CTCCATTGCTCACTTTTGTCAGG - Intronic
1116486433 14:45454542-45454564 CTCCATTCCCCACTCCTTTTGGG + Intergenic
1119113708 14:71998760-71998782 CTCCATTTCACACTCCTTTTAGG - Intronic
1123979894 15:25591517-25591539 ATCCTTTTCCCACGTCTGTTGGG + Intergenic
1127527509 15:59808212-59808234 CTCCATTTCTTGCTTTTGTCAGG - Intergenic
1127570480 15:60236494-60236516 CTCCAGTTCCCCCTTCTCTGAGG - Intergenic
1129258112 15:74345709-74345731 TCCCATTACTCACTTCTGTCGGG + Intronic
1130082845 15:80749613-80749635 CTCCATTCCCCTCTGATGTCTGG + Exonic
1132436120 15:101804353-101804375 ATTCATTTCCCATTTCTGTTGGG + Intergenic
1132866068 16:2093325-2093347 CTCCAATGCCCACTCCTGCCTGG - Intronic
1132870708 16:2114607-2114629 CGCCATTGCCCACCTCTGCCCGG + Exonic
1133599737 16:7327413-7327435 TTCCATTACCCACTTTTGTCTGG + Intronic
1133786417 16:8977169-8977191 CCCCATTTCTTGCTTCTGTCAGG + Intergenic
1134521823 16:14922297-14922319 CGCCATTGCCCACCTCTGCCCGG - Intronic
1134709493 16:16320948-16320970 CGCCATTGCCCACCTCTGCCCGG - Intergenic
1134716706 16:16360977-16360999 CGCCATTGCCCACCTCTGCCCGG - Intergenic
1134876359 16:17702526-17702548 CTTCATTTCCTACTCCTCTCAGG - Intergenic
1134950110 16:18347697-18347719 CGCCATTGCCCACCTCTGCCCGG + Intergenic
1134958044 16:18391182-18391204 CGCCATTGCCCACCTCTGCCCGG + Intergenic
1136232601 16:28895431-28895453 CTCCATTAAGCACTTCTCTCTGG + Intronic
1136239133 16:28933381-28933403 CTCCATTACCCACATATCTCTGG - Exonic
1136284882 16:29234816-29234838 TTCTGTTTCCCACTTCTTTCAGG + Intergenic
1136603514 16:31314494-31314516 CCCCATTTCCTGCTTTTGTCAGG + Intronic
1137547290 16:49413170-49413192 CTCCTTTTGCCACTGCTGTAGGG + Intergenic
1139094157 16:63684543-63684565 TCCCAGTTCCCACTTCTGTATGG + Intergenic
1140782277 16:78307523-78307545 ATCCATTTCTCACCTCTTTCAGG - Intronic
1141039577 16:80661337-80661359 CTCCATTTCACACTGTTGTGGGG - Intronic
1142089943 16:88204440-88204462 TTCTGTTTCCCACTTCTTTCAGG + Intergenic
1142137139 16:88456642-88456664 CTCAGTTTTCCACTGCTGTCGGG + Intronic
1144622879 17:16829744-16829766 TCCCATTTCCCACATCTCTCAGG + Intergenic
1144845891 17:18218868-18218890 ATCCATTGCTCCCTTCTGTCTGG + Intergenic
1144883552 17:18442972-18442994 TCCCATTTCCCACATCTCTCAGG - Intergenic
1145148676 17:20501414-20501436 TCCCATTTCCCACATCTCTCAGG + Intergenic
1146269085 17:31472729-31472751 CTCCATCCCTCACTTCTGTCTGG - Intronic
1146956856 17:36940972-36940994 CTCCATCTCTCACTTCTCTCTGG - Intronic
1147577202 17:41609679-41609701 TCCCATTTCCCACATCTCTCAGG + Intergenic
1147971933 17:44222751-44222773 TTCCACATCCCACTTCTATCAGG + Intergenic
