ID: 1162101350

View in Genome Browser
Species Human (GRCh38)
Location 19:8341031-8341053
Sequence ACACCCAAATCCCAGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 336}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162101344_1162101350 -3 Left 1162101344 19:8341011-8341033 CCTCCTCCGGTGACCTGGTCACA 0: 1
1: 0
2: 0
3: 24
4: 120
Right 1162101350 19:8341031-8341053 ACACCCAAATCCCAGGCCCTGGG 0: 1
1: 0
2: 3
3: 26
4: 336
1162101345_1162101350 -6 Left 1162101345 19:8341014-8341036 CCTCCGGTGACCTGGTCACACCC 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1162101350 19:8341031-8341053 ACACCCAAATCCCAGGCCCTGGG 0: 1
1: 0
2: 3
3: 26
4: 336
1162101346_1162101350 -9 Left 1162101346 19:8341017-8341039 CCGGTGACCTGGTCACACCCAAA 0: 1
1: 0
2: 1
3: 14
4: 161
Right 1162101350 19:8341031-8341053 ACACCCAAATCCCAGGCCCTGGG 0: 1
1: 0
2: 3
3: 26
4: 336
1162101341_1162101350 22 Left 1162101341 19:8340986-8341008 CCGTATGACGCAATGGGGTCAGC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1162101350 19:8341031-8341053 ACACCCAAATCCCAGGCCCTGGG 0: 1
1: 0
2: 3
3: 26
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162101350 Original CRISPR ACACCCAAATCCCAGGCCCT GGG Intronic
900894405 1:5473300-5473322 ACGCCCACAGCCCAGGCTCTGGG - Intergenic
901173528 1:7281960-7281982 ACACAGAAAGCCCTGGCCCTGGG - Intronic
902633212 1:17718173-17718195 ACACCCCAAAGCCTGGCCCTTGG - Intergenic
902784336 1:18723242-18723264 ACACCCCACCCCCAGGGCCTCGG - Intronic
902797752 1:18810372-18810394 ACCCCCAATCCCCAGGCCCCAGG + Intergenic
902934440 1:19754612-19754634 ACAGCCTAATCCCAGGCTCCTGG - Intronic
903356189 1:22749279-22749301 ACACCCTAATCCCAGTACTTTGG - Intronic
904202924 1:28833321-28833343 AGACCCAAAGCCCACGCTCTAGG - Intronic
906268045 1:44449672-44449694 ATACCCCAATCCCAGCCCTTTGG - Intronic
908247764 1:62241563-62241585 CCGACCAAATGCCAGGCCCTGGG - Intronic
910795256 1:91091363-91091385 AGACCCAAAGCCCTGACCCTAGG - Intergenic
911160941 1:94682904-94682926 CCTCCCAATTCCCAAGCCCTAGG - Intergenic
912511302 1:110192030-110192052 ACCACCAAAGCCCAGGCCCAAGG - Exonic
916058146 1:161082066-161082088 ACACCCTAATCCCAGCACTTTGG + Intronic
916067088 1:161144846-161144868 ACTCCCAAATCCCAGCACTTTGG + Intergenic
916352446 1:163866556-163866578 ACACCCAACACCCAGGCACTAGG + Intergenic
917488097 1:175473616-175473638 CCACCCAAATCCCATGTCCAAGG - Intronic
921191242 1:212710580-212710602 CCATCCACTTCCCAGGCCCTGGG - Intergenic
921280272 1:213559659-213559681 ATACTAAAGTCCCAGGCCCTCGG - Intergenic
921637136 1:217509716-217509738 ACACTCAAATCATAGGCTCTCGG - Intronic
922981821 1:229833463-229833485 ACCCCAAAATCCTATGCCCTGGG + Intergenic
923033399 1:230267482-230267504 ACACACAGACGCCAGGCCCTGGG - Intronic
923479609 1:234371164-234371186 ACACACAAATCCCAGGTACGTGG - Intergenic
923717507 1:236437552-236437574 ACAACCCAAATCCAGGCCCTTGG - Intronic
924055433 1:240119620-240119642 ACACGGAAATACCAGGCCCAGGG + Intronic
924810958 1:247401697-247401719 CCTCCCAAATCCCCAGCCCTAGG + Intergenic
1062882190 10:988094-988116 ACTCCCAAATCCCAAGACCCCGG + Exonic
1065316106 10:24465494-24465516 ACACCCAACTACCACGCTCTGGG - Intronic
1065778353 10:29143323-29143345 ACACCCTCATCGCACGCCCTGGG + Intergenic
1067074322 10:43165536-43165558 ACACCTTAATCCCAGCACCTTGG + Intronic
1067662611 10:48247724-48247746 ACACAGAAATCCCAGTCCCAGGG + Intronic
