ID: 1162102763

View in Genome Browser
Species Human (GRCh38)
Location 19:8349964-8349986
Sequence TGGTATTCCCTGCAAATTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162102758_1162102763 20 Left 1162102758 19:8349921-8349943 CCTACACTCATTGTGTAGTTAGT 0: 1
1: 0
2: 1
3: 6
4: 118
Right 1162102763 19:8349964-8349986 TGGTATTCCCTGCAAATTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162102763 Original CRISPR TGGTATTCCCTGCAAATTGG CGG Intronic
904706984 1:32398617-32398639 TGATATTCCCTGAAAATTCCCGG + Intergenic
906401053 1:45504991-45505013 TGTTAATCCCTGCTACTTGGGGG + Intronic
908538299 1:65099146-65099168 TGGTAATCCCAGCACTTTGGAGG - Intergenic
908850155 1:68367733-68367755 TCGTAGTCCCAGCAACTTGGAGG + Intergenic
911370642 1:96990935-96990957 TGCCATTCTGTGCAAATTGGAGG - Intergenic
917097689 1:171415788-171415810 TGGTAATCCCAGCACTTTGGAGG + Intergenic
920913919 1:210242933-210242955 GGGTATTCCCTGCAAGTTTCTGG + Exonic
922192960 1:223335567-223335589 TGGTTTGCCTTTCAAATTGGGGG - Intronic
922491609 1:226021510-226021532 TCATTTTCCCTGCAAACTGGGGG - Intergenic
922900907 1:229135728-229135750 TTGTAATCCCTGCATGTTGGAGG + Intergenic
923975793 1:239260881-239260903 TGGTAATCCCAGCACTTTGGGGG - Intergenic
924608706 1:245556520-245556542 TGGTAGTCCCAGCTACTTGGGGG - Intronic
1063902053 10:10744172-10744194 TGTTATTCCCAGCATATAGGTGG - Intergenic
1065685569 10:28281200-28281222 TGGTAATCCCAGCTACTTGGGGG - Intronic
1067510547 10:46891473-46891495 TGAAATTCCCAGCAAATTGCCGG + Intergenic
1067651706 10:48160389-48160411 TGAAATTCCCAGCAAATTGCCGG - Intronic
1069589105 10:69630841-69630863 TGGTGTTCCCTGCGAAGTGAGGG + Intronic
1072261429 10:93678571-93678593 TGGTAATCCCAGCACTTTGGGGG + Intronic
1074708897 10:116160751-116160773 TGGTGGTCCCTGCCACTTGGGGG - Intronic
1076064304 10:127437059-127437081 CCATATTCCCTGCATATTGGTGG + Intronic
1079830416 11:25259626-25259648 CGGTGTTGCCTGCAAATTTGGGG - Intergenic
1079830576 11:25262604-25262626 TGGTTGTCCCTGCAAATAGATGG - Intergenic
1080037947 11:27728975-27728997 GGGTATACACTGCAAATTAGGGG + Intergenic
1081184674 11:40027587-40027609 TCCTATTCCCTTCATATTGGAGG + Intergenic
1081679522 11:44991974-44991996 TGGTATTCCCTACCATTTGGAGG - Intergenic
1084105981 11:66980812-66980834 TGGTAGTCCCAGCTACTTGGGGG - Intergenic
1084131599 11:67140047-67140069 TGGTATTCTCTCTCAATTGGTGG - Intronic
1087015491 11:93550550-93550572 TGGTAGTCCCAGCTACTTGGGGG + Intergenic
1087156372 11:94908862-94908884 TGGTATTCCCTGGGATATGGAGG - Intergenic
1087247592 11:95857588-95857610 AAGTATTCCCTGAAAATGGGTGG - Exonic
1087430549 11:98047885-98047907 TGGTAGTCCCTGGAACATGGTGG - Intergenic
1088228536 11:107648370-107648392 CTGTATTTCCTGAAAATTGGAGG + Intronic
1092023379 12:5221270-5221292 TGGTATTCATAGCAAACTGGAGG - Intergenic
1093095203 12:14964058-14964080 TGGCATGCCCTGGTAATTGGTGG + Intergenic
1101687260 12:107037273-107037295 TGGTAATCCCAGCACTTTGGGGG + Intronic
1103723962 12:122988856-122988878 TGGCAGTCGCTGCAAAGTGGTGG - Exonic
1104447164 12:128843987-128844009 TGGTAGTCCCAGCTACTTGGGGG + Intergenic
1106265273 13:28103794-28103816 TGATTTTCCGTGGAAATTGGTGG + Intergenic
