ID: 1162103076

View in Genome Browser
Species Human (GRCh38)
Location 19:8352432-8352454
Sequence GAGGAGGGAAGTTGTTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162103076_1162103083 0 Left 1162103076 19:8352432-8352454 CCTCTTAAACAACTTCCCTCCTC 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1162103083 19:8352455-8352477 CCCCACATTCCTAATACCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 143
1162103076_1162103081 -1 Left 1162103076 19:8352432-8352454 CCTCTTAAACAACTTCCCTCCTC 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1162103081 19:8352454-8352476 CCCCCACATTCCTAATACCCTGG 0: 1
1: 0
2: 1
3: 6
4: 110
1162103076_1162103087 9 Left 1162103076 19:8352432-8352454 CCTCTTAAACAACTTCCCTCCTC 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1162103087 19:8352464-8352486 CCTAATACCCTGGGTGTTCATGG 0: 1
1: 0
2: 0
3: 10
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162103076 Original CRISPR GAGGAGGGAAGTTGTTTAAG AGG (reversed) Intronic
900423546 1:2566140-2566162 GAGGAGGTGAGGTGTTTAGGTGG - Intergenic
903783061 1:25834898-25834920 GAGGAGTGAGTTTGTTTAGGTGG - Exonic
903950186 1:26992115-26992137 GTGGAGGGACGTTCTTTATGTGG - Intergenic
905190174 1:36227598-36227620 GAGGAAGGAAGGGGTTTCAGGGG + Intronic
906590614 1:47021615-47021637 GAGGCTGGAAGGTGTTGAAGAGG - Intergenic
907226262 1:52949914-52949936 GAGGAGGAAAGTCTTTGAAGAGG + Intronic
907328277 1:53654911-53654933 GAAGAGGGAAGTGGGTTGAGAGG + Intronic
911396065 1:97311932-97311954 GAGTAGGGATGGTGTTAAAGTGG + Intronic
913011562 1:114688544-114688566 CAGGAGGTAAGTGGTGTAAGGGG - Exonic
913700843 1:121373158-121373180 CAGGAGGGAAGTAGTATAAAAGG - Intronic
914041393 1:144053625-144053647 CAGGAGGGAAGTAGTATAAAAGG - Intergenic
914136692 1:144906865-144906887 CAGGAGGGAAGTAGTATAAAAGG + Intronic
914813460 1:151046610-151046632 GAGGAGAGAAGTGGTTCAGGGGG - Intronic
915772134 1:158436892-158436914 GAAAAGAGAAGTTGTTTAATAGG - Intergenic
915820920 1:159022837-159022859 GGGGAGGAAAGTTTTTGAAGAGG + Intronic
916394849 1:164374708-164374730 GAGGAAGGATTTTGTTAAAGGGG - Intergenic
916398260 1:164415682-164415704 GAGGAGGGAAGTTCAATAAGAGG + Intergenic
917226659 1:172790802-172790824 GAGGAGGGAAGGAGGTTCAGAGG + Intergenic
917995082 1:180429222-180429244 GAAATGGGAAGTTGTTTAATGGG - Intronic
918502703 1:185216180-185216202 GAGGAAAGAATTTATTTAAGGGG + Intronic
919079629 1:192854648-192854670 GAGGAGGGAGGATGTTTATATGG + Intergenic
919554336 1:199031851-199031873 GAGGAGGAAAGTGGTTTCATGGG - Intergenic
920156569 1:203956779-203956801 GAGGAGGGAAGGTCTTTTATTGG + Intergenic
920488262 1:206391894-206391916 CAGGAGGGAAGTAGTATAAAAGG - Intronic