1067945391 10:50685481-50685503 AGACCCTGAGCCCAGGCCCTGGG - Intergenic
1069789041 10:71007668-71007690 AATCCCAAAACGCAGGCCCTGGG - Intergenic
1070365367 10:75731776-75731798 CCACCCATGTGCCAGGCCCTGGG - Intronic
1070866901 10:79712353-79712375 AGACCCTGAGCCCAGGCCCTGGG - Exonic
1070880692 10:79850474-79850496 AGACCCTGAGCCCAGGCCCTCGG - Exonic
1070910087 10:80110251-80110273 GCACCCAGATCCCAGGCCAGTGG - Intergenic
1071633813 10:87234576-87234598 AGACCCTGAGCCCAGGCCCTGGG - Exonic
1071647262 10:87366792-87366814 AGACCCTGAGCCCAGGCCCTGGG - Exonic
1071676468 10:87660067-87660089 ACCCCCAATTCCCCGGCACTTGG + Intronic
1073451654 10:103613237-103613259 ACAGCCCACTCCCAGGCCCTAGG + Intronic
1074206621 10:111288339-111288361 ACACCCAAACACTAGGCTCTGGG + Intergenic
1074813704 10:117129129-117129151 CCTACCAAATGCCAGGCCCTGGG + Intronic
1075061913 10:119262600-119262622 ACGCCCAAATCCCAGCACTTTGG - Intronic
1077415968 11:2424418-2424440 AGTCCCAAACCCCAGGACCTGGG + Intergenic
1078345084 11:10540961-10540983 ACGCCCCAATCCGAGGCCCGGGG + Intronic
1078355473 11:10628908-10628930 AGACCCAGTTCCCAGGGCCTGGG - Intronic
1078450019 11:11433848-11433870 ACAGCCCTGTCCCAGGCCCTGGG + Intronic
1078531881 11:12142950-12142972 ACTTCCAAATGCCAGGTCCTGGG + Intronic
1079490232 11:20980764-20980786 ACATCAGAATCCCAGGGCCTTGG - Intronic
1080922628 11:36723953-36723975 ACTACCAAATCCCAGGCCATGGG + Intergenic
1080931945 11:36820049-36820071 ACACCCAAATCCTTGTCTCTGGG - Intergenic
1082835019 11:57645426-57645448 AAACTCAAATCCCAGGCCCTGGG - Exonic
1083131829 11:60632275-60632297 CCACCCAACTCCCATGCCTTTGG - Intergenic
1083526734 11:63373908-63373930 ACACACAGATTCCAGGCCATGGG + Exonic
1084767695 11:71323368-71323390 ACACCCAGTGCCCAGGCCCAGGG + Intergenic
1085464754 11:76716074-76716096 ACAGCCAGTTCCCAGGCCCTTGG - Intergenic
1086527700 11:87747965-87747987 ACACCTAAATCCCAGCACTTTGG - Intergenic
1088811620 11:113396244-113396266 CCACCCAGCTCCCAGTCCCTGGG - Intronic
1089112200 11:116065603-116065625 AAACTCAAATCCCATTCCCTTGG - Intergenic
1089445914 11:118552002-118552024 TCCTCCAAACCCCAGGCCCTGGG - Intronic
1089673609 11:120074021-120074043 CCACCAAAGTCCCAGGCCCAAGG + Intergenic
1092046297 12:5433461-5433483 ACTCCCCCATCCCATGCCCTCGG - Intronic
1092294564 12:7188399-7188421 GCACACAAATCCCAGCCCTTGGG - Intergenic
1093451703 12:19323554-19323576 ACACCGTAATCCCAGGACTTTGG + Intronic
1093654712 12:21681491-21681513 ACACCTAAATCCCAGCACTTTGG + Intronic
1096603109 12:52744585-52744607 ACACCACAATCCCATCCCCTTGG - Intergenic
1097320747 12:58223349-58223371 TCCCCCAAACCCCCGGCCCTAGG + Intergenic
1099352374 12:81589927-81589949 AAACCCAAATCCAAGGTCTTAGG + Intronic
1100444524 12:94649408-94649430 ACACCCAAATCCCCAGTTCTCGG + Intronic
1100876536 12:98967961-98967983 CCACCCCAATCCCAGTCCATAGG - Intronic
1101123214 12:101605005-101605027 TTTCCCAAGTCCCAGGCCCTGGG + Intronic
1101346641 12:103891995-103892017 CCACCCAGCACCCAGGCCCTTGG + Intergenic
1101731310 12:107428692-107428714 ACAACCAAATCCCTGCCCCAGGG + Intronic
1101748304 12:107561198-107561220 ACAGCCACACCCCAGACCCTGGG + Intronic
1101765880 12:107698851-107698873 ACACTGTAATCCCAGGACCTTGG - Intronic
1101907579 12:108839269-108839291 GAACCTAATTCCCAGGCCCTGGG - Intronic
1102369023 12:112365899-112365921 ACACCCAAGTCCCAGGTACTCGG - Intronic
1102506560 12:113387920-113387942 CCACCCACAGCTCAGGCCCTAGG - Intronic