1148054831 17:44787722-44787744 CCACAGTTCCCACTGCTGTCCGG + Intergenic
1148069879 17:44902493-44902515 GTCCAAATCCCACATCTGTCTGG - Exonic
1148120503 17:45207204-45207226 CTACATTTTCCTCTTCTGGCTGG + Intergenic
1151775055 17:76195172-76195194 CTCCATTTCCTAAGCCTGTCTGG - Intronic
1152233366 17:79125833-79125855 CTCCCTTCCCCATTTCTGCCTGG - Intronic
1153499051 18:5729866-5729888 CTCCCTTTTCCACTTCTCTTAGG + Intergenic
1153614528 18:6921929-6921951 ATCCCTTTCCAACTTCTTTCTGG - Intergenic
1155910578 18:31499974-31499996 CTGCATTGCCCACTACTCTCTGG - Intronic
1158185756 18:54769303-54769325 CTCCACGTCTCACCTCTGTCTGG + Intronic
1158261387 18:55609813-55609835 CTCCTTTTCCTACCTCTGTTGGG + Intronic
1158924764 18:62244335-62244357 CCACTTTTCCCACTTCTGTAAGG - Intronic
1160189090 18:76700143-76700165 CTGCATTCCACACTTCTGCCTGG - Intergenic
1161867805 19:6847635-6847657 CTCCTTCCCCTACTTCTGTCCGG + Intronic
1162101278 19:8340716-8340738 CTCCATTTCCCACTTCTGTCTGG + Intronic
1164725628 19:30463934-30463956 CTCCATGTCCAACTTCTCCCTGG + Intronic
1165357668 19:35313669-35313691 CTCCTTTACCCTCATCTGTCTGG + Exonic
1166539629 19:43596511-43596533 GTCCCTATCCCACTTCTCTCTGG + Intronic
1168093369 19:54100398-54100420 CCCCATTTCCCTCTTCTCTCAGG + Intronic
925636223 2:5943276-5943298 CTCCACTTCCCACTTGTTACCGG + Intergenic
926783938 2:16501488-16501510 CTGCATTTGCCACTGCTGCCTGG + Intergenic
926817705 2:16816239-16816261 CTTCATCTCCCACATCTATCAGG + Intergenic
927047537 2:19295020-19295042 GTCCCTTTCCCACTCATGTCAGG + Intergenic
927403077 2:22736395-22736417 CTCCATTTCCCTCTCATTTCAGG + Intergenic
930337337 2:50065821-50065843 CTCCATTTCCAACGTGTTTCTGG - Intronic
931119623 2:59201608-59201630 ACCCATCTCCCACTTCTGTGAGG + Intergenic
931285845 2:60830894-60830916 CTCCATTCCACACTCCTCTCTGG - Intergenic
934924231 2:98370608-98370630 TTCCATTTCCTACCTGTGTCAGG - Intronic
938084496 2:128389855-128389877 CTTCATTTCCCAGTTTTGTTTGG + Intergenic
938300434 2:130207473-130207495 CTCCATATCCCTGTTTTGTCTGG - Intergenic
938405373 2:131029930-131029952 CTCCATGCCCCACATCTGACAGG - Intronic
939884918 2:147671097-147671119 CTCCATTCTCCACTTCTTCCAGG - Intergenic
941534807 2:166708892-166708914 CTTCATTTCCCTCTTCTGAGTGG - Intergenic
941623538 2:167805592-167805614 CCCCATTTCTCATTTTTGTCAGG + Intergenic
941641126 2:167989561-167989583 CTCTATCACCCACTGCTGTCTGG - Intronic
943101252 2:183489495-183489517 CTGCATTCTCCACTTCTGTTAGG + Intergenic
944858144 2:203787843-203787865 CCCCATAACCCACTTCTGTCAGG + Intergenic
945311440 2:208318147-208318169 CTCCCCTTCCTCCTTCTGTCTGG - Intronic
946136295 2:217650352-217650374 CTCCTTTTCCCACATCTTCCTGG + Intronic
