ID: 1162103970

View in Genome Browser
Species Human (GRCh38)
Location 19:8358685-8358707
Sequence CCTAATCTTTTATTTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1500
Summary {0: 1, 1: 1, 2: 8, 3: 159, 4: 1331}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162103959_1162103970 22 Left 1162103959 19:8358640-8358662 CCTCCCAAAGTGCTAGGATTACA 0: 22138
1: 313177
2: 258607
3: 141974
4: 131406
Right 1162103970 19:8358685-8358707 CCTAATCTTTTATTTTTTGGAGG 0: 1
1: 1
2: 8
3: 159
4: 1331
1162103962_1162103970 18 Left 1162103962 19:8358644-8358666 CCAAAGTGCTAGGATTACAGGCG 0: 7600
1: 143979
2: 282423
3: 215359
4: 145953
Right 1162103970 19:8358685-8358707 CCTAATCTTTTATTTTTTGGAGG 0: 1
1: 1
2: 8
3: 159
4: 1331
1162103963_1162103970 -9 Left 1162103963 19:8358671-8358693 CCGCCACGCCCAGCCCTAATCTT 0: 1
1: 16
2: 214
3: 1616
4: 7746
Right 1162103970 19:8358685-8358707 CCTAATCTTTTATTTTTTGGAGG 0: 1
1: 1
2: 8
3: 159
4: 1331
1162103957_1162103970 28 Left 1162103957 19:8358634-8358656 CCTCGGCCTCCCAAAGTGCTAGG 0: 7193
1: 136299
2: 273280
3: 205953
4: 123893
Right 1162103970 19:8358685-8358707 CCTAATCTTTTATTTTTTGGAGG 0: 1
1: 1
2: 8
3: 159
4: 1331
1162103961_1162103970 19 Left 1162103961 19:8358643-8358665 CCCAAAGTGCTAGGATTACAGGC 0: 15701
1: 240057
2: 272945
3: 174764
4: 138480
Right 1162103970 19:8358685-8358707 CCTAATCTTTTATTTTTTGGAGG 0: 1
1: 1
2: 8
3: 159
4: 1331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162103970 Original CRISPR CCTAATCTTTTATTTTTTGG AGG Intronic
900048571 1:528449-528471 CATATTCTTTTTTTTTTTTGAGG + Intergenic
900549082 1:3244928-3244950 GCTGATCTCCTATTTTTTGGGGG + Intronic
900729756 1:4248525-4248547 CCCCTGCTTTTATTTTTTGGAGG + Intergenic
901046900 1:6402230-6402252 GCTAATTTTTTAATTTTTTGTGG - Intergenic
901134043 1:6981595-6981617 GCTAATTTTTAATTTTTTTGTGG + Intronic
901536914 1:9888546-9888568 CTTAATTTTTTTTTTTTTTGAGG - Intronic
901560481 1:10066282-10066304 GCTAATTTTTTATTTTTTGTGGG + Intronic
901578399 1:10219754-10219776 CTTTATTTTTTATTTTTTTGAGG - Intronic
901690667 1:10971145-10971167 CCTTTTCTTTTTTTTTTTTGAGG - Intronic
901701646 1:11047598-11047620 GCTAATTTTTTATTTTTGGTAGG + Intergenic
902433854 1:16384371-16384393 CCTTTTTTTTTTTTTTTTGGTGG - Intronic
902863425 1:19261814-19261836 ACTAATGTTTTTCTTTTTGGGGG - Intergenic
902881349 1:19373858-19373880 GTTTATATTTTATTTTTTGGAGG + Intronic
903495694 1:23765544-23765566 ACTAAGCATTTTTTTTTTGGGGG + Intergenic
904002465 1:27346595-27346617 GCTAATTTTTTATATTTTGTAGG - Intronic
904106996 1:28093295-28093317 CATGCTCTTTTTTTTTTTGGTGG - Intergenic
904549423 1:31303118-31303140 GCTAATTTTTTTTTTTTTTGAGG - Intronic
904630045 1:31834153-31834175 GCTAATTTTGTATTTTTTAGTGG - Intergenic
904760035 1:32796525-32796547 GCTAATTTTTTATTTTATTGTGG + Intronic
905044851 1:34988866-34988888 CCTAATCTTTTTTTCTTTGAAGG + Exonic
905056120 1:35095327-35095349 GCTAATTTTTTAATTTTTAGTGG - Intronic
905620927 1:39446488-39446510 TGTAATTTTTTTTTTTTTGGTGG + Intronic
905634465 1:39540393-39540415 CCTAGTCTCTAAATTTTTGGAGG - Intergenic
905696048 1:39974443-39974465 GCTAATTTTGTATTTTTTGTAGG - Intergenic
906624602 1:47314725-47314747 CATAATTTTTTTTTTTTTTGAGG + Intergenic
907066905 1:51493358-51493380 GCTAATTTTTATTTTTTTGGAGG - Intronic
907097860 1:51797933-51797955 GCTAATTTTTTATTTTTTGTAGG + Intronic
907253825 1:53162587-53162609 GTTAATTTTTTATTTTTTTGTGG - Intergenic
907256344 1:53181885-53181907 TATCATCTCTTATTTTTTGGGGG + Intergenic
907410793 1:54281929-54281951 GCTAATTTTTTATTTTTTGTAGG - Intronic
908074820 1:60504537-60504559 CCTGATGTTTTCTTTTTTAGTGG + Intergenic
908261148 1:62340045-62340067 GCTAATTTTTAAATTTTTGGTGG - Intergenic
908649415 1:66315431-66315453 TTTTATTTTTTATTTTTTGGAGG + Intronic
909211851 1:72834169-72834191 CCCAATGTTTTCTTTTTTTGTGG - Intergenic