921192995 1:212726291-212726313 GAGTAGAGTAGTTGTTTATGGGG - Intronic
921342132 1:214144874-214144896 GGGGAGGGAAGTCTTTGAAGAGG + Intergenic
922024146 1:221735142-221735164 GAAGAGGGAAATGGTTTAAAAGG - Intronic
922976668 1:229790465-229790487 GAGGAGGGAAGTCTTTGAAGAGG - Intergenic
923383688 1:233446383-233446405 GAGGAGGGAATTCGGCTAAGTGG - Intergenic
924045183 1:240021906-240021928 GAGGAGGGCAGTATTTGAAGTGG - Intronic
924261855 1:242239706-242239728 GAGGGGACAAGTTGGTTAAGCGG - Intronic
924899087 1:248375411-248375433 GAGAAGAGAAGTTTTTTATGTGG - Intergenic
1064823971 10:19374011-19374033 GCGCTGGGAAATTGTTTAAGCGG + Intronic
1065897277 10:30175103-30175125 ATGAAGGGAAGTTGGTTAAGGGG - Intergenic
1067932853 10:50580763-50580785 GAGAAGGGGAGTTGTTTAATGGG + Intronic
1068810609 10:61251658-61251680 GAGGAGAGAAAGTATTTAAGGGG + Intergenic
1068857213 10:61809932-61809954 GAGGAGAGAAGTGGTATGAGGGG - Intergenic
1069107879 10:64405790-64405812 GAGGAGGGCATTTGTGTAAATGG + Intergenic
1069452806 10:68530704-68530726 GAGGAGGAAAGTCTTTGAAGAGG + Intergenic
1069986028 10:72284576-72284598 GAGGAAATAAGTTGTTTAACGGG - Intergenic
1070671777 10:78382496-78382518 GAGGAAGGAGGATGTTTAGGAGG - Intergenic
1071226026 10:83528424-83528446 GAGGAGTGAGGTTGGTTAATTGG + Intergenic
1072813934 10:98486379-98486401 CAGGAGAGAAGTTGTCTGAGAGG + Intronic
1073848393 10:107586162-107586184 GGGGAGGAAAGTTTTTGAAGAGG - Intergenic
1075228881 10:120654643-120654665 GAGAAGGGGAGTTGTTTAATGGG + Intergenic
1075808841 10:125209735-125209757 GAGGAGACAATTTGTTTGAGAGG - Intergenic
1076460334 10:130639825-130639847 GAGCAGAGAAATTGTTGAAGAGG + Intergenic
1076812982 10:132898807-132898829 GAGGAGGGGAGGGGGTTAAGGGG - Intronic
1078358069 11:10647564-10647586 GAGGATGGGAGTTGTTCAGGTGG + Intronic
1078394909 11:10972470-10972492 GAGGAGAGAACTTGTTTGAGAGG - Intergenic
1080008288 11:27432248-27432270 GGGGAGAGAAGGTGTTCAAGTGG - Intronic
1081686338 11:45045884-45045906 GAGGAGGGAAGTTATTCAGTGGG - Intergenic
1082979385 11:59106129-59106151 AAGGAGAGAAGATGGTTAAGTGG - Intergenic
1083362343 11:62119229-62119251 GAGGAGGGAGGTTGATCAATGGG + Intergenic
1086038059 11:82440856-82440878 GAGAAGGGAAATTGGTTAACGGG - Intergenic
1086220488 11:84437501-84437523 GAGGTGGGAAGTTGATTGTGCGG - Intronic
1087091855 11:94281711-94281733 GAGGAGGGGAGGTGGTAAAGGGG + Intergenic
1087340504 11:96899724-96899746 GAGGAGGGAAAATGTTTAATAGG - Intergenic
1087425479 11:97980637-97980659 AAGGAGGGAGGTTGTTGGAGTGG + Intergenic
1089070208 11:115693918-115693940 GAGGAGGGGAGTTATTTAATGGG - Intergenic