946471483 2:219964859-219964881 CTCCAGTTCCCACTTGTGAAGGG + Intergenic
946493361 2:220171316-220171338 TCCCATTTCCCACTTCTATTGGG - Intergenic
947134361 2:226962434-226962456 CTCCTTTTCACAGTTCTGTCAGG - Intronic
1170001937 20:11624500-11624522 ATTCATTTCCCACTTTTGTCAGG - Intergenic
1170504385 20:17009924-17009946 CTCCATCTCCTTCTGCTGTCTGG + Intergenic
1171137941 20:22714132-22714154 CTCCATTGCCTATTTTTGTCAGG + Intergenic
1171387539 20:24780316-24780338 CTCCAGCTCCCAATTCTTTCTGG + Intergenic
1172184243 20:33021386-33021408 CTCCATATCCCACATCTGCTCGG + Intronic
1172745741 20:37207251-37207273 CTGCATTTCGCATTTCTTTCAGG + Exonic
1173855700 20:46249314-46249336 CACCATCTCCCACACCTGTCTGG + Intronic
1174045010 20:47727236-47727258 CCAAATTTCCCTCTTCTGTCAGG - Intronic
1175473264 20:59249304-59249326 CTCCATTTCTCATTAGTGTCTGG + Intronic
1178362662 21:31962276-31962298 CTCCTTTTCCCACAGCTGTGTGG - Intronic
1179040713 21:37800100-37800122 CTCCATTTCCAACTTCTTCCAGG - Intronic
1182105317 22:27685031-27685053 CCCTAATTCCCACTTCAGTCAGG + Intergenic
1184048064 22:41984429-41984451 CTGCATTTCCTACTAGTGTCCGG + Intronic
1184097766 22:42325737-42325759 CTCCACTTCCCAGCTCTGGCAGG - Intronic
1184472739 22:44704823-44704845 CTCCATCTCCCACATCTGCTGGG - Intronic
949828509 3:8187907-8187929 CACCAATTCCCTCTTCTATCTGG - Intergenic
949956581 3:9274291-9274313 CTCCAGTTCCCACTTGTGAAGGG - Intronic
950599637 3:14021490-14021512 CTCCTTTGCCCACTTCTTTATGG + Intronic
950902202 3:16508095-16508117 GTTGATTTCCCACTTCTGGCTGG + Intronic
952511789 3:34065686-34065708 CTCCATTTCCCACTCCATACTGG + Intergenic
953950148 3:47183315-47183337 CTACAACTCCCACCTCTGTCTGG + Intergenic
954792185 3:53141664-53141686 TGCCATTTCCCAATTCTGACGGG + Intergenic
954828372 3:53396005-53396027 CCCCATTTCTTGCTTCTGTCAGG - Intergenic
954836065 3:53469226-53469248 CTCCATTTCTTGTTTCTGTCAGG + Intergenic
955466499 3:59242860-59242882 CTCCATTTCCTACCTCTTCCTGG + Intergenic
955841524 3:63117870-63117892 CTTCCTTTCCTGCTTCTGTCTGG + Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
959490918 3:106987748-106987770 CTCCTTCACCCACTTCTGTAAGG - Intergenic
959920325 3:111861501-111861523 CTCATTTTTCCACTTCTGACAGG - Intronic
960952593 3:123009268-123009290 CTCCATTCCTCACTTCCTTCTGG + Intronic
962486465 3:135847502-135847524 CCCCCTTTCACACTTCTGCCAGG + Intergenic
962915084 3:139894042-139894064 CTCCCTTCCCCACTTCTGTTTGG + Intergenic
965011561 3:163099333-163099355 GTCCTTTTCCCACTTTGGTCTGG + Intergenic
965218943 3:165901609-165901631 CCCCATTTCTCATTTTTGTCAGG + Intergenic