909758876 1:79264712-79264734 TCTGATATTTTAATTTTTGGGGG - Intergenic
910205004 1:84741283-84741305 GCTAATCTTTTGATTTTTTGTGG + Intergenic
910563740 1:88620182-88620204 CATAATCCTATATTTCTTGGAGG - Intergenic
910975833 1:92904513-92904535 CTTAATTTTTTAATTTTTGTCGG + Intronic
911189914 1:94937884-94937906 CCTAATTTTTTTTTTTTTTTTGG + Intergenic
911631083 1:100184331-100184353 TCTTAACTTTTTTTTTTTGGTGG + Intergenic
911637791 1:100255093-100255115 ATTAATCTTTTCTTTTTTTGAGG + Intergenic
912256821 1:108068402-108068424 TTTAATCTTTCATTTTGTGGAGG - Intergenic
912319360 1:108696389-108696411 TATTATCTTTTATTTATTGGTGG + Intronic
912761560 1:112371820-112371842 GCTAATTTTTTATTTTTTGTAGG - Intergenic
912887136 1:113486813-113486835 CTTTATTTTTTATTTTTTCGTGG + Intronic
912934310 1:113989457-113989479 CTTGCTATTTTATTTTTTGGGGG + Intergenic
912954812 1:114147875-114147897 CTTCATGTTTTGTTTTTTGGTGG + Intronic
913432078 1:118806350-118806372 CCTAATCATTTATTTTTAATGGG + Intergenic
913589630 1:120311027-120311049 CCTTATTTTTTATTTTTTTGAGG + Intergenic
913618555 1:120587339-120587361 CCTTATTTTTTATTTTTTTGAGG - Intergenic
913672544 1:121111205-121111227 CGTAACTTTTTTTTTTTTGGGGG - Intergenic
914232700 1:145779171-145779193 CCTAATTTTTTTTTTTTTTTTGG + Intronic
914242402 1:145860412-145860434 CCTATTTTTTTATTTTTTTGGGG + Intergenic
914402423 1:147335286-147335308 ACTAATATTTTACTTTTTCGTGG + Intergenic
914571658 1:148922885-148922907 CCTTATTTTTTATTTTTTTGAGG + Intronic
914601176 1:149207377-149207399 CCTTATTTTTTATTTTTTTGAGG - Intergenic
914726266 1:150330347-150330369 CCAATTATTTTCTTTTTTGGGGG + Intronic
914740900 1:150464172-150464194 GCTAATTTTTTATTTTTGGTAGG + Intronic
915576705 1:156783943-156783965 TTTAATTTTTTTTTTTTTGGGGG + Intronic
916292727 1:163184396-163184418 CCTTTTTTTTTTTTTTTTGGAGG - Intronic
916869012 1:168892235-168892257 CATATTCTTGTATATTTTGGGGG + Intergenic
917055449 1:170976892-170976914 TATAATCTTGTATTTCTTGGAGG + Intronic
917240064 1:172938586-172938608 CCTTTTATTTTACTTTTTGGTGG + Intergenic
917527485 1:175801957-175801979 CTTAAACCTGTATTTTTTGGAGG + Intergenic
917601921 1:176583888-176583910 CCTAATTTTTTAATTTTTAGTGG - Intronic
917812744 1:178675746-178675768 CCTAATCTTTTGTATTTTTGTGG - Intergenic
917915583 1:179697999-179698021 CCTGAAATTTTCTTTTTTGGTGG - Intergenic
918030615 1:180805055-180805077 CTTTATCTTCTATTCTTTGGGGG + Intronic
918301844 1:183211673-183211695 ACTAATTTTTTATTTTTTTGTGG + Intronic
918678141 1:187316239-187316261 CCTAGGCTTTTCTTTGTTGGGGG - Intergenic
919101926 1:193105983-193106005 CCTAATTTTTTTTTTTTGGCAGG - Exonic
919122122 1:193354263-193354285 GCTAATTTTTTTTTTTTTGTCGG - Intergenic
919215382 1:194546946-194546968 CCCAATTTTTTATTTTGAGGAGG + Intergenic
919272167 1:195361307-195361329 CCTGGTGTTTTATTTTCTGGGGG - Intergenic
919513804 1:198496827-198496849 GCTTATTTTTTATTTTTTGCAGG + Intergenic
919624231 1:199895735-199895757 CCTATATTTTTATTTTTTTGAGG + Intergenic
919661601 1:200253220-200253242 CTAATTTTTTTATTTTTTGGTGG + Intergenic
919721636 1:200843229-200843251 TCTCTTCTTTTATTTTTTGGGGG - Intronic
919734881 1:200941309-200941331 TCTTATTTTCTATTTTTTGGAGG + Intergenic
919942728 1:202299424-202299446 CCTAATGTTTTATTATTTCCCGG - Intronic
920118094 1:203635494-203635516 GCTAATTTTTTATTTTGTAGAGG - Intronic
920585193 1:207152319-207152341 GCTAATTTTTAATTTTTTTGTGG - Intergenic
921014708 1:211178435-211178457 AATAACCTTTAATTTTTTGGGGG - Intergenic
921167284 1:212516161-212516183 GCTAATTTTTAATTTTTTTGTGG + Intergenic
921406006 1:214780325-214780347 CCTGAACTTTTACATTTTGGGGG + Intergenic
921697025 1:218223359-218223381 GCTAATTTTTTATTTTTTGTAGG - Intergenic
921862035 1:220050427-220050449 GCTAATTTTTTATTTTCTGTAGG + Intergenic
921917583 1:220629351-220629373 CCTTTTTTTTTTTTTTTTGGTGG + Intronic