1104060198 12:125261370-125261392 ACAGTCCCATCCCAGGCCCTAGG - Intronic
1104718010 12:131029508-131029530 ACAACCTAATCCCAGAGCCTGGG - Intronic
1104718056 12:131029687-131029709 ACAACCTAATCCCAGAGCCTGGG - Intronic
1104718102 12:131029868-131029890 ACAACCTAATCCCAGAGCCTGGG - Intronic
1104874483 12:132024513-132024535 AGACCCAAAGCCCAGACCTTTGG + Intronic
1106132596 13:26952394-26952416 ACAACCAGATCCCAGGTCCCAGG - Intergenic
1106317778 13:28610087-28610109 CCTCCCTAATCCCAGGCCCTGGG + Intergenic
1108115599 13:47124161-47124183 ACACCCAAATCCCATACCAGAGG - Intergenic
1108176279 13:47796071-47796093 AGACCCTAATCCCAACCCCTTGG + Intergenic
1110432107 13:75436393-75436415 ACTCCCAAATCCCAGCACTTTGG + Intronic
1111746476 13:92276220-92276242 TCACACAAATCACTGGCCCTGGG + Intronic
1112772427 13:102805661-102805683 ACCCCCAAACCCCAAGCCCTAGG + Intronic
1113727559 13:112616535-112616557 AAACCCAGATCCCAGCACCTGGG - Intergenic
1113800451 13:113083607-113083629 ACACCCTGAGCCCTGGCCCTAGG - Intronic
1114040804 14:18676729-18676751 GCACCCAGATCCCAGGCCAGTGG - Intergenic
1114045842 14:18875233-18875255 GCACCCAGATCCCAGGCCAGTGG - Intergenic
1114118372 14:19644237-19644259 GCACCCAGATCCCAGGCCAGTGG + Intergenic
1115083790 14:29489322-29489344 ACACCCAAGTACCAGTCTCTGGG + Intergenic
1115341615 14:32298766-32298788 ACACCCTGATCCCATGCCCAGGG + Intergenic
1117828297 14:59726407-59726429 AGGCCCAAATCCCTTGCCCTTGG + Intronic
1118999838 14:70871966-70871988 ACAGCCACTTCCCAGGCCCCAGG - Intergenic
1119487487 14:75000365-75000387 ACACCCGAATCCCAGCACTTTGG - Intergenic
1120970830 14:90205633-90205655 CCACCCACAGCCCAGCCCCTGGG + Intergenic
1122294446 14:100697566-100697588 GCACCCAAATCCCAGGCTAAGGG - Intergenic
1122388588 14:101365215-101365237 ACAGGCAAAGCCCAGCCCCTCGG + Intergenic
1122781006 14:104143572-104143594 ACCCCCAAATCACAGGCCTGGGG - Intronic
1123675711 15:22708990-22709012 ACACCGCAATCCCAGCCACTCGG - Intergenic
1123735260 15:23177947-23177969 ACACCGCAATCCCAGCCACTCGG + Intergenic
1124285775 15:28399253-28399275 ACACCGCAATCCCAGCCACTCGG + Intergenic
1125135980 15:36343078-36343100 ACACACAACTCCAAAGCCCTCGG + Intergenic
1125548419 15:40525847-40525869 CCACCCAATGCCCTGGCCCTTGG + Intergenic
1127654582 15:61044280-61044302 TAACCCAAATGCCAGGCCCTTGG + Intronic
1127932372 15:63605432-63605454 ACACACAAATCCCAGGCACTGGG + Intergenic
1128111669 15:65079994-65080016 GTACCCAACTCCCAGGCCCAAGG - Intergenic
1128549967 15:68591673-68591695 ACACCCAGCTCCCAGGCACAGGG - Intronic
1128866164 15:71116175-71116197 ACACACAGATCCGAGGCCCCAGG - Intronic
1129306146 15:74664679-74664701 ACTCTCAAATTCTAGGCCCTGGG + Intronic
1129720296 15:77874300-77874322 AGACACAAAGCCCAGGGCCTGGG + Intergenic
1129738838 15:77980109-77980131 CCACCCCATACCCAGGCCCTCGG - Intergenic
1129847122 15:78773072-78773094 CCACCCCATACCCAGGCCCTCGG + Exonic
1130254779 15:82320818-82320840 CCACCCCATACCCAGGCCCTCGG - Intergenic
1130552935 15:84903543-84903565 ACAAACAAATCCCAGCCCCAGGG + Intronic
1130584319 15:85168759-85168781 AAACACAAATCACAGCCCCTGGG + Intergenic
1130600194 15:85269188-85269210 CCACCCCATACCCAGGCCCTCGG + Intergenic
1130982585 15:88822936-88822958 ACAGCCACATCCCAGGCACCTGG + Intronic
1131838985 15:96416577-96416599 ACGCCCAAATCTGAGGCCCGTGG - Intergenic
1133139212 16:3731995-3732017 ACGCCCAGCTCCCAGGCCGTGGG + Intronic