1089556843 11:119319825-119319847 GAGGAAGGAAGCTGATAAAGAGG + Intronic
1089735455 11:120547518-120547540 GAGGGAGGAAGGTGTTTGAGGGG + Intronic
1090393613 11:126405428-126405450 AGGGAGGGAAGGTGTTTAAATGG - Intronic
1090911252 11:131121552-131121574 GAGGAGGGAAGTTGCATCTGAGG + Intergenic
1092518410 12:9240253-9240275 GAAGAAGGAAGTTGTGGAAGAGG - Intergenic
1092564896 12:9654310-9654332 GATGAGGGAAGTTGTACGAGAGG + Intergenic
1092796073 12:12111219-12111241 GAAGAAGGAAGTTGTGGAAGAGG + Intronic
1095511528 12:42955942-42955964 AAAAAGGGAAGTTGGTTAAGTGG + Intergenic
1095829888 12:46573490-46573512 GAGGAGGTAGGTTCTTTTAGAGG + Intergenic
1096282252 12:50266423-50266445 GAGGTGGGAAGATGTTCAAGAGG - Intronic
1096874378 12:54615729-54615751 GAGGATGGAAGTTGTTCTTGGGG + Intergenic
1097999608 12:65925847-65925869 AAGGAAGGAAGTTGTGAAAGGGG + Intronic
1099957047 12:89361061-89361083 GAGGAGAGAAGTGGTAGAAGAGG - Intergenic
1100597489 12:96084254-96084276 AAGGAGGGGATTTGTTTAAGGGG + Intergenic
1101734663 12:107453990-107454012 AAGGAGAGAACTGGTTTAAGGGG + Intronic
1101940237 12:109094454-109094476 GATGGGCGAAGTTGATTAAGAGG - Intergenic
1102590179 12:113950864-113950886 AAGGACGGAAGATGTTTATGGGG - Intronic
1103011735 12:117463279-117463301 GGGGAGAGAACTTGTTTCAGCGG - Exonic
1103358364 12:120338749-120338771 GAGAAGGAGAGTTGTTTAATGGG - Intergenic
1106207261 13:27611451-27611473 GAAATGGGAAGTTGTTTAATGGG + Intronic
1106436706 13:29729681-29729703 GAGGAGGGGAGTGGACTAAGAGG - Intergenic
1107838462 13:44431949-44431971 GAGAAGGAAAGATTTTTAAGGGG - Intergenic
1109419530 13:62093050-62093072 GAAGAGGGAAATTGTTCAAAGGG + Intergenic
1110798624 13:79669688-79669710 GAGGAGGGAACATGTATGAGAGG - Intergenic
1110965516 13:81690124-81690146 GAAGAAGGAAGTTGTGGAAGAGG + Intergenic
1113202581 13:107883412-107883434 GAGGATGGAACATGTTGAAGAGG + Intergenic
1114923745 14:27366386-27366408 GAAGAGAGATGTTGTTCAAGGGG + Intergenic
1116186352 14:41605560-41605582 GAGGAGTGAAGTGCTTTAGGTGG - Intergenic
1116563764 14:46418615-46418637 GTGGAGAGAATTTTTTTAAGTGG + Intergenic
1119610719 14:76059613-76059635 GGGAAGGGAAGATGTTTCAGGGG - Intronic
1121190670 14:92026622-92026644 GAAGAAGGAAGTTGTGGAAGAGG + Intronic
1121939632 14:98057543-98057565 GACGTGGGGAGTTGTTTAGGAGG - Intergenic
1125456049 15:39859816-39859838 GAAAAGGGGAGTTGTTTAATGGG + Intronic
1125544896 15:40496023-40496045 GAGGAGGGAAAGCATTTAAGAGG - Intergenic
1126214455 15:46138441-46138463 GATGAGGCAAGATGTGTAAGAGG - Intergenic
1127512095 15:59652953-59652975 GAGGAGGGAAGTCATTCCAGAGG + Intronic
1127557144 15:60098906-60098928 GAAGAAGGAAGTTCTTCAAGAGG - Intergenic