1106400118 13:29421755-29421777 GGGAATTCACTCCAAATTGGAGG + Intronic
1109689719 13:65869976-65869998 TTGTAGTCCCAGCAACTTGGAGG - Intergenic
1114303623 14:21400790-21400812 TGGTTTGCCTTTCAAATTGGGGG - Intronic
1116168370 14:41364019-41364041 TGGTATACTCTGGAAATGGGAGG + Intergenic
1117356394 14:54927569-54927591 TGGTATTTCTAGCAAAATGGTGG - Intergenic
1119582217 14:75795727-75795749 TGGTATTCGCAGCAACCTGGAGG - Intronic
1120757736 14:88259712-88259734 TGGTAATCCCAGCAGCTTGGGGG - Intronic
1123789900 15:23710065-23710087 TGGTATGCCACCCAAATTGGAGG - Intergenic
1125504132 15:40257209-40257231 TGGAATTCCCTGCCATTTGCGGG - Intronic
1128087635 15:64897002-64897024 TGGTGTTCCTTACACATTGGAGG - Intronic
1130714193 15:86315457-86315479 TGGTAATCCCAGCACTTTGGAGG + Intronic
1130934753 15:88459520-88459542 TGATATTACCTGCAAATGTGAGG + Exonic
1135556079 16:23437668-23437690 TGGTATTCACTGAAAAATAGTGG - Intronic
1140017166 16:71198699-71198721 TGATATTTCCTGAAACTTGGGGG + Intronic
1141236930 16:82227311-82227333 TGGCATTCTCTTTAAATTGGGGG - Intergenic
1141350077 16:83286631-83286653 TGGTAGTCCCAGCTACTTGGGGG + Intronic
1143999207 17:11037007-11037029 TGGTAGTCCCTGCTACTTGGCGG + Intergenic
1148450166 17:47772326-47772348 TTGTATTCCCAGCTACTTGGAGG - Intergenic
1149420050 17:56501687-56501709 TGGGATTCCCTGGAAAGAGGAGG + Intronic
1150872465 17:68928393-68928415 TGGTGATCCATGTAAATTGGCGG + Intronic
1151320441 17:73349401-73349423 TGGCATTCCCAGCTCATTGGAGG - Intronic
1151811934 17:76449205-76449227 TAGTTTTCTCTGTAAATTGGAGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153296761 18:3553788-3553810 TTGTAATCCCAGCACATTGGGGG - Intronic
1154142602 18:11838006-11838028 TGGTAGTCCCAGCTACTTGGGGG + Intronic
1157145346 18:45156990-45157012 GGGTCTTCCCTGCAATATGGTGG + Intergenic
1158044009 18:53133229-53133251 GGGTATTCCCAGCAACTTGCTGG - Intronic
1158621892 18:59040139-59040161 TGGTAGTCCCAGCTACTTGGAGG + Intergenic
1161918100 19:7245372-7245394 TTGTAGTCCCAGCAACTTGGAGG + Intronic
1161967448 19:7556317-7556339 TGGTAATCCCAGCACTTTGGAGG - Intronic
1162102763 19:8349964-8349986 TGGTATTCCCTGCAAATTGGCGG + Intronic
1164124595 19:22300849-22300871 AGGTTTTCCCTGCACATTTGTGG - Intronic
1165850688 19:38848890-38848912 TGGAAAACCCTGCAAATAGGCGG + Intronic
1167129721 19:47576379-47576401 TTGTAATCCCAGCAATTTGGGGG + Intergenic
1167159764 19:47759658-47759680 TGGTAGTCCCAGCTACTTGGGGG + Intergenic
1167317599 19:48774424-48774446 TGGTAATCCCAGCTACTTGGGGG - Intergenic
925390640 2:3491759-3491781 TGCTGTTCCTTGCAACTTGGGGG - Intergenic
926004101 2:9358585-9358607 GGGTATTGCATGTAAATTGGTGG + Intronic
926307198 2:11646900-11646922 TGGTGTTCCCTGCATGTAGGAGG + Intergenic
928631027 2:33192412-33192434 TGGTATTCCCTGTAAACTTGGGG - Intronic
930102967 2:47617422-47617444 TGGTGTTGCCTGCACATTTGAGG - Intergenic
933545343 2:83704078-83704100 TTTTATTGCCTGTAAATTGGGGG - Intergenic
935601763 2:104929207-104929229 TGGTGATCCCAGCACATTGGAGG - Intergenic
940862397 2:158784178-158784200 TTGTATTTCCTGCAAACTGGTGG - Intergenic
941615651 2:167715933-167715955 TGGTTTTCCATGCGAACTGGTGG - Intergenic