1133202290 16:4211324-4211346 AAAGGCAAATGCCAGGCCCTAGG - Intronic
1133210760 16:4262245-4262267 ACACCTGAGTCCCAGGCCCATGG + Intronic
1134623725 16:15709199-15709221 AATCCCAAATCCCAGCACCTTGG - Intronic
1135995248 16:27243114-27243136 ACACCCAAAACTCGGGCACTCGG - Intronic
1136084881 16:27877699-27877721 TCATCCAAACCCCAGCCCCTGGG + Intronic
1136288686 16:29258939-29258961 ACATCCTAATCCCAGATCCTGGG - Intergenic
1136588872 16:31205044-31205066 AAACTCAAGTCCCAAGCCCTTGG + Intergenic
1137338354 16:47573245-47573267 ACACTCATATCCCAGGCAATGGG + Intronic
1137560974 16:49502258-49502280 AGTCCCACATCCCAGCCCCTTGG - Intronic
1138346702 16:56324644-56324666 GCACCCAAAGCCCAGGCCCCAGG + Intronic
1139146362 16:64329952-64329974 ACATCCACCTCCCAGGCCCAAGG - Intergenic
1142066421 16:88065517-88065539 ACACCCAGGTCCCAATCCCTGGG - Intronic
1142094407 16:88231844-88231866 ACATCCTAATCCCAGATCCTGGG - Intergenic
1142130628 16:88430190-88430212 ACCCCCAAACCCCCCGCCCTGGG + Exonic
1143069333 17:4277291-4277313 ACACCCAGATCCCATGGCCATGG + Intronic
1143452524 17:7044048-7044070 ACACACAACCCCCAGGCCCGGGG + Intergenic
1144265107 17:13561510-13561532 AATCCCAAATCCCAGCTCCTTGG - Intronic
1144786490 17:17835270-17835292 ACCCTGAAATCCCAAGCCCTAGG - Intronic
1144890018 17:18489183-18489205 ACACCCAGGTCCCCGGCTCTGGG - Intronic
1145142198 17:20455134-20455156 ACACCCAGGTCCCCGGCTCTGGG + Intronic
1145761061 17:27425707-27425729 AAACCCAACTCCCAGCCCATGGG - Intergenic
1146033286 17:29384957-29384979 ACACCCAGCTCCCAATCCCTGGG + Intergenic
1146161110 17:30559865-30559887 AAACCCAACTCCCAGCCCATGGG - Intronic
1146446653 17:32937537-32937559 GAACCCACATCCCAGGCTCTGGG + Intronic
1148235385 17:45965068-45965090 ACACCCCAGTCCCAGGCACCTGG - Intronic
1149104423 17:52944437-52944459 ACACCCATGTCCCATGTCCTGGG + Intergenic
1149431148 17:56596235-56596257 GCCCCGAAATCCCAGGCCCTCGG + Intergenic
1149686117 17:58535970-58535992 ACACCCACCTCCCAGCCCCGTGG + Intronic
1150380768 17:64717660-64717682 ACTCCCAAATCCAAGGTCATAGG - Intergenic
1150699774 17:67436724-67436746 CCACACAAATCCAAGACCCTTGG - Intronic
1150726777 17:67657538-67657560 GCCCCCAAATCACAGGCACTCGG - Intronic
1150981569 17:70148114-70148136 TCACCCAAATACCAGGCATTAGG + Intergenic
1151335816 17:73438996-73439018 ACATCCAAACCCCAGGACTTGGG - Intronic
1151367390 17:73626363-73626385 ACACCCAAACCCCAAGGGCTGGG + Intronic
1151835578 17:76580893-76580915 ATGCCCAATTCCCAGGCGCTAGG + Intronic
1151969348 17:77449934-77449956 ACACTGAAATCCAAGGCCCTGGG - Intronic
1152377153 17:79924774-79924796 CCACCCAGAGCCCAAGCCCTCGG + Intergenic
1152404402 17:80088202-80088224 ACACCCATATCCCAGTGCTTTGG + Intronic
1152573636 17:81130997-81131019 ACACCCAACGCCCAGCACCTGGG + Intronic
1152603682 17:81278256-81278278 ACACCCAAATACCAGCACTTTGG + Intronic
1154945183 18:21156172-21156194 ACACCCGAATCCCAGCACTTTGG - Intergenic
1154945829 18:21160441-21160463 ACACCCGAATCCCAGCACTTTGG - Intergenic
1159917263 18:74198500-74198522 ACATCCAAATCCTAAGTCCTAGG + Intergenic
1160142440 18:76337694-76337716 ACACCAAAATTCCAGCCCCATGG - Intergenic
1162101350 19:8341031-8341053 ACACCCAAATCCCAGGCCCTGGG + Intronic
1162373768 19:10293436-10293458 CCGCCCAAATACCACGCCCTAGG - Intronic
1162656483 19:12134996-12135018 ACCCCCAAATGCCAGTCCTTTGG - Intronic
1162837100 19:13327386-13327408 AGACCCAAAACCCAGGCCAGTGG - Intronic