1127578156 15:60312702-60312724 GAGCAGGGATGTTGGTAAAGAGG + Intergenic
1129702071 15:77773919-77773941 GAGGAGAGATGTTGTTTGTGGGG - Intronic
1130246366 15:82253378-82253400 GAGAAGTGAAGTTGATTGAGGGG + Intronic
1130807977 15:87347018-87347040 GGGGAGGGATGTTGATTATGGGG + Intergenic
1131251432 15:90833071-90833093 GAAGAGGGAGGATGTTTGAGGGG + Intergenic
1135291853 16:21246550-21246572 GGGGAGGAAAGTTTTTGAAGAGG + Intronic
1135810048 16:25578753-25578775 GGGGAGGGAAGTCTTTGAAGAGG + Intergenic
1136373319 16:29849413-29849435 AGGGAGGGAGGTGGTTTAAGGGG - Intergenic
1137980990 16:53069411-53069433 GGGAAGGGGAGTTGTTTAATGGG - Intronic
1138533446 16:57647238-57647260 GAGGAGGGAAGTTTTCTGGGTGG + Intronic
1140346651 16:74219957-74219979 GTGGAGGGAGGTTCCTTAAGAGG - Intergenic
1140533186 16:75684364-75684386 GTGGAGGGAAGGTGTTTAAATGG + Intronic
1141431091 16:83970458-83970480 GAGGAGGGGTGATGTTTGAGAGG + Intronic
1142253992 16:89005353-89005375 CAGGAGCAAAGTTGTTTATGTGG - Intergenic
1146654957 17:34629716-34629738 GAGCCTGGAAGCTGTTTAAGAGG + Intronic
1148498503 17:48070663-48070685 GAGGAGGGAAGGTCTTTTATTGG - Exonic
1149564443 17:57631098-57631120 GAGGTGGGAAGTGGGTAAAGTGG - Intronic
1149674114 17:58443475-58443497 GAGCAGGCAAGTTGATTAACGGG - Intronic
1149826872 17:59836505-59836527 GAGGGGTGAAGTTGTTAAAAAGG - Intronic
1151339674 17:73462787-73462809 GAGGTGGGAAGATGTTGGAGTGG - Intronic
1152385625 17:79972660-79972682 GAGATGGGGAGTTGTTTAACGGG + Intronic
1152512226 17:80798214-80798236 AAGGAGGGAAGTTGGTTACAGGG - Intronic
1153397292 18:4638829-4638851 GAGCAGAGAAGATGTATAAGTGG + Intergenic
1153821740 18:8837958-8837980 GAGGAGGAAGGTTGTTTCAGCGG + Intergenic
1157688115 18:49659195-49659217 GGGTAGGGAAGTTATTTAAAAGG - Intergenic
1158001105 18:52620207-52620229 AAGGAGAGAAATTGTTTGAGAGG - Intronic
1158962691 18:62599641-62599663 GAGATGGGGAGTTGTTTAATGGG - Intergenic
1161388489 19:4009148-4009170 GGGGAGGGAAGATGTGAAAGGGG - Intronic
1162103076 19:8352432-8352454 GAGGAGGGAAGTTGTTTAAGAGG - Intronic
1165674091 19:37706589-37706611 GAGGAGGTAAGGTATTTCAGAGG + Intronic
926994878 2:18723990-18724012 GAGATGGGAAGCTGTTTAATGGG + Intergenic
927222147 2:20722470-20722492 GATGAGAGAAATTGGTTAAGGGG + Intronic
928288134 2:30011136-30011158 GAGGGGGGAAGTAGATTAAAAGG + Intergenic
928654862 2:33440012-33440034 GAGGAGAGAATGTGTTCAAGAGG + Intronic
929301376 2:40307390-40307412 GAAAAGGGGAGTTGTTTAATGGG + Intronic
930034682 2:47078109-47078131 GAGAAAGGAGGGTGTTTAAGGGG - Intronic
933786703 2:85848699-85848721 GAAAAGGGGAGTTGTTTAATAGG + Intronic
934161679 2:89255394-89255416 GAAGAGGGAAGTTGTCTACAAGG + Intergenic