921919367 1:220649221-220649243 CCAAGTCTTTTTTTTTTTTGGGG + Intronic
921932921 1:220769841-220769863 CTTTTTCTTTTTTTTTTTGGCGG + Intronic
922423941 1:225477002-225477024 GCTAATTTTTTGTATTTTGGTGG - Intergenic
922498656 1:226080762-226080784 GCTAATTTTTTTTTTTTTTGAGG - Intergenic
922609550 1:226914902-226914924 ACTAATTTTTTTTTTGTTGGTGG - Intronic
922760943 1:228130156-228130178 GCTAATATTTAATTTTTTTGTGG - Intergenic
923727699 1:236521827-236521849 CCTACTTTTTTTTTTTTTTGAGG - Intronic
924171193 1:241342960-241342982 CCTATACTTTTAATTTTTTGAGG - Intronic
924348340 1:243093284-243093306 CATATTCTTTTTTTTTTTTGAGG + Intergenic
924499652 1:244625335-244625357 AGTAATATTTTGTTTTTTGGGGG + Intronic
924728457 1:246691124-246691146 GCTTATTTTTTAATTTTTGGTGG + Intergenic
1062928015 10:1332237-1332259 GCTAATTTTTTATTGTTTTGTGG - Intronic
1063037944 10:2306441-2306463 TTTTATCGTTTATTTTTTGGGGG + Intergenic
1063147208 10:3306626-3306648 CCAAATCTTCTATATTTTGTGGG + Intergenic
1063207215 10:3844546-3844568 CATAATCTTTTAGTTTTGTGAGG + Intergenic
1063294693 10:4792966-4792988 CCTGAGCTTTCATTTTGTGGTGG + Intronic
1063471575 10:6291385-6291407 GCTAATCTTTTTATTTTTTGTGG - Intergenic
1063612025 10:7570785-7570807 GCTAATTTTTTATTTTTTGTAGG + Intronic
1063832715 10:9973804-9973826 CATAATGATTTATTTTTTGGTGG - Intergenic
1064420705 10:15188028-15188050 GCTAATTTTTTTTTTTTTTGAGG - Intergenic
1064523683 10:16230662-16230684 GCAAATTTTTAATTTTTTGGAGG - Intergenic
1064554773 10:16537471-16537493 CCTAATCTCTTCTTCTTAGGAGG - Intergenic
1064614827 10:17142255-17142277 TTTAATCTTTTATTTTTAGTAGG + Intronic
1065157703 10:22887109-22887131 CATAATCTCATGTTTTTTGGAGG - Intergenic
1065227157 10:23556070-23556092 TTTTATTTTTTATTTTTTGGGGG + Intergenic
1065509751 10:26466634-26466656 GCTAATCTTTAAATTTTTTGTGG - Intronic
1065525941 10:26621337-26621359 CCTTATCTTTTTTTTTTTTTAGG + Intergenic
1065545309 10:26813250-26813272 CATGATTTTTTTTTTTTTGGCGG - Intronic
1065548182 10:26843286-26843308 GCTAATTTTGTATTTTTTAGTGG - Intronic
1065556017 10:26916379-26916401 CCTAATTTTTTTTTTTTTTTTGG + Intergenic
1065751900 10:28895389-28895411 TCTAGTTTTTTTTTTTTTGGGGG + Intergenic
1065905204 10:30244920-30244942 CCTATAATTTTATTCTTTGGAGG - Intergenic
1066183393 10:32984993-32985015 GCTAATTTTTTATATTTTAGTGG - Intronic
1066700909 10:38127118-38127140 TCTCATCTTACATTTTTTGGGGG - Intergenic
1067113075 10:43414417-43414439 CCTTTTATTTTATTTTTTTGAGG + Intergenic
1067308376 10:45089151-45089173 ACTAATTTTTAATTTTTTGTAGG + Intergenic
1067519935 10:46992083-46992105 CATAATCTCTTATTTCTTGGAGG + Intronic
1068224730 10:54092393-54092415 CCAATTCTTTTATTTCTTTGGGG + Intronic
1068639689 10:59389280-59389302 GCTAATTTTTAATTTTTTTGTGG + Intergenic
1068648027 10:59491538-59491560 CTTAGGCTTTTATTTGTTGGGGG + Intergenic
1069323858 10:67206656-67206678 CTTAATTTTTTTTTTTTTGAAGG - Intronic
1070146339 10:73776379-73776401 CCTAATTTTTTTTTTTTTTTTGG + Intronic
1070183946 10:74041736-74041758 GCTAATCTTTTTTTTTTTTTTGG - Intronic
1070250004 10:74765369-74765391 GCTAACATTTTAATTTTTGGGGG - Intergenic
1070869308 10:79735734-79735756 TTTAATTATTTATTTTTTGGGGG + Intergenic
1070894314 10:79969172-79969194 CCTTATTTTTTATTTTTTATTGG - Intronic
1071062542 10:81590012-81590034 CACAATCTTATATTTCTTGGAGG - Intergenic
1071615534 10:87072106-87072128 GCTAATTTTTTAATTTTTTGTGG - Intronic
1071659014 10:87480017-87480039 TTTAATTATTTATTTTTTGGGGG - Intergenic
1071778974 10:88821229-88821251 CCCTAGCTTTTAATTTTTGGAGG - Intergenic
1071867808 10:89755757-89755779 GTAAATCTTTTATTTTTTGTAGG + Intronic
1071954970 10:90748140-90748162 CTTTTTCTTTTATTTTTTAGAGG + Intronic
1072125690 10:92443364-92443386 GCTAATTTTTTAATTTTTTGTGG - Intergenic
1072182416 10:92999703-92999725 CCTAATTTTTTTTTTTTTTGAGG + Intronic