1163525999 19:17821653-17821675 ACATCCAAGGCCCTGGCCCTGGG - Intergenic
1163571881 19:18087129-18087151 ACACCCAGATGCCAGCCCCATGG + Intronic
1164901467 19:31929560-31929582 ACACCCTACTCCCAGCGCCTTGG + Intergenic
1166231345 19:41427235-41427257 ACACCCCAACCCCAGGGACTGGG + Intronic
1166368097 19:42287249-42287271 ACCCCCAAGTCCCAGGCCTCAGG - Intronic
1167318769 19:48782495-48782517 ACACCCAAATCCCAGGGGCCAGG - Intergenic
925424457 2:3737111-3737133 ACCCCCAGGTGCCAGGCCCTGGG + Intronic
925463864 2:4088926-4088948 ACACCCACATTCCAGCCCCCGGG - Intergenic
926051475 2:9747570-9747592 ACATCCCAGTGCCAGGCCCTGGG - Intergenic
927939621 2:27095384-27095406 ACACCCAAACCCCAGCTCCTTGG - Intronic
928684041 2:33729426-33729448 ACACCCAAAGCCTAGTCTCTAGG + Intergenic
928944636 2:36761350-36761372 ACACCCCCATCCCAGGCCAGTGG - Intronic
932607960 2:73176969-73176991 ACACCCCCAACCCAGCCCCTGGG + Intergenic
933055621 2:77660286-77660308 ACAGCCCAATGCCATGCCCTGGG + Intergenic
933694403 2:85206474-85206496 ACTGCCAAGTCCCAGGCTCTGGG + Intronic
933751268 2:85603192-85603214 TAAGCCAAATCCCAGGCGCTTGG - Intronic
933806747 2:86003711-86003733 ACACCAAAATCCCAGCTACTAGG + Intergenic
934854002 2:97717915-97717937 ACACTCACAGCCCAGGCCCTGGG - Intronic
936171144 2:110176728-110176750 ACACAGAAGGCCCAGGCCCTAGG - Intronic
936339488 2:111618472-111618494 GCACCCCAATCCCAGGACTTGGG - Intergenic
937851768 2:126642484-126642506 TCACCCATATCCCATGGCCTTGG + Intergenic
938164421 2:129014283-129014305 ACACCCAAATCATAGCCACTTGG - Intergenic
938269392 2:129955862-129955884 GCACCCAGATCCCAGGCCAGCGG + Intergenic
938910768 2:135883893-135883915 ACCCCCACATACCATGCCCTTGG - Intergenic
940455798 2:153898224-153898246 ACACACAAATCCAAGTCCTTCGG - Intronic
941213474 2:162673481-162673503 GTAGCCAAATCCCAGACCCTGGG - Intronic
941491971 2:166153816-166153838 ACACCCACATCCCAGCACTTTGG + Intergenic
941704366 2:168642109-168642131 ACACCATAATCCCAGGTCTTTGG + Intronic
942450490 2:176105669-176105691 AAACCCAAATCCCAGAACCGAGG - Intronic
944396084 2:199267749-199267771 ACACCTAACTTCCAGGCCCCAGG - Intergenic
944398027 2:199291784-199291806 ACACCTAAATCCCAGCTACTAGG + Intronic
944581521 2:201136971-201136993 ACTCCCCAGTCCCTGGCCCTGGG - Intronic
946653005 2:221914314-221914336 ACACACAGATCCCTAGCCCTTGG - Intergenic
947283243 2:228480150-228480172 ACAACCATATTCCAGGCACTGGG + Intergenic
948182888 2:235996708-235996730 ACACACAGATTTCAGGCCCTTGG - Intronic
948960844 2:241335366-241335388 CAACCCAAATCCAAGGACCTCGG - Intronic
949044027 2:241862409-241862431 CCATCCAAATCACTGGCCCTGGG + Intergenic
1170146567 20:13181395-13181417 GCACCCAAATCCTTGTCCCTGGG + Intergenic
1170164241 20:13345379-13345401 ACACCCAAACGCCAAGCCCCTGG + Intergenic
1171010922 20:21509031-21509053 ACACCCAGATTGCAGGCCCGCGG + Intergenic
1172010883 20:31845039-31845061 ACCCCCAAAGCTTAGGCCCTTGG + Exonic
1172128224 20:32638123-32638145 ACCCCCAAATGCCAGGTCCTTGG - Intergenic
1174460789 20:50680961-50680983 ACACCTTAATCCCAGGACTTTGG + Intronic
1174709013 20:52685434-52685456 ACTCCCAAACCCCAAGCTCTTGG - Intergenic
1175059720 20:56230905-56230927 ACACACAAATCCCAGCTACTTGG + Intergenic
1175900888 20:62359483-62359505 ACACCCAGGCCCCAGGCCCCAGG - Intronic
1176168545 20:63686848-63686870 ACAAACAGATTCCAGGCCCTTGG - Intronic
1176659816 21:9623812-9623834 ACACTGTAATCCCAGCCCCTAGG - Intergenic