934205605 2:89927021-89927043 GAAGAGGGAAGTTGTCTAAAAGG - Intergenic
934506105 2:94895779-94895801 GAGGAGGGGAGCAGTTGAAGGGG + Intergenic
935224236 2:101039073-101039095 GAAGAGGGAAGTTGATTTATGGG + Intronic
937468873 2:122158256-122158278 GAGAAGGGAGGTGGTTTAAGGGG + Intergenic
940588132 2:155683293-155683315 GAGGAGGGGAGATGATGAAGAGG + Intergenic
940713249 2:157187657-157187679 GAGGAGGGGAGTTAAATAAGGGG - Intergenic
941319532 2:164037889-164037911 GAGGAAAGAAGTTGATTAAAAGG + Intergenic
942003640 2:171675911-171675933 GAGCAGAGAAATTGTTTTAGTGG - Intergenic
942012990 2:171782774-171782796 GAGTAGGGATGATGTTAAAGTGG + Intergenic
942745730 2:179229940-179229962 GAGCAGGGCTGTTGTTTTAGGGG - Intronic
943465479 2:188223730-188223752 TATGAGGGAAGTTGCTTAAGGGG - Intergenic
944435386 2:199683550-199683572 TAGGTGGGAAGTTGGCTAAGTGG + Intergenic
945240156 2:207669186-207669208 GAAGTGGGGAGTTGTTTAATGGG - Intergenic
945358548 2:208867669-208867691 GTGGAGGGCAGTTTTTTATGTGG - Intergenic
946768281 2:223060484-223060506 GAGGAGGGAAATTGTCAAACAGG + Intronic
947287830 2:228537342-228537364 TAGGAGGCTAGTTTTTTAAGGGG - Intergenic
947641870 2:231711359-231711381 GAAGAAGGAAGTTGTGGAAGAGG + Exonic
948814170 2:240501443-240501465 GAGGAGGCAAGTTCTATCAGGGG + Intronic
1171250787 20:23645400-23645422 GAGAAGAGAAGTTGGTGAAGGGG - Intergenic
1172305011 20:33874569-33874591 GATGGGGGAATGTGTTTAAGAGG + Intergenic
1172311229 20:33919830-33919852 GAAACGGGAAGTTGTTCAAGGGG + Intergenic
1172709732 20:36912263-36912285 AAGGAGGGAAGTGGATAAAGGGG - Intronic
1173234087 20:41227954-41227976 GAGCAAGGAAGTTGAATAAGTGG - Intronic
1173475314 20:43355014-43355036 AAGGAAGGTAGTTGTTTATGCGG + Intergenic
1174230951 20:49045258-49045280 GAGGAGGGCAGGGGTTTAGGAGG + Intergenic
1175567132 20:59989180-59989202 AAGAAGGGCGGTTGTTTAAGTGG + Intronic
1177498942 21:21925652-21925674 GAGGACAGAAGGTGTTTACGAGG + Intergenic
1178516464 21:33251774-33251796 GAAGAGGCAAGGTGTTTAAAGGG + Intronic
1179191783 21:39128750-39128772 GATATGGGAAGTTGTTTAATGGG - Intergenic
1180673132 22:17568976-17568998 GGGGAGGAAAGTCTTTTAAGAGG + Intronic
1181788662 22:25246085-25246107 GAGGAGTGAAGTTGATTGCGAGG - Intergenic
1182515583 22:30857000-30857022 CAGGAAGGAAGTTGCTTAAGAGG - Intronic
955148542 3:56344302-56344324 GAGGAGGGAAGGTGTTTGCCAGG - Intronic
955769571 3:62373927-62373949 GAGGGGGGAACTTGTTAATGGGG + Intronic
955929040 3:64037262-64037284 AAGGAGGGAAGTTGTTTTCAGGG + Intergenic
956506123 3:69942182-69942204 GAAAAGGGGAGTTGTTTAATGGG + Intronic
957498134 3:81017273-81017295 GAGGAGGTAAGGTGTGGAAGGGG - Intergenic
963491357 3:146005342-146005364 GAAAAGGGAAGTTGTTTAATTGG + Intergenic
