ID: 1162103357

View in Genome Browser
Species Human (GRCh38)
Location 19:8354163-8354185
Sequence CGGGGCCGCGGTTGTCAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 29}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162103346_1162103357 9 Left 1162103346 19:8354131-8354153 CCAGAGGGCGCTGCTATCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 55
Right 1162103357 19:8354163-8354185 CGGGGCCGCGGTTGTCAAACCGG 0: 1
1: 0
2: 1
3: 1
4: 29
1162103344_1162103357 12 Left 1162103344 19:8354128-8354150 CCACCAGAGGGCGCTGCTATCTA 0: 1
1: 0
2: 0
3: 10
4: 65
Right 1162103357 19:8354163-8354185 CGGGGCCGCGGTTGTCAAACCGG 0: 1
1: 0
2: 1
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162103357 Original CRISPR CGGGGCCGCGGTTGTCAAAC CGG Intronic
915279386 1:154812122-154812144 CGTGGCAGCGGTTCTCAATCAGG - Intronic
919980821 1:202642234-202642256 CGGGGCAGGGGGTGTCAAAGTGG - Intronic
1071511150 10:86263340-86263362 CGGGGCCGCGGTGGGCCAGCTGG + Intronic
1077144012 11:1036818-1036840 GGGCGCCGCGGTGGCCAAACAGG + Intergenic
1091451717 12:576259-576281 CGGCGCCGCCGTTGTCCACCAGG + Intronic
1092084451 12:5744187-5744209 CGGTGGCAGGGTTGTCAAACAGG + Exonic
1099926428 12:89024188-89024210 CAGGGCAGTGGTTCTCAAACTGG + Intergenic
1104600505 12:130150235-130150257 TGGGGCCGTGTTTGCCAAACTGG + Intergenic
1105443862 13:20436183-20436205 GGGGGCCGCGGCTGGCAGACTGG - Intronic
1106160394 13:27196203-27196225 AGGGGCCGTGGGTCTCAAACAGG + Intergenic
1117080772 14:52150230-52150252 AGGGGCCGCAGTTGTCAGACAGG + Intergenic
1122582292 14:102778035-102778057 CGGGGCCGCGGGTTTCACGCGGG + Intronic
1133208204 16:4246796-4246818 GCGGGCCTCAGTTGTCAAACAGG + Intergenic
1134803793 16:17108156-17108178 CTGGGCAGTGCTTGTCAAACTGG + Exonic
1143256634 17:5562416-5562438 AGGGGCCGTGGTTGGCAGACAGG - Intronic
1145246904 17:21275541-21275563 CGTGGCCGAGGCTGTTAAACCGG - Intergenic
1152231616 17:79116843-79116865 CAGGGCAGTGGTTGTCAAAGTGG + Intronic
1162079508 19:8209718-8209740 CGAGGACGCGGCTGTGAAACGGG + Intronic
1162103357 19:8354163-8354185 CGGGGCCGCGGTTGTCAAACCGG + Intronic
933808471 2:86017249-86017271 TAGGGCCGAGGTTCTCAAACTGG + Intergenic
1169065727 20:2693276-2693298 CGGGGCCGCGGTCGTCGGAGGGG - Intronic
1176029413 20:63004913-63004935 CGGGGCCGCGGGGCGCAAACCGG + Intergenic
1184062198 22:42090416-42090438 CGGCGGCGCGGTGGTCAGACCGG - Intronic
972671252 4:41215298-41215320 CAGGGCAGCGGTTGTCAAACTGG + Intronic
979536208 4:121823489-121823511 CGGGTCCGCGGTTGTTGGACGGG + Exonic
1006294039 6:33161882-33161904 CGAGGCCGCGGATGCGAAACCGG + Intergenic
1019427725 7:985236-985258 CGGGGTCCCGGTAGTCAAATCGG - Exonic
1024645863 7:51369744-51369766 AGGGGCCACAGTTGGCAAACAGG - Intergenic
1025036723 7:55597861-55597883 AGGGGCCACAGTTGGCAAACAGG - Intergenic
1032075793 7:128835552-128835574 CGGGGGCGCAGTTGTCCACCAGG - Exonic
1062559884 9:137136781-137136803 CGGGGCCGCAGCTGTCAGAGTGG + Intergenic
1199570612 X:149263531-149263553 GGAGGCAGTGGTTGTCAAACTGG - Intergenic