1176979425 21:15363274-15363296 ACACCCTTATCCTTGGCCCTTGG + Intergenic
1178856990 21:36258609-36258631 ACGCCCAACGGCCAGGCCCTCGG - Intronic
1180464373 22:15597850-15597872 GCACCCAGATCCCAGGCCAGTGG - Intergenic
1180617393 22:17137427-17137449 CCACCCATCTCCCAGACCCTGGG + Intergenic
1180636471 22:17266323-17266345 AAACACAAAACCCAAGCCCTGGG + Intergenic
1180844540 22:18973940-18973962 GACCCCAAAGCCCAGGCCCTGGG - Intergenic
1181427829 22:22855757-22855779 ACAGCTCAATCCCAGGCCCCTGG - Intronic
1181695779 22:24592187-24592209 AAACCCAGATCCCAACCCCTGGG - Intronic
1181775740 22:25159030-25159052 ACACCCACAGCGCAGGCTCTAGG + Intronic
1182689228 22:32144981-32145003 ACCCGCATATCCCTGGCCCTAGG - Intergenic
1182764202 22:32746768-32746790 ACCTGCAAATGCCAGGCCCTGGG - Intronic
1183710640 22:39501495-39501517 ACTCCAAAGCCCCAGGCCCTGGG + Intronic
1185205231 22:49534053-49534075 ACACCCAGACCCCATGGCCTGGG + Intronic
949531770 3:4962798-4962820 ACACTCTAATCCCAGTACCTTGG + Intergenic
950529571 3:13545454-13545476 ACACCCCAGGCCCAGGCCCGAGG - Intergenic
950569509 3:13791268-13791290 TCAGCCAAGTCCCAGGCCCCAGG - Intergenic
952882726 3:37994757-37994779 ACACCCCCATCCCCTGCCCTAGG + Intronic
953340906 3:42133309-42133331 ACACCAAACTCCCATGACCTTGG + Intronic
955531597 3:59878832-59878854 ACACCCAAACCCCATCCCCATGG + Intronic
958465301 3:94449766-94449788 GCACCAAGATCCCAGGACCTTGG - Intergenic
961002294 3:123382110-123382132 ACAGCCAGATCAAAGGCCCTGGG - Intronic
961253142 3:125523358-125523380 ACACCCAGAACCCAAGCTCTTGG + Intergenic
962856386 3:139349626-139349648 ACTGCCAACTCCCAGGCCATGGG - Intronic
962865153 3:139442398-139442420 GCACACAGATCCCGGGCCCTGGG + Intergenic
963237771 3:142972481-142972503 ACACTCTAAGCCCAGGCCTTGGG + Intronic
965091223 3:164164757-164164779 ACACCCAAAGCCCAGGAAATAGG + Intergenic
966874766 3:184315474-184315496 ACCTCCCAACCCCAGGCCCTCGG + Exonic
967340227 3:188389345-188389367 AAAGTCAAGTCCCAGGCCCTTGG - Intronic
967631563 3:191748353-191748375 ACATCCAAATACCAGGACCAAGG - Intergenic
968524126 4:1047282-1047304 ACACCCAAATCCCCGCACCCGGG - Intergenic
968855275 4:3115633-3115655 ACACCCACTGCCCAGTCCCTGGG - Intronic
969258664 4:6020364-6020386 CCACTCAGATCCCAGGCGCTGGG + Intergenic
969617149 4:8260333-8260355 ACATCCATATCCCAGCCCCCAGG - Intergenic
969752211 4:9119883-9119905 ACACCCGCATCGCATGCCCTTGG + Intergenic
969881392 4:10177119-10177141 ACAATTAAATCCCAGGCCCTAGG - Intergenic
970928926 4:21485957-21485979 AAAACCAAATCCCAGGCTGTGGG - Intronic
971367761 4:25991329-25991351 TCACCCAAATTTCAGGCCCATGG - Intergenic
975579255 4:75892019-75892041 ACCCCCAAACCCCTGGCCCAGGG - Intronic
976088544 4:81430627-81430649 ACACCCCCATCGCATGCCCTGGG + Intronic
976844189 4:89468667-89468689 ACTCCCAAATACCATGACCTTGG - Intergenic
977557274 4:98498646-98498668 ACACTCCACCCCCAGGCCCTGGG - Intronic
979347384 4:119604683-119604705 ACACCCCAAATCCCGGCCCTCGG + Intronic
981694586 4:147547777-147547799 TCAGCCAAATCACAGGCCCAAGG + Intergenic
985620475 5:952342-952364 ACAGCCACAGCCGAGGCCCTGGG - Intergenic
986174925 5:5343924-5343946 ACACCCACATCTCAGCTCCTCGG + Intergenic
986354222 5:6908061-6908083 ACACCCACCTGCCAAGCCCTGGG + Intergenic
986499606 5:8385139-8385161 CCTCCCAAATCCCAGTCTCTGGG - Intergenic
988012904 5:25513574-25513596 ACACCTATATCCCAGCACCTTGG + Intergenic