963804363 3:149708446-149708468 GAGATGGGGAGTTGTTTAATGGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
967048969 3:185764588-185764610 GAGAAGGGAGGTTGTTTCACAGG + Intronic
967193523 3:187005976-187005998 GATGAGGGAAGTGGTGCAAGTGG + Intronic
967839546 3:193994156-193994178 GAGGGGGGAAGTAGTTGATGAGG - Intergenic
968455198 4:694322-694344 GGGGAGGAAAGTTTTTGAAGAGG - Intergenic
970105597 4:12579408-12579430 GAGAATGGAAGTCGTTTCAGGGG - Intergenic
970883982 4:20965463-20965485 ATGGAGGGAAATTTTTTAAGTGG - Intronic
972702007 4:41503370-41503392 GGGGAGGAAAGTTGCTCAAGTGG + Intronic
974980781 4:68954828-68954850 GAGGAGGAAAGTCTTTGAAGAGG - Intergenic
975580131 4:75898982-75899004 GATGAGGAAAGTTGATTAACAGG - Intronic
977988381 4:103413017-103413039 GAGGAGGAAAGTCTTTGAAGAGG + Intergenic
978877307 4:113657064-113657086 GTGGATGGAAGATTTTTAAGAGG - Intronic
979492002 4:121338878-121338900 GAGGAGGGGAGTTATTTAAAAGG - Intronic
979910031 4:126353012-126353034 GGTGAGGAAAGTTTTTTAAGTGG + Intergenic
981167365 4:141577151-141577173 GAGGAAGGAGCTTGTTTGAGAGG - Intergenic
981674506 4:147325587-147325609 TAAAGGGGAAGTTGTTTAAGTGG - Intergenic
982269598 4:153572845-153572867 GCTGAGGGAAGGTGTTTAATGGG - Intronic
983307456 4:166009959-166009981 GAAAAGAGAAGTTGTTTAATAGG - Intronic
983862465 4:172724679-172724701 AAGAAGGGAAGTTATTGAAGTGG + Intronic
984615447 4:181891866-181891888 AAGGGGAGAGGTTGTTTAAGAGG + Intergenic
985610009 5:882264-882286 GTGTTGGGAAGTTGTTTATGTGG - Intronic
985610025 5:882381-882403 GTGTTGGGAAGTTGTTTATGTGG - Intronic
986830568 5:11572589-11572611 GAGGAGGGAAGAAGTTGAAGTGG - Intronic
987264502 5:16238009-16238031 TAAGAGGGAAGTTGTTTAAATGG - Intergenic
987910011 5:24129703-24129725 GAGGAGAGAAGTTGACTAAAAGG + Intronic
988418312 5:30974452-30974474 GAGGAGGGAAGGAGTTGCAGAGG - Intergenic
991640040 5:68743079-68743101 CAGTAGGGAAGTTGGTTACGAGG + Intergenic
994781543 5:104095767-104095789 GAGGGGGAAAGTGGTTTAATGGG - Intergenic
994997012 5:107076862-107076884 GAGGAGGCAAGTGGTCCAAGAGG - Intergenic
995654205 5:114406363-114406385 GAGGAGTGAAGTTGTGAAAGGGG - Intronic
996055096 5:118973852-118973874 GAAGAAGGAAGTTGTGGAAGAGG + Intronic
996597293 5:125219930-125219952 GAAGAGGGGAGTTGTTCAATGGG + Intergenic
996717510 5:126599813-126599835 GGGGAGGAAAGTTTTTGAAGAGG - Intergenic
999347019 5:150832497-150832519 GAGGAGGAAAGTCTTTGAAGAGG + Intergenic
1002820144 6:717240-717262 GAGAAGGGAAGTGTTCTAAGTGG + Intergenic
1003867224 6:10374422-10374444 GAGGAGGCAACTTATATAAGTGG + Intergenic
1006824655 6:36925888-36925910 GAGGTGGGGAGTTGGTTAGGTGG - Intronic