965982202 3:174706901-174706923 CCCCATTTCTCATTTTTGTCAGG + Intronic
965994426 3:174862451-174862473 GTCCATTTCCTACTTCTCCCAGG + Intronic
966755736 3:183369640-183369662 GTCCATTTCCAGCTTCTGGCAGG + Intronic
968846012 4:3041907-3041929 ATCCATTCTCCACTGCTGTCAGG + Intergenic
969859586 4:10025042-10025064 CTCCATTTCACACCTCTGTGGGG + Intronic
970325586 4:14920229-14920251 CTCCCTTTCCCACTCCTCTCTGG - Intergenic
970349309 4:15185418-15185440 TTCCATTTCCCAGTTGGGTCTGG + Intergenic
970800106 4:19963178-19963200 CTCCATTTCCTAATGCTGTGGGG + Intergenic
970875888 4:20869590-20869612 GTCTATTTCCCACCTCTGGCTGG + Intronic
971877944 4:32328406-32328428 CTCCAAATCCCACCTTTGTCTGG - Intergenic
972879940 4:43410506-43410528 CTACAATGGCCACTTCTGTCTGG - Intergenic
973701642 4:53543204-53543226 CTCCCTTCCTCACTTCTTTCTGG + Intronic
976220514 4:82753488-82753510 GTCCATTTCCCACATCTGCCAGG + Intronic
976656802 4:87497279-87497301 CTCCTTTTCCCCCTTCTTTAAGG - Intronic
977106320 4:92889992-92890014 CTCCATTGCCTATTTTTGTCAGG - Intronic
977755530 4:100667210-100667232 CCCCATTTCTCATTTTTGTCAGG + Intronic
979565595 4:122151406-122151428 TTCCATAAACCACTTCTGTCTGG + Intergenic
979671101 4:123360997-123361019 CTTCCTTACCCACCTCTGTCAGG + Intergenic
981740966 4:148001179-148001201 CCCCATTTCCTATTTTTGTCAGG + Intronic
982722536 4:158873953-158873975 CTCCTTTTTCCTCTTGTGTCTGG + Intronic
982925617 4:161334047-161334069 CTCCATTCCACAGTCCTGTCTGG + Intergenic
983065740 4:163208202-163208224 CTCCATTTCCTGTTTTTGTCAGG + Intergenic
983112757 4:163773214-163773236 CTCCTCTCCCCATTTCTGTCAGG - Intronic
983926966 4:173412936-173412958 CTCAATTTCCCCCATCTGTCAGG + Intergenic
986475684 5:8129307-8129329 CTCCCCTTCCCAATTCTTTCTGG + Intergenic
988971715 5:36475173-36475195 CCCCATTTCTCATTTTTGTCAGG - Intergenic
989466720 5:41765110-41765132 ATGCATTTCCCGCTTATGTCAGG - Intronic
989990268 5:50755445-50755467 CCCCATTTCTCACTTTTGTCAGG + Intronic
990145662 5:52757304-52757326 CCCCATTTCTCAATTCTGGCTGG + Intergenic
990772448 5:59264165-59264187 CACTATGTCCCTCTTCTGTCTGG + Intronic
991407150 5:66311200-66311222 CTCCATTTCTTATTTTTGTCAGG + Intergenic
994578306 5:101609202-101609224 CTCCTTTTCCCTCCTCTGGCAGG - Intergenic
994999623 5:107110934-107110956 ATCCACTTCCCCCTTCTGTTAGG - Intergenic
995743328 5:115377534-115377556 CTCTTTCTCCCTCTTCTGTCTGG - Intergenic
995745783 5:115402026-115402048 CTCCATTTTCCACTTGTGAAAGG + Intergenic
995788810 5:115861257-115861279 CACATTTTCCCACTTCCGTCTGG - Intronic
995835647 5:116397030-116397052 CCCCTTTTCCCCCTTCTGGCTGG - Intronic
995894404 5:116995440-116995462 CTCCTTTCCCCACTTTTGTGTGG - Intergenic