995689315 5:114805882-114805904 TCACCCAAATCCCAGCCCTCAGG + Intergenic
998409233 5:141896586-141896608 ACACCCAGCTGCCAGGGCCTTGG + Intergenic
999721582 5:154402579-154402601 ACTCCCAAATCCCTGGCCTAGGG - Intronic
999745855 5:154591187-154591209 AGTCCCCAATCCCAGGCCATTGG + Intergenic
1001545224 5:172566934-172566956 GCACCCACATGCCAGGCACTGGG - Intergenic
1002145666 5:177179185-177179207 ACACTTAAATCCAAGGTCCTAGG - Intronic
1002252362 5:177938073-177938095 AGCCCCAAATCCTAGGCTCTGGG + Intergenic
1002329335 5:178430773-178430795 AGACCCAGATCCCAGGGTCTGGG - Intronic
1002553567 5:180016468-180016490 ACTCCCATGTCCCAGGCCCTGGG + Intronic
1003183313 6:3810249-3810271 TCATTCAAAGCCCAGGCCCTTGG + Intergenic
1003277228 6:4663049-4663071 ACAGACAGTTCCCAGGCCCTCGG + Intergenic
1003886066 6:10522530-10522552 AGACTGTAATCCCAGGCCCTGGG + Intronic
1004731742 6:18366192-18366214 ACTCCCCTGTCCCAGGCCCTGGG - Intergenic
1005805272 6:29468519-29468541 ACACCCTCAGGCCAGGCCCTGGG - Intergenic
1006654372 6:35577792-35577814 ACACCCTAATCCCAGCACTTTGG + Intronic
1007125059 6:39418986-39419008 AGACCCATCTCCCAGGCCCAGGG - Intronic
1007243221 6:40442020-40442042 AGATCCAAGTGCCAGGCCCTAGG + Intronic
1007244768 6:40452937-40452959 ACAACCAAATCTCTTGCCCTAGG - Intronic
1007380426 6:41486975-41486997 ACCTCCAAATCACAGGCCTTAGG + Intergenic
1011155264 6:84323354-84323376 ACACCAAAGTCCCAGACACTTGG - Intergenic
1011194376 6:84766610-84766632 CCGCCCCAATCCCAGGCTCTCGG + Intergenic
1011326258 6:86152193-86152215 ACACCCCCATCACATGCCCTGGG - Intergenic
1012191629 6:96287211-96287233 TCACCCATATCCCATGCACTTGG - Intergenic
1012447196 6:99318858-99318880 ACACCCATATGCCAGCCACTAGG + Intronic
1013047509 6:106502042-106502064 ACAGCCAAGTCAGAGGCCCTGGG - Intergenic
1013100137 6:106979328-106979350 ACACCCAAATCCCAGCATTTTGG - Intergenic
1016489380 6:144580373-144580395 ACAACCAGATCCAAGGCCATGGG + Intronic
1016885667 6:148957209-148957231 ACACCCACATACCAGGGCCTGGG + Intronic
1017754925 6:157521409-157521431 ACAACAAAATACCAGGCCGTGGG + Intronic
1018099096 6:160420638-160420660 ACTCCCAACTCCCCGGCCCTGGG - Intronic
1018388803 6:163327748-163327770 ACCCCCACATCCCAGGCCCTGGG - Intergenic
1018650117 6:165986219-165986241 ACCCCCAAATCCCCAGCCCTGGG - Intronic
1019782546 7:2952352-2952374 ACAGCCAAATTCCTGGACCTGGG + Intronic
1022901101 7:34811429-34811451 AACCCCAAATCCCAGGCTCCAGG - Intronic
1023769447 7:43541864-43541886 TCACTCAAATCACAGGGCCTGGG - Exonic
1023850532 7:44147612-44147634 TCCCCCACAACCCAGGCCCTGGG - Intronic
1024281110 7:47720648-47720670 AGCCTCAAAGCCCAGGCCCTGGG - Intronic
1024561261 7:50647503-50647525 AGACCCGAATCCCAGCACCTTGG - Intronic
1024566138 7:50682366-50682388 CCACCTAAATCCCAGAGCCTGGG - Intronic
1025256137 7:57385024-57385046 ACACTCAGATGCCAGGGCCTGGG + Intergenic
1026397727 7:69974590-69974612 ACATCCAAATCTCCTGCCCTTGG - Intronic
1027996082 7:85427033-85427055 AGACCCTTATTCCAGGCCCTAGG + Intergenic
1028604171 7:92636923-92636945 ACACCTAAATCCCAGCACTTTGG - Intronic
1029055101 7:97733037-97733059 CCCCCGAAATCCCAGGTCCTGGG - Intronic
1032271437 7:130411016-130411038 ACATCAAAGTCCCAGTCCCTGGG + Intronic
1032395200 7:131584419-131584441 ACTGCCCAAGCCCAGGCCCTCGG - Intergenic
1032656497 7:133936178-133936200 ACACCCACATTCCATGCGCTCGG + Intronic
1034543183 7:151772723-151772745 ACACCTAAATCCCAGCACTTTGG + Intronic
1035758145 8:2049559-2049581 CCACCCACATCCCGGGCCATGGG - Intronic
1036285825 8:7443404-7443426 AAAGCCAGGTCCCAGGCCCTGGG - Intronic
1036335648 8:7868125-7868147 AAAGCCAGGTCCCAGGCCCTGGG + Intronic
1036480965 8:9139383-9139405 ACACCCAAGTCCATGTCCCTGGG + Exonic
1037268597 8:17098945-17098967 ACTCCCATACCCCAGGCCCTTGG - Intronic
1037542975 8:19889861-19889883 GCACACAAATCCCAGGGCATAGG + Intergenic
1037703755 8:21297956-21297978 ACACCCGAATCCCAGGACCCGGG + Intergenic
1037834406 8:22207625-22207647 TCACCCACAACCCTGGCCCTGGG - Intronic
1041669499 8:60478491-60478513 ACACCCCACCCCCATGCCCTGGG - Intergenic
1044573443 8:93744192-93744214 ATACCCAAAACCCAGGACCCTGG - Intergenic
1045019586 8:98030394-98030416 ACACACAACTTCCAGCCCCTGGG + Intronic
1048570968 8:135655646-135655668 TCATACAAGTCCCAGGCCCTAGG - Intronic
1049064493 8:140302173-140302195 AGACCCACATCCCAGCCCCGGGG + Intronic
1049226218 8:141451755-141451777 ACACCCACATCCCATCCCCTAGG - Intergenic
1049497986 8:142945676-142945698 CCACCCCATTCCCAGTCCCTGGG - Intergenic
1049596243 8:143484825-143484847 TCCCCCCACTCCCAGGCCCTGGG + Intronic
1049781875 8:144432792-144432814 ACACCCAATTCCCAGCCTCTTGG + Intronic
1050989229 9:12126528-12126550 ACACTCTAATCCCAGGTACTCGG - Intergenic
1052833276 9:33232612-33232634 ACACACACATGCCAGGCCCTGGG + Intronic
1055480718 9:76706669-76706691 ACACCAAAATGCCAGTCCCTGGG - Exonic
1056855787 9:90128553-90128575 ACACCCAAACCCTTGGCACTGGG - Intergenic
1057353536 9:94318575-94318597 AGACCCTGAGCCCAGGCCCTGGG + Exonic
1057588950 9:96355142-96355164 ACACCTAAATCCCAGCTACTTGG - Intronic
1057654215 9:96939017-96939039 AGACCCTGAGCCCAGGCCCTGGG - Exonic
1061220525 9:129247906-129247928 AAATCCACCTCCCAGGCCCTCGG - Intergenic
1061234882 9:129336579-129336601 ACACTCAACTCCCCGGCCCCTGG + Intergenic
1062187644 9:135227191-135227213 ACGTCCAGATCCCAGGCCCAGGG - Intergenic
1062358471 9:136176298-136176320 AAACCCACATCCCAGGTCCAAGG - Intergenic
1062460803 9:136661840-136661862 ACCCCCATTTCCCTGGCCCTGGG - Intronic
1062529587 9:136994032-136994054 ACACCCAGAACACAGGCCCAGGG - Intergenic
1203637376 Un_KI270750v1:125656-125678 ACACTGTAATCCCAGCCCCTAGG - Intergenic
1185579244 X:1197874-1197896 ACACTGTAATCCCAGGCACTCGG + Intronic
1186449565 X:9660892-9660914 ACCCCCAAATACCATCCCCTTGG - Intronic
1187512214 X:19930743-19930765 ACACCTAAATCCCAGCACTTTGG + Intronic
1187539262 X:20175477-20175499 ACACCAACATCCTAGTCCCTCGG + Intronic
1189173066 X:38927703-38927725 CCACTCCAATCCCTGGCCCTAGG + Intergenic
1189348980 X:40263034-40263056 GCTCCCATATCCCAGGACCTTGG - Intergenic
1190217852 X:48492152-48492174 ACACCAAGATCCAAGGCCATTGG - Intergenic
1193990308 X:88299249-88299271 ACACCCAACCCCCAGTACCTAGG + Intergenic
1194143919 X:90240804-90240826 CCACCCAGATCCCATGCACTTGG - Intergenic
1194228110 X:91286930-91286952 TCACCCAAGGCCCAGGCCTTGGG - Intergenic
1195354022 X:104021388-104021410 CCACCCACGTCCCAGACCCTGGG - Intergenic
1197967466 X:132080551-132080573 ACACCTTAATCCCAGCCCTTTGG + Intronic
1198251226 X:134880782-134880804 AGACCCAAACCCGTGGCCCTTGG - Intergenic
1199152478 X:144503824-144503846 TCACCCAAATCCCAGCACTTTGG - Intergenic
1200002301 X:153068401-153068423 ACACACAAATCACGTGCCCTCGG - Intergenic
1200005430 X:153081624-153081646 ACACACAAATCACGTGCCCTCGG + Intergenic
1200489679 Y:3810105-3810127 CCACCCAGATCCCATGCACTTGG - Intergenic