1010717278 6:79244259-79244281 GAAAAGGGAAGTTGTTTGATGGG - Intergenic
1011202848 6:84856486-84856508 GAGGAGGGATGTAGTTCAAGTGG - Intergenic
1013934090 6:115572130-115572152 AATGAGGGAAGTTGATCAAGAGG + Intergenic
1014480248 6:121927428-121927450 GAGGAGTGTTGATGTTTAAGGGG + Intergenic
1017081972 6:150678265-150678287 AAGGAGAGATGTTGTTCAAGTGG - Intronic
1017335769 6:153257957-153257979 GAGAAGGGATGTTGTCTAAGAGG + Intergenic
1017510220 6:155107751-155107773 GAGGGGGGTACTTGTTTAAGAGG + Intronic
1017534360 6:155330601-155330623 GAGAAGGGAAAGTGGTTAAGAGG + Intergenic
1018111502 6:160540891-160540913 GAGGAGGGAAGTGTTTCTAGAGG - Intronic
1019266747 7:121478-121500 GAGGAGGGAAGATGGGAAAGAGG + Intergenic
1020475216 7:8586286-8586308 GTGGAGGGAGGTTGTATAAATGG + Intronic
1020916827 7:14204989-14205011 GAAGAATGAAGTTGATTAAGAGG - Intronic
1022624655 7:32022518-32022540 GGGGAATGAAGTGGTTTAAGGGG + Intronic
1023504493 7:40885768-40885790 GAGAAGGGAAGTGTTTTATGTGG - Intergenic
1024720927 7:52136947-52136969 GAGGAGGGAGGATGATAAAGAGG + Intergenic
1026369051 7:69680583-69680605 GAGGGGAGTTGTTGTTTAAGGGG - Intronic
1026911628 7:74094709-74094731 GAGGACGGAAGTTGGTGAGGGGG - Intronic
1028832290 7:95341136-95341158 ATTGAGGGAAGTTCTTTAAGGGG - Intergenic
1029190466 7:98768131-98768153 CAGGAGGGAAGTTGAGTAAATGG + Intergenic
1032075544 7:128834069-128834091 GAGGGGAGAAGATGTGTAAGGGG + Intronic
1032211068 7:129914476-129914498 CTGGAGGGGAGTTGTTTAAAAGG - Intronic
1032436750 7:131907130-131907152 GAGGAGGGAGGCTGCTGAAGTGG + Intergenic
1033093047 7:138404445-138404467 GAAGAAGGAAGTTGTGGAAGAGG - Intergenic
1034585013 7:152082724-152082746 GGGGAGGAAAGTTTTTGAAGAGG + Intronic
1037463982 8:19141043-19141065 GAAGAGGGGAGTTCTTTAAAGGG - Intergenic
1037592875 8:20328250-20328272 GAGGAGGGAAGATGCTTATCAGG - Intergenic
1038513397 8:28161940-28161962 AAGGAAGGAAGTTCATTAAGAGG - Intronic
1039023404 8:33231679-33231701 GAGAAGGGAGGTTGGTAAAGGGG - Intergenic
1039379819 8:37074639-37074661 GAGCAGGAAAGTTCCTTAAGTGG - Intergenic
1040355748 8:46617042-46617064 GAGGAGGGAGGCAGTTTAAGGGG + Intergenic
1041621067 8:59970104-59970126 AAGATGGGAAGTTGTTTAATGGG - Intergenic
1042737556 8:72005513-72005535 GTGGAGGGCAGTTTTTTCAGTGG + Intronic
1044524453 8:93236526-93236548 GAGGAGGGAATTGGTTTTACAGG - Intergenic
1046382196 8:113466130-113466152 GAGGAAGGAAGTGGTTTTATTGG - Intergenic
1047800541 8:128305081-128305103 AAGGAGAGAAGTTGGCTAAGTGG + Intergenic
1048032639 8:130647205-130647227 GGGAAGGTAAGTTGGTTAAGGGG + Intergenic
1051607111 9:18926989-18927011 GAGGAGGGACTTTGTTAAAGAGG - Intergenic
1051718314 9:20008765-20008787 GAGGATGGAAGTGGAGTAAGTGG - Intergenic