995916305 5:117249273-117249295 TTGCATTTCTCACTTCTGCCAGG + Intergenic
996317997 5:122182884-122182906 GACCATTTCACACTTTTGTCAGG + Intergenic
998205466 5:140154164-140154186 CTCCCTTTCCCACCTCAGCCTGG - Intergenic
999717623 5:154374219-154374241 CGCCCTTTCCCACTTCTCTTTGG - Intronic
1000608785 5:163353382-163353404 GTTCATTTCCCTCTTCTGTTGGG + Intergenic
1002763618 6:220066-220088 CTCCAGTTCCCCATTCTGTGTGG - Intergenic
1003920085 6:10824796-10824818 CTCCTTGTCCCACTGCAGTCTGG + Intronic
1005286195 6:24329590-24329612 CTCCAATTCCCCATTCTGTTTGG - Intronic
1006823548 6:36917323-36917345 CATCATTTCCCACTTCAGTCTGG + Intronic
1007636989 6:43305620-43305642 TTCCCTTTCCCATTTCTATCTGG - Exonic
1008538109 6:52522915-52522937 TTACATTTCCCAGTCCTGTCTGG + Intronic
1011313521 6:86005962-86005984 CCCCATTTCTCATTTTTGTCAGG + Intergenic
1011557866 6:88588190-88588212 CTCCATTTCACACTTCCCACGGG + Intergenic
1012317605 6:97799498-97799520 CCCCATTTCTTATTTCTGTCAGG - Intergenic
1015656608 6:135525585-135525607 GCCCATTTCCCTCTTCTTTCAGG + Intergenic
1015816564 6:137217605-137217627 CTCCATTTCTTATTTCTGTCTGG - Intronic
1016183038 6:141170787-141170809 CTCCATTTCCCACCCATGACGGG - Intergenic
1016430803 6:143983309-143983331 CACAATTTCTCAGTTCTGTCTGG - Intronic
1020433044 7:8132813-8132835 CTCCAATTCCAAGTTCTTTCTGG + Intronic
1022801841 7:33784087-33784109 CTGGATTTCCCATTTCTGACAGG + Intergenic
1022964925 7:35463931-35463953 CTCCATTCCCCTCTGCTGTGTGG + Intergenic
1024137386 7:46424339-46424361 CTACACTCCCCACTTCTGTCAGG - Intergenic
1027415388 7:77968578-77968600 CTCCCTTCCTCACTTCTGTATGG + Intergenic
1029964075 7:104720267-104720289 CCCCATTTCTCATTTCTGTCAGG - Intronic
1032934542 7:136713647-136713669 CTTCATTTACCACTTCTGTTGGG - Intergenic
1033874191 7:145794211-145794233 CTCCAAATCCAATTTCTGTCAGG + Intergenic
1034122881 7:148643455-148643477 CTCCGTTTCCCACCACAGTCTGG + Intergenic
1034881263 7:154764368-154764390 CTCTCTTTCCCACTTCTTGCTGG - Intronic
1035523586 8:294348-294370 CTACAGTTGCCACTTCTGTTTGG - Intergenic
1038539664 8:28381781-28381803 TTCCATTTTCCGCTTCTGGCTGG - Intronic
1039743597 8:40404167-40404189 CTCTCTTTCCTAATTCTGTCTGG - Intergenic
1041260102 8:56013826-56013848 CTTTATTTTCCACTTCTGGCTGG + Intergenic
1044053508 8:87539509-87539531 CCCCATTTCTCGCTTTTGTCAGG + Intronic
1044378894 8:91509213-91509235 CTCCATTTACCATTTCTTGCAGG + Intergenic
1046436121 8:114191837-114191859 CCCCATTTCTCATTTTTGTCAGG - Intergenic
1046564210 8:115877940-115877962 CTCCCTTTCCCTCTTCTCTCTGG - Intergenic
1047282862 8:123460930-123460952 GCACATTTCACACTTCTGTCAGG + Intronic