942037648 2:172026284-172026306 TCCTGTTTCCTGCAAATTGGTGG + Intronic
942441004 2:176036746-176036768 CTGTATTCCCGGCAACTTGGAGG - Intergenic
942445373 2:176074088-176074110 TGGTATTCCCAGCCAAGTTGGGG - Intergenic
945793091 2:214330007-214330029 TTGTAATCCCTGCACTTTGGGGG + Intronic
946189165 2:217998620-217998642 TGGTAGTCCCAGCTACTTGGAGG - Intronic
1169454107 20:5737035-5737057 TTGTATTCCCAGCTACTTGGTGG + Intergenic
1170663695 20:18366620-18366642 TTGTTTTCCCTTCAAATTTGGGG - Intergenic
1170966145 20:21073389-21073411 TGGTAATCCCAGCACTTTGGGGG - Intergenic
1172645151 20:36464435-36464457 TTGTATTCCCAGCTACTTGGAGG + Intronic
1173984789 20:47252662-47252684 TTGTAATCCCTGCAATTGGGAGG + Intronic
1175231782 20:57478106-57478128 TGGTGTTCCTTACAAATGGGAGG + Intergenic
1179080254 21:38164272-38164294 AGGTATTCCCTGCAAAGAGAAGG + Intronic
951156859 3:19365358-19365380 TGGTATTCTATGCAAACTTGGGG + Intronic
955787918 3:62559362-62559384 TGGAATCCCCTGTAAATTTGGGG - Intronic
955808595 3:62762397-62762419 TGGTAATCCCAGCATTTTGGGGG + Intronic
956880973 3:73510314-73510336 TGGTCTTGCCTGGAAACTGGTGG + Intronic
960648710 3:119921512-119921534 CTATATTTCCTGCAAATTGGTGG - Intronic
962113889 3:132481328-132481350 TGGTAATCCCAGCACTTTGGGGG + Intronic
966766686 3:183469497-183469519 TGGTGTTCTCTTCAAATTGCAGG - Intergenic
967277736 3:187793261-187793283 TAGTATTTCCTGCAATCTGGAGG - Intergenic
968407482 4:353249-353271 TTGTATTCCCAGCTACTTGGGGG + Intronic
968736544 4:2300052-2300074 TTGTATTCCCAGCACTTTGGGGG - Intronic
971349205 4:25841701-25841723 TTGTAATCCCTGCACTTTGGGGG + Intronic
973983812 4:56330048-56330070 TGGTATTTAGTGCAAATTTGGGG - Intergenic
974019961 4:56684354-56684376 TGATAGTCCCTGGAAATCGGTGG - Intergenic
975907512 4:79231777-79231799 TTGTATTTCCTGTAAACTGGTGG - Intronic
976055619 4:81062064-81062086 TGGTTTTCATTGCAACTTGGTGG - Intergenic
976724274 4:88200203-88200225 TGGTAGTCCCAGCTACTTGGGGG + Intronic
979266405 4:118708079-118708101 TTGTAATCCCAGCAATTTGGAGG - Intronic
980301268 4:130997421-130997443 TGGTATTCTCTGCAAAGTTTTGG + Intergenic
986597307 5:9437114-9437136 TGGTATGCACTGCAAATAAGTGG + Intronic
987874905 5:23668529-23668551 CTGTAATCCCTGCAATTTGGAGG - Intergenic
988213659 5:28243218-28243240 TTGTATTCTCTCCAAGTTGGAGG - Intergenic
990569443 5:57063316-57063338 TTGTAATCCCAGCAACTTGGGGG + Intergenic
993585144 5:89715423-89715445 TATTATTCCCTGCTAAATGGGGG - Intergenic
995418933 5:111940759-111940781 TGGTACTCACTGCAAGTTTGAGG + Intronic
999243827 5:150142631-150142653 ATGTATTCCCTGCAGATAGGGGG - Intronic
1001592611 5:172875958-172875980 TGGTATTTTCTGTAAACTGGTGG + Intronic
1004077522 6:12358127-12358149 TTGTAATCCCAGCAATTTGGGGG - Intergenic
1004850473 6:19693453-19693475 TGCTATTCCATGCAAACAGGTGG - Intergenic
1006312843 6:33273093-33273115 TTATATTCCCTGAGAATTGGAGG + Intronic
1006554515 6:34853964-34853986 TTGTAATCCCTGCACTTTGGGGG + Intronic
1008385930 6:50889892-50889914 TGGTTTTCCTTGAAAATTTGTGG + Intergenic
1008793005 6:55261965-55261987 TGGCATTCCCAGCAACCTGGAGG + Intronic
1013942360 6:115680190-115680212 TGGTATTCGCTCCAAAAGGGTGG - Intergenic