1072244333 10:93528479-93528501 CAAAATATTTTATGTTTTGGGGG + Exonic
1072282278 10:93877689-93877711 GCTAATTTTTTGTATTTTGGGGG - Intergenic
1072301103 10:94063184-94063206 CCTACTCTTTTCCTTTATGGTGG + Intronic
1072332816 10:94370118-94370140 ACATATCTTTTTTTTTTTGGAGG + Intergenic
1072418669 10:95270913-95270935 GCTAATTTTTTAATTTTTAGTGG + Intronic
1072799680 10:98384450-98384472 GCTAATTTTTTATTCTTTTGTGG - Intronic
1072829345 10:98641204-98641226 CTTGATATTTTCTTTTTTGGAGG - Intronic
1073398722 10:103239684-103239706 TCTAATTTTTTTTTTTTTGGGGG + Intergenic
1073497716 10:103908884-103908906 GTTAATTTTTTTTTTTTTGGTGG + Intronic
1073640212 10:105244902-105244924 GCTAATTTTTTATATTTTAGTGG - Intronic
1073693059 10:105832958-105832980 CGTAACCTTTTTTTTTTTGGTGG - Intergenic
1074066122 10:110015538-110015560 GCTAATTTTTTATATTTTAGTGG + Intronic
1074218565 10:111412343-111412365 CCCATCCTTTTGTTTTTTGGGGG + Intergenic
1074270365 10:111947619-111947641 CATATTTTATTATTTTTTGGTGG - Intergenic
1074329237 10:112487422-112487444 CCTAATCTTGCATTTTTGAGAGG + Intronic
1074648362 10:115490389-115490411 CATAATCCCTTATTTCTTGGAGG + Intronic
1074918027 10:117977367-117977389 CCTAAGTATTTAATTTTTGGGGG - Intergenic
1074966234 10:118493179-118493201 CCTAATCTTATATTCTTGTGAGG - Intergenic
1075585374 10:123653538-123653560 GCTAATTTTTTTTTTTTTAGGGG - Intergenic
1075775021 10:124977543-124977565 CTAAATTTTGTATTTTTTGGTGG - Intronic
1076129602 10:128004055-128004077 CCTAACCTCTTATTGTTGGGGGG + Intronic
1076195458 10:128514342-128514364 CTTGCCCTTTTATTTTTTGGGGG + Intergenic
1076920221 10:133447979-133448001 CCTGGTCTTTTCTTTGTTGGGGG - Intergenic
1077621668 11:3730356-3730378 CATTTTCTTTTTTTTTTTGGAGG + Intronic
1078136182 11:8653783-8653805 TCTTTTCTTTTTTTTTTTGGTGG - Intronic
1078211842 11:9276172-9276194 CCTAATTTTTAAATTTTTAGTGG + Intergenic
1078601377 11:12734078-12734100 CCTAATTTTTAAATTTTTTGTGG + Intronic
1078970836 11:16409285-16409307 CCTGTTTTTTTTTTTTTTGGAGG - Intronic
1079710292 11:23674988-23675010 CCTAATCCTCTATTTTTTCAAGG - Intergenic
1080170754 11:29299703-29299725 TTTAATCCTTTATATTTTGGGGG + Intergenic
1080186477 11:29493218-29493240 CTTTATCTTTTATTATTTTGGGG + Intergenic
1080686527 11:34520224-34520246 AGTCATATTTTATTTTTTGGGGG - Intergenic
1080879039 11:36301882-36301904 CCTCATCTTTTTTTCTTTTGGGG + Intronic
1081078825 11:38713244-38713266 TCTTACCTTTTTTTTTTTGGAGG - Intergenic
1081411238 11:42760653-42760675 CCTTTTCTTTTCTTTTTTTGGGG - Intergenic
1081426920 11:42935426-42935448 ACTTATCTTTTTTTTTTTTGTGG - Intergenic
1081843565 11:46221305-46221327 TTTTATTTTTTATTTTTTGGGGG - Intergenic
1081881483 11:46456632-46456654 CCGCAGCTTTTATTGTTTGGTGG + Intronic
1081932656 11:46883139-46883161 CCTTATCTTTTTTTTATTGTTGG - Intronic
1082109071 11:48253192-48253214 CTAGATATTTTATTTTTTGGTGG + Intergenic
1082227602 11:49726626-49726648 CATAGTCTTATATTTCTTGGAGG - Intergenic
1082687180 11:56254567-56254589 CAGAATCATTTATTTTTTTGAGG + Intergenic
1082837707 11:57663773-57663795 TTTGATCTTTTTTTTTTTGGGGG + Intergenic
1082875250 11:57981170-57981192 TCTAATTTTTTATTTTTTGTAGG - Intergenic
1082920945 11:58493123-58493145 CTGAATTTTTTTTTTTTTGGAGG - Intergenic
1083353734 11:62049530-62049552 GCTAATTTTGTATTTTTTAGTGG + Intergenic
1083406966 11:62464206-62464228 GCTAATCTTTTTCTTTTTTGGGG + Intronic
1083566950 11:63727023-63727045 CTTAATTTTGTATTTTTTAGTGG - Intronic
1084203194 11:67576062-67576084 CCTTTTTTTTTTTTTTTTGGGGG - Intergenic
1084216824 11:67651730-67651752 CCTAATTTTTTTTTTTTTTTTGG - Intergenic
1084432383 11:69118364-69118386 CCTAATTACTTATTTTTTTGGGG + Intergenic
1084838356 11:71823407-71823429 TCTAATATCTTATTTTTTTGAGG - Intergenic
1085012679 11:73152209-73152231 GCTAATTTTTTATTTTTTGTAGG - Intergenic
1085088732 11:73691337-73691359 GCTAATTCTTTATTTTTTGTAGG + Intronic