1049612915 8:143563759-143563781 CAGCCTTCCCCACTTCTGTCAGG + Intergenic
1049919924 9:353646-353668 CTCCATCTGACAGTTCTGTCTGG + Intronic
1049994936 9:1025766-1025788 CTCCATGTCCCTCATCTTTCAGG + Intergenic
1050612629 9:7368901-7368923 CTGCATTTCCCACTGTTGTCTGG - Intergenic
1051249735 9:15147203-15147225 CTCCATTTCCTACCACTTTCAGG - Intergenic
1052690942 9:31816295-31816317 CTCCTTTATCCACTACTGTCAGG + Intergenic
1052842588 9:33305682-33305704 CTCCCATTCCTACTACTGTCAGG - Intronic
1052997571 9:34559422-34559444 CTCCATTCCCCAGGCCTGTCAGG + Intronic
1053265216 9:36707994-36708016 CTTCATTTCCCTTTTCTGGCTGG - Intergenic
1053517454 9:38743085-38743107 CTCCAATTCTCCCTTCTCTCAGG - Intergenic
1054729068 9:68682377-68682399 CTACATTTCCTTCTTCTGCCTGG - Intergenic
1054906949 9:70420397-70420419 TTCCAGTTCCCCCTTCTGTACGG + Intergenic
1056204389 9:84306151-84306173 CTCCTTCTCCCACTTGAGTCTGG + Intronic
1057129437 9:92642715-92642737 CTCCTTTGCCCCCTTGTGTCAGG - Intronic
1058954281 9:109931095-109931117 TTCACTTTCCCACTTCTTTCTGG + Intronic
1060720167 9:125971290-125971312 CTCCCTTTCCCAACTCTGTAGGG - Intergenic
1060786581 9:126455781-126455803 CTCAAATACCCACTTCAGTCAGG - Intronic
1061160155 9:128889164-128889186 CTCCATTACCCTCTTTTCTCAGG + Intronic
1062163200 9:135091156-135091178 CTCCACTCCCCACTTTAGTCAGG + Intronic
1062415638 9:136448237-136448259 CTACATGACCCACTTCTGTGAGG + Intronic
1185909595 X:3969808-3969830 CTCCCTTTCCCACTCCCTTCGGG - Intergenic
1189741284 X:44119501-44119523 ATCAATTTCCCACTTCAATCTGG + Intergenic
1192263558 X:69523649-69523671 CTCCTTTCCCCACCTCAGTCGGG - Intronic
1192588570 X:72340493-72340515 TTCCATTTCCCACTGGTGTTTGG - Intronic
1192703588 X:73503183-73503205 CTCCATTTCTTGTTTCTGTCAGG - Intergenic
1194250866 X:91573231-91573253 CCCCATTTCCTATTTTTGTCAGG - Intergenic
1195926343 X:110029453-110029475 CTCCACACCTCACTTCTGTCAGG - Intronic
1196553206 X:117055347-117055369 CTCCATTTCCAACTGCTTACTGG - Intergenic
1196990429 X:121322780-121322802 CCTCATTTCCTACTTCAGTCAGG - Intergenic
1197892638 X:131281583-131281605 CTCCCTTTCCCATATCTTTCTGG + Intronic
1199734670 X:150674277-150674299 ATACATTTCCCATTTCTCTCGGG - Intergenic
1200110544 X:153738564-153738586 CTCCGTCTCCCCTTTCTGTCAGG + Intronic
1200183981 X:154169852-154169874 CTCCGTCTCCCCTTTCTGTCAGG + Intergenic
1200189635 X:154206980-154207002 CTCCGTCTCCCCTTTCTGTCAGG + Intergenic
1200195388 X:154244789-154244811 CTCCGTCTCCCCTTTCTGTCAGG + Intergenic
1200201040 X:154281910-154281932 CTCCGTCTCCCCTTTCTGTCAGG + Intronic
1201582387 Y:15523846-15523868 CTCCATTTCCTGTTTTTGTCAGG + Intergenic