1053569914 9:39293632-39293654 GAGGAGGCAAGTACTATAAGGGG + Intergenic
1053835877 9:42134662-42134684 GAGGAGGCAAGTACTATAAGGGG + Intergenic
1054091544 9:60852634-60852656 GAGGAGGCAAGTACTATAAGGGG + Intergenic
1054112959 9:61128208-61128230 GAGGAGGCAAGTACTATAAGGGG + Intergenic
1054127235 9:61325378-61325400 GAGGAGGCAAGTACTATAAGGGG - Intergenic
1054594754 9:67053983-67054005 GAGGAGGCAAGTACTATAAGGGG - Intergenic
1056431084 9:86528645-86528667 GAGGAGGGAAGTGCTTGAATAGG + Intergenic
1056628790 9:88275783-88275805 GAGGAGAGGAGTGGTTTCAGTGG - Intergenic
1057649751 9:96910132-96910154 GAAGAAGGAAGTTGTGAAAGAGG + Intronic
1057889451 9:98858048-98858070 GTGAAGTGAAGTTGGTTAAGGGG - Intergenic
1058755380 9:108078566-108078588 TAGGAGGGAAGTTGATGACGAGG - Intergenic
1058755429 9:108078952-108078974 GAAGAGGGAAGTTGTGGGAGGGG - Intergenic
1058917238 9:109579301-109579323 AAGGAGGGAAGTGTCTTAAGAGG + Intergenic
1059129796 9:111734961-111734983 GAGGAGGGAAGTGGGGGAAGGGG - Intronic
1059457862 9:114411194-114411216 GAGGAGGGAGGTGGTGTGAGAGG - Intronic
1061450695 9:130665598-130665620 GCGGAGGGGACTTGTTTAAAAGG - Intronic
1185513958 X:684520-684542 GGGGAGGGAAGTCTTTGAAGAGG + Intergenic
1186073242 X:5846348-5846370 GAAAAGGGAAGTTGAATAAGTGG + Intronic
1186286985 X:8055701-8055723 GAGGAAAGAAGATGTTTAATGGG - Intergenic
1187298209 X:18023185-18023207 GAGAAGAGCAGTTGGTTAAGTGG - Intergenic
1187366882 X:18673235-18673257 GAAAAGGGGAGTTGTTTAATAGG + Intergenic
1187929347 X:24279714-24279736 GAGGAGTCAAGTTGTTTACTGGG - Intergenic
1189803159 X:44710127-44710149 AAGGTGGGGAGGTGTTTAAGGGG - Intergenic
1190973161 X:55372288-55372310 GAGAAGAGAAGTTGGTTAATGGG - Intergenic
1191090102 X:56610782-56610804 GATGAGAGAAGTTGGTTAATGGG + Intergenic
1192348640 X:70335394-70335416 GGAAAGGGAAGTTGTTTAATGGG + Intronic
1192360675 X:70436823-70436845 GAGGAAGGAACCTGTTAAAGGGG + Intergenic
1192362554 X:70448836-70448858 GAGGAGGCAGGTTGACTAAGGGG + Intronic
1193383992 X:80849328-80849350 GAGGAGAGAAATTGTTTGAAAGG - Intergenic
1194960471 X:100229508-100229530 ATGAAGGGAAGTTGTTTAATGGG - Intergenic
1195025416 X:100872259-100872281 GAGGAGAGAAGTTTATTTAGAGG + Intronic
1195028790 X:100906187-100906209 GATGAGGGATGTTGATGAAGAGG - Intergenic
1197299326 X:124758885-124758907 GAAGAGGGAAGTTGTTTAATGGG + Intronic
1199312168 X:146333185-146333207 GAGGAGGAAAGTCTTTGAAGAGG + Intergenic
1200762475 Y:7052958-7052980 GGGGAGGAAAGTTTTTGAAGAGG + Intronic
1201785990 Y:17779706-17779728 GGGGAGGGAAGTTGTTTGGAAGG - Intergenic
1201815563 Y:18126282-18126304 GGGGAGGGAAGTTGTTTGGAAGG + Intergenic