1085634066 11:78144442-78144464 CCAATTCTTTTATTTTTTAAAGG - Intergenic
1085687550 11:78637894-78637916 CCTCCTCTTCAATTTTTTGGAGG - Intergenic
1085825033 11:79838116-79838138 TCTAATTTTTTAAATTTTGGGGG - Intergenic
1086106663 11:83155162-83155184 CCAAAGGTTTTATTTTCTGGAGG - Intergenic
1086325945 11:85699554-85699576 TCTAATTCTTTCTTTTTTGGGGG + Intronic
1086344392 11:85881373-85881395 CTGAAACTTTTTTTTTTTGGGGG - Intronic
1086923701 11:92617141-92617163 CATAGTCTTATATTTCTTGGAGG + Intronic
1086933098 11:92715054-92715076 TTTAGTCTTTTTTTTTTTGGAGG - Intronic
1087309001 11:96518594-96518616 CCTGAAGTTTTATTTTTTTGTGG + Intergenic
1087378085 11:97368969-97368991 CATAATCTTATATTTCTTAGAGG - Intergenic
1087610107 11:100423698-100423720 CATAATCTCAAATTTTTTGGAGG - Intergenic
1087718976 11:101640362-101640384 CATAGTCTTATATTTCTTGGAGG - Intronic
1087768438 11:102181143-102181165 CCTATTATTTTATTTTTTTGAGG - Intronic
1087955367 11:104279682-104279704 CTTTATCTTTTTATTTTTGGTGG + Intergenic
1088134495 11:106537869-106537891 TATAATCTTTTATTTTTTCTTGG + Intergenic
1088268679 11:108011624-108011646 TTTAATTTTTTTTTTTTTGGAGG + Intronic
1088561115 11:111117239-111117261 CCTGAACTTTTATTTTTTAGTGG - Intergenic
1088694932 11:112358599-112358621 GCTAATTTTTTATTTTTTAGTGG + Intergenic
1088697997 11:112385268-112385290 CCTAAAGTTTTTTTTTTTGGTGG + Intergenic
1089006199 11:115093117-115093139 TCTGATTTTTTTTTTTTTGGAGG - Intergenic
1089220067 11:116863392-116863414 GCTAATTTTTAATCTTTTGGGGG + Intronic
1089707037 11:120285861-120285883 CATAATGTTCTATTGTTTGGGGG + Intronic
1089713349 11:120333820-120333842 CCTATTTTTTTTTATTTTGGGGG + Intergenic
1089921927 11:122217196-122217218 TCTAATTTTTTTTTTTTTTGAGG + Intergenic
1090038948 11:123273587-123273609 GCTAATTTTTTATTTTTTGTTGG + Intergenic
1090099810 11:123782369-123782391 TAAAATCTTTTCTTTTTTGGGGG - Intergenic
1090282169 11:125465635-125465657 CCTTTTATTTTATTTTTTAGTGG - Intronic
1090789730 11:130081106-130081128 TCTACTCTTTTGTTTTTGGGGGG - Intronic
1091186043 11:133648945-133648967 CCAAATCTTTGCTTTTTTGCAGG + Intergenic
1091245149 11:134086967-134086989 GCTAATTTTTTAATTTTTTGTGG + Intronic
1092143951 12:6201871-6201893 GCTAATTTTTTATTTTTTTGTGG - Intronic
1092212240 12:6654135-6654157 CCTAATCTATTTATTTTTAGAGG + Intronic
1092280563 12:7095114-7095136 TCCAATCTTTTTTTTTTGGGGGG + Exonic
1092444614 12:8543014-8543036 CTTAATGATTTCTTTTTTGGGGG + Intergenic
1092679130 12:10957899-10957921 CAGAATCTGTTGTTTTTTGGGGG - Intronic
1093587681 12:20860255-20860277 CCTGATCATTTCTTTTTTGTGGG + Intronic
1093982904 12:25494475-25494497 CCTAAACTTTTACTTTTCGTAGG - Intronic
1094136629 12:27133956-27133978 TCTATTTTTTTTTTTTTTGGAGG + Intergenic
1095168297 12:39001923-39001945 CCTTTTCTTTTTTTTTTTAGTGG + Intergenic
1095488848 12:42711797-42711819 CCTGGGCTTTTTTTTTTTGGGGG - Intergenic
1095490579 12:42729315-42729337 GCTAATTTTTAAATTTTTGGTGG + Intergenic
1095829395 12:46568578-46568600 GCTAATTTTGTATTTTTTAGTGG + Intergenic
1096029769 12:48402906-48402928 CATAATCTCATATTTCTTGGAGG + Intergenic
1096156507 12:49344381-49344403 CCTCTTCTTTTTTTTTTTCGGGG + Intergenic
1096164630 12:49411478-49411500 AATAAACTTTTCTTTTTTGGGGG - Intronic
1096291193 12:50344799-50344821 TTTAATTTTTTATTTTTTGTAGG - Intronic
1096313826 12:50545647-50545669 CTGTAACTTTTATTTTTTGGAGG + Intronic
1096339984 12:50789761-50789783 CCCAATCTTTTTTTTTTGGTGGG - Intronic
1096563835 12:52459050-52459072 CCTGAACTTTTCTTTTTTTGTGG + Intergenic
1096681671 12:53259751-53259773 CTTTTTCTTTTTTTTTTTGGGGG + Intergenic
1096710024 12:53448621-53448643 GCTAATTTTTAATTTTTTGTAGG + Intergenic
1096739698 12:53683810-53683832 CTTTATTTTTTATTTTTTAGAGG - Intergenic
1096937937 12:55304585-55304607 CATAGTCTTGTATTTCTTGGAGG - Intergenic
1097118111 12:56713842-56713864 CTTTATTTTTTATTTTTTGGAGG + Intronic
1097203676 12:57301974-57301996 CCTAATGCTTTACTTTTTAGGGG - Intronic
1097318000 12:58193708-58193730 CCTTCTCTTCAATTTTTTGGAGG + Intergenic
1097460626 12:59857609-59857631 CATAATCTTGTATTTCTTGGAGG - Intergenic
1097761425 12:63469805-63469827 CTAATTTTTTTATTTTTTGGTGG - Intergenic
1097770315 12:63576554-63576576 TCTAATAGTTTTTTTTTTGGTGG - Intronic
1097937176 12:65265668-65265690 GCTAATTTTTTATTTCTTAGTGG - Intergenic
1098100231 12:67007481-67007503 CCTCATTCTTTGTTTTTTGGGGG - Intergenic
1098129625 12:67335719-67335741 CCTTATGTTTTAGTTTTTAGAGG + Intergenic
1098130897 12:67348743-67348765 CCAAATATTTATTTTTTTGGAGG + Intergenic
1098323672 12:69278232-69278254 CCTAACCATTTAATTTTTGAGGG + Intergenic
1098419403 12:70277362-70277384 TTTTATTTTTTATTTTTTGGTGG + Intronic
1098706763 12:73701680-73701702 ACTCATCTTTGATTTTTTGAGGG - Intergenic
1098942038 12:76549111-76549133 TCTCATCTTTTATATTTTGTGGG - Intronic
1098983749 12:76987264-76987286 CCTTATCTTTTATATTGTGTTGG + Intergenic
1099120614 12:78685421-78685443 GCTAATTTTTTAATTTTTAGTGG + Intergenic
1099172363 12:79380177-79380199 CATTTTCTCTTATTTTTTGGTGG - Intronic
1099386707 12:82021480-82021502 CTTACTCTTTTCTTTTTTGAGGG + Intergenic
1099635419 12:85205761-85205783 CATAGTCTTATATTTATTGGAGG + Intronic
1100180709 12:92083068-92083090 GCTAATTTTTTATTTTTTATAGG + Intronic
1100269774 12:93013823-93013845 ACTTATTATTTATTTTTTGGAGG - Intergenic
1100411128 12:94321035-94321057 CATAATCTCATATTTCTTGGAGG + Intronic
1100895848 12:99181647-99181669 TCTTATTTTTTATTTTTTTGTGG + Intronic
1100911073 12:99364136-99364158 GCAAATATTTTATTTTTTGCAGG + Intronic
1100941246 12:99724483-99724505 CATAATCCTATATTTCTTGGAGG - Intronic
1101109265 12:101470119-101470141 TCAAATCTTTTATATTTTGAGGG - Intergenic
1101120798 12:101577877-101577899 TTTAATTTTTTATTTTTTGGAGG + Intronic
1101886559 12:108668513-108668535 CCTAATATAGTTTTTTTTGGCGG - Intronic
1101911167 12:108861017-108861039 CTTAATCATTGAGTTTTTGGGGG - Intronic
1102160621 12:110765763-110765785 CCCCATCTCTTACTTTTTGGCGG - Intergenic
1102268517 12:111508741-111508763 CCTAAGTTTTCATTTGTTGGCGG - Intronic
1102404037 12:112656934-112656956 TATAATAATTTATTTTTTGGGGG + Intronic
1102660179 12:114520088-114520110 TCTACTCTTTAATTTCTTGGAGG + Intergenic
1102692112 12:114769503-114769525 ACTAATTTTTTATTTTTTGTAGG + Intergenic
1102842103 12:116135902-116135924 CCTTTTTTTTTTTTTTTTGGTGG + Intronic
1103095267 12:118127239-118127261 GCTAATTTTTTAATTTTTGGGGG + Intronic
1103307207 12:119974503-119974525 CCTATTTTTTTTTTTTTTTGAGG + Intergenic
1103409669 12:120701785-120701807 CCTGATTTTGTACTTTTTGGTGG - Exonic
1103654391 12:122458650-122458672 GCTAATCTTTGATTTTTTGTAGG + Intergenic
1104006429 12:124896003-124896025 TCTTTTCTTTTTTTTTTTGGGGG - Intergenic
1105017974 12:132797709-132797731 CCGCATCTTTTTTTTTTTTGAGG - Intronic
1105230278 13:18488350-18488372 CTTAATGATTTTTTTTTTGGAGG + Intergenic
1105293469 13:19069476-19069498 TTTTATTTTTTATTTTTTGGCGG - Intergenic
1105601651 13:21893185-21893207 CCAATTCTTTTTTTTTTTGGTGG - Intergenic
1105833780 13:24191041-24191063 CCTAATCTTTTTTCTGGTGGAGG - Intronic
1105957012 13:25293180-25293202 ACTAATTTTGTATTTTTTAGTGG + Intergenic
1106037547 13:26057875-26057897 GCTAATTTTTTATTTTTGTGGGG + Intergenic
1106739235 13:32621296-32621318 CCAATTTTTTTATTTTTTGTAGG - Intronic
1107002698 13:35568562-35568584 CTTTATTTTTAATTTTTTGGGGG - Intronic
1107083571 13:36401230-36401252 CCTATACTTTTCTTTTTTTGAGG + Intergenic
1107389280 13:39946311-39946333 CATAATCCCATATTTTTTGGAGG - Intergenic
1107742977 13:43473338-43473360 CCTTAACTTTTCTTTTTTGGGGG + Intronic
1107791782 13:44009638-44009660 CCTATTCTTTTATCCTTTGTAGG - Intergenic
1107909471 13:45091956-45091978 GCTAATTTTTGATTTTTTTGGGG - Intergenic
1108117125 13:47140956-47140978 CTAAATCTTTTATTTTCAGGTGG + Intergenic
1108187816 13:47905866-47905888 TTTAATTTTTTTTTTTTTGGGGG - Intergenic
1108204964 13:48079028-48079050 CCTCATCTTTTATAGTTTGTAGG - Intronic
1108324646 13:49318301-49318323 ACTAATATTTTAATTTTTTGTGG - Intronic
1108334264 13:49422613-49422635 CTTAATTTTTTTTTTTTTTGAGG + Intronic
1108415581 13:50195250-50195272 GCTAATTTTTTCTTTTTTGCAGG + Intronic
1108600017 13:51984392-51984414 CATAGTCTTATATTTCTTGGAGG - Intronic
1108748759 13:53424290-53424312 TGTTATCTTTTATTTTTTTGTGG - Intergenic
1108884824 13:55166657-55166679 CATAATCTCATATTTCTTGGAGG - Intergenic
1108965975 13:56302301-56302323 CAAAATTTTTTTTTTTTTGGCGG - Intergenic
1109072356 13:57786239-57786261 CATAATCCTATATTTCTTGGAGG + Intergenic
1109077033 13:57848842-57848864 CCTAATATTGTAATTTTTTGGGG + Intergenic
1109169892 13:59082235-59082257 TCTATTCTTTTTTTTTTTGGGGG - Intergenic
1109218914 13:59620986-59621008 CTTGATCTTTTGTATTTTGGGGG - Intergenic
1109358686 13:61267904-61267926 CGTAGTCCTATATTTTTTGGAGG - Intergenic
1109830311 13:67777713-67777735 ACTAATCATATATATTTTGGGGG - Intergenic
1110909320 13:80935677-80935699 CCTCTTCTTTAATTTTGTGGAGG + Intergenic
1111451435 13:88423291-88423313 GCTAATGTTTTAATTTTGGGTGG - Intergenic
1111565179 13:90004752-90004774 CCTAATTTTTCATTTTTTAAGGG - Intergenic
1112049739 13:95633516-95633538 CCTAATTTTGTATTTTTTTGTGG - Intronic
1112095617 13:96128848-96128870 CCTGTGCTTTTTTTTTTTGGCGG + Intronic
1112166004 13:96920200-96920222 CATAGTCCTGTATTTTTTGGAGG - Intergenic
1112460364 13:99598664-99598686 CCTTTTTTTTTTTTTTTTGGTGG + Intergenic
1112508239 13:99988327-99988349 ATTTATTTTTTATTTTTTGGTGG + Intergenic
1112717803 13:102206514-102206536 GCTAATTTTGTATTTTTTGGTGG - Intronic
1113032681 13:106012101-106012123 CATATTCTTTGCTTTTTTGGAGG - Intergenic
1113202037 13:107876481-107876503 CATAATCTCATATTTCTTGGAGG - Intergenic
1113221141 13:108103884-108103906 TTTTATTTTTTATTTTTTGGGGG + Intergenic
1113268061 13:108641489-108641511 CTTAATCTTATATTTGTTGCTGG - Intronic
1113498209 13:110750618-110750640 GCTAATTTTTTTTTTTTTTGTGG - Intergenic
1114065541 14:19056324-19056346 TCTTTTCTTTTCTTTTTTGGGGG + Intergenic
1114138536 14:19883559-19883581 ACTGATCTTTTAATTTTTGGAGG + Intergenic
1114396451 14:22367099-22367121 CCTGATTTTTTTTTTTTTTGTGG - Intergenic
1114419583 14:22570165-22570187 AATAATCTTTAATTTTTTGTTGG - Intronic
1114601939 14:23963532-23963554 CCTAATTTTTAATTCTTTGAAGG - Intronic
1114817068 14:25971624-25971646 TCTATTCTTTTAATATTTGGGGG - Intergenic
1114863102 14:26551864-26551886 AATAATCTTTTTCTTTTTGGAGG - Intronic
1115106610 14:29769402-29769424 GCTAATTTTTTAATTTTTTGTGG - Intronic
1115330828 14:32195912-32195934 CCTTTTTTTTTATTTTTTAGTGG + Intergenic
1115729810 14:36256388-36256410 CCGGATTTTTTTTTTTTTGGGGG + Intergenic
1115795860 14:36934991-36935013 CTTTATCTTTTTTTTTTTGAGGG + Intronic
1115840813 14:37468576-37468598 CTTAATTTTTTATGTTTTAGTGG - Intronic
1115890675 14:38024646-38024668 CATAATCTTATATTTTTCAGAGG - Intronic
1115998800 14:39220683-39220705 GGTAATTTTTTATTTTTTGTAGG + Intergenic
1116016234 14:39410651-39410673 CCTGGGCTTTTCTTTTTTGGGGG + Intronic
1116280487 14:42900583-42900605 TTTAAGCTTTTCTTTTTTGGTGG - Intergenic
1116282390 14:42926039-42926061 CATATTCTGTTATTTTTGGGTGG + Intergenic
1116309123 14:43299396-43299418 TATAATCTTTTATATTTTTGTGG - Intergenic
1116318007 14:43422690-43422712 TCTCTTCTTTTGTTTTTTGGTGG - Intergenic
1116472653 14:45304271-45304293 CATAATCCCATATTTTTTGGAGG + Intergenic
1116734592 14:48672346-48672368 CATAATCTTATATTTCTTGGGGG - Intergenic
1116783151 14:49258612-49258634 ACTTTTTTTTTATTTTTTGGTGG - Intergenic
1117126792 14:52637793-52637815 CCTGATTTTTTTTTTTTTTGTGG - Intergenic
1117152564 14:52904350-52904372 GCTAATTTTTTAATTTTTAGTGG - Intronic
1117162189 14:53000671-53000693 GCTAATTTTTTTTTTTTTTGAGG - Intergenic
1117279609 14:54225510-54225532 TGTCATCTTGTATTTTTTGGAGG + Intergenic
1117489303 14:56230077-56230099 CATAGTCTTGTATTTCTTGGAGG - Intronic
1117590501 14:57263303-57263325 GCTAATTTTTTATTTTTTGTAGG - Intronic
1117697766 14:58383327-58383349 CCTACTCTCCTATTTTTTGGAGG + Intergenic
1117763094 14:59053050-59053072 TCTAAACTTTTTTTTTTTGGAGG - Intergenic
1117896143 14:60489013-60489035 TCTACCCTTTTCTTTTTTGGGGG + Intronic
1118045392 14:61964848-61964870 CATAATCTTTTTATTTATGGAGG - Intergenic
1118091982 14:62491942-62491964 CTTACTCTTTTATAATTTGGAGG + Intergenic
1118139152 14:63060918-63060940 CCTAATCTCCTCTTTTTAGGAGG + Intronic
1118398633 14:65359086-65359108 ACCAATCTTTTCTTTTTTAGGGG + Intergenic
1118494780 14:66297255-66297277 CATAGTCTTATATTTCTTGGAGG - Intergenic
1118519392 14:66565061-66565083 CAAAATCCTTTATTTTTAGGAGG - Intronic
1118587757 14:67371418-67371440 CTTAACTTTTTTTTTTTTGGTGG - Intronic
1118589126 14:67387949-67387971 CCTCACCTATTATTTTTAGGCGG + Intronic
1118969472 14:70621171-70621193 CCTAAACTTTTATTTACTAGAGG + Intergenic
1119082846 14:71712522-71712544 ACTAATCTTTTTTTTTTCAGTGG - Intronic
1119501570 14:75132393-75132415 CTTAAACTTTTTTTTTTTTGGGG - Exonic
1119625549 14:76171580-76171602 GCTATTTTTTTATTTTTTTGGGG - Intronic
1119999223 14:79283632-79283654 CCTAATGTGAGATTTTTTGGGGG - Intronic
1120040807 14:79750832-79750854 CCTGACATTTTACTTTTTGGGGG - Intronic
1120053396 14:79894852-79894874 GCTAATCTTTTGTATTTTTGTGG + Intergenic
1120205330 14:81581402-81581424 ACTAATTTTTTATTTTTTTGTGG - Intergenic
1120467140 14:84873656-84873678 GCTAATCTTTAATTTTTTTAAGG + Intergenic
1120664072 14:87285103-87285125 CAGAATCATTTATTTTTTGATGG - Intergenic
1120819302 14:88897175-88897197 GCTAATCTTTGTATTTTTGGGGG - Intergenic
1120891307 14:89493855-89493877 GCTATTTTTTTTTTTTTTGGAGG - Intronic
1121074737 14:91059173-91059195 GCTAATTTTGTATTTTTTGTGGG - Intronic
1121181597 14:91933274-91933296 TTTAATTTTTTATTTTTTTGAGG + Intronic
1121272002 14:92643924-92643946 TCTAATTTTTTTTTTTTTTGAGG - Intronic
1121543965 14:94750098-94750120 ACTAATTTTTTATTTTTTATGGG - Intergenic
1121756362 14:96406053-96406075 CCTCATTTTTTTTTTTTTTGAGG + Intronic
1121969723 14:98344945-98344967 CCTCTTCTTCTTTTTTTTGGAGG - Intergenic
1122039841 14:98979347-98979369 TCTAATTTTTTATTTTTTGAAGG - Intergenic
1122084839 14:99292440-99292462 CCTATTTTTTTTTTTTTTGGTGG - Intergenic
1122451008 14:101807434-101807456 CTTGTTCTTTTATTTTTTGCAGG + Intronic
1123220412 14:106850448-106850470 CCAGATTTTTTATTTCTTGGTGG + Intergenic
1123776125 15:23582353-23582375 CTTTTTCTTTTTTTTTTTGGTGG - Intronic
1123811776 15:23933638-23933660 CCTAAGCAATTATGTTTTGGGGG + Intergenic
1123875552 15:24620646-24620668 CATAATCTCATATTTCTTGGAGG + Intergenic
1123949995 15:25262082-25262104 CTTTTTCTTTTTTTTTTTGGGGG - Intergenic
1123957891 15:25358382-25358404 TTTAATCTTTTATTTTTTGGTGG - Intronic
1124072486 15:26408931-26408953 CCAAATCTTTTATTTCTTATGGG - Intergenic
1124099697 15:26682042-26682064 CATTTTATTTTATTTTTTGGAGG + Intronic
1124352608 15:28968939-28968961 GCTACTCTTTTTTTTTCTGGAGG + Intronic
1124706506 15:31970989-31971011 TCTAAAGATTTATTTTTTGGGGG - Intergenic
1124916486 15:33979617-33979639 CCAAATCTTTCATTTTTTAAAGG - Intronic
1125109923 15:36020640-36020662 CCTATTCTCTTATTTTTCTGGGG - Intergenic
1125365717 15:38913643-38913665 ATTTATTTTTTATTTTTTGGGGG + Intergenic
1125372622 15:38994510-38994532 CCTATTCATTTATTTGTTGGAGG + Intergenic
1125387953 15:39158267-39158289 CCTAAGCATTTCTTTTTTGCAGG + Intergenic
1125873216 15:43121184-43121206 CCTAATTTTTTTTTTTTTTTTGG - Intronic
1126161006 15:45613419-45613441 CCTTTTCTTTTTTTTTTTGCCGG + Intronic
1126170297 15:45690081-45690103 CCTTTTTTTTTTTTTTTTGGAGG + Intronic
1126