1015343655 6:132130826-132130848 TGGAATTCCTTCCAAGTTGGAGG - Intergenic
1018016896 6:159720735-159720757 TTGTATTCTCTGTAAACTGGAGG + Intronic
1020801110 7:12733381-12733403 TGGTCTGCCCTGCAAATTTTGGG - Intergenic
1024694989 7:51846789-51846811 TGGGAATCCCTGCAAGCTGGAGG - Intergenic
1027462010 7:78466122-78466144 TGGAATTTCATGCAAATTGAGGG - Intronic
1028954982 7:96678653-96678675 TGGTGTTCCCAGGAAATTGTGGG - Intronic
1029036616 7:97529210-97529232 TGGTGTTCCCTGCCACTTGCTGG - Intergenic
1031291604 7:119944262-119944284 TGGTAATCCCTGTGCATTGGAGG - Intergenic
1032633475 7:133680053-133680075 TCATAATCCCTGCAAATTAGAGG + Intronic
1034897481 7:154886702-154886724 TGACATTCCCTGCAGGTTGGAGG + Intronic
1039041201 8:33410382-33410404 TGGTATGCACTGCAAATAGCTGG + Intronic
1039327024 8:36496771-36496793 TGGTATTTCATGCAAATGGTTGG + Intergenic
1039404477 8:37300903-37300925 TGGGCTTCCCTGCAACGTGGTGG - Intergenic
1040485553 8:47868298-47868320 TTGTAATCCCAGCAATTTGGAGG + Intronic
1043464827 8:80494415-80494437 TTGTATTCTCTACAAGTTGGTGG + Intronic
1043600160 8:81928124-81928146 TGGTTGTCACTGCAAATGGGAGG - Intergenic
1044987458 8:97767967-97767989 TTGTAATCCCTGCTACTTGGGGG + Intergenic
1045556952 8:103223885-103223907 TAGCATTCCCCTCAAATTGGTGG - Intronic
1048627172 8:136197939-136197961 TGGTATGCTCTGCAAATGTGAGG - Intergenic
1050409152 9:5343573-5343595 TGGTATTCACAGCAACCTGGTGG + Intergenic
1051840415 9:21391239-21391261 TGTGCTTCCCTGTAAATTGGAGG + Intergenic
1052264655 9:26558032-26558054 TGGTAATCCCAGCTACTTGGGGG + Intergenic
1053751135 9:41256781-41256803 TTGTAATCCCTGCATCTTGGCGG + Intergenic
1054256655 9:62821110-62821132 TTGTAATCCCTGCATCTTGGCGG + Intergenic
1054334655 9:63794502-63794524 TTGTAATCCCTGCATCTTGGCGG - Intergenic
1054721447 9:68608130-68608152 TGGTGAACCCTGCAATTTGGAGG + Intergenic
1054801285 9:69351671-69351693 TTGTAATCCCAGCAATTTGGCGG - Intronic
1058958718 9:109972685-109972707 TGGCATTCCCTGCAGACTGGTGG - Intronic
1060591134 9:124817583-124817605 TGGTAATCCCAGCACTTTGGGGG + Intergenic
1061653603 9:132070432-132070454 TTGTAGTCCCTGCTACTTGGGGG + Intronic
1185627030 X:1489804-1489826 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627125 X:1490457-1490479 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627145 X:1490588-1490610 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627177 X:1490807-1490829 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627189 X:1490895-1490917 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627214 X:1491075-1491097 AGATATTCCCTGCAAATGTGGGG + Intronic
1187500612 X:19835490-19835512 TTCTATTCCTTGCAAAATGGAGG - Intronic
1188911126 X:35849090-35849112 TGGTAATCCCTGTATTTTGGTGG - Intergenic
1191624438 X:63255102-63255124 TGGTATTCCCTGAAGATTCTTGG + Intergenic
1194115377 X:89889777-89889799 TGCTATGCCCTGGGAATTGGAGG - Intergenic
1196644266 X:118099693-118099715 TTGTAGTCCCAGCAACTTGGTGG + Intronic
1196910108 X:120476458-120476480 TCCTATTTCCTCCAAATTGGGGG - Intergenic
1197047394 X:122014281-122014303 TAGTCTTTTCTGCAAATTGGAGG + Intergenic
1197248178 X:124188026-124188048 TGGTATTGCCTGCATACTTGAGG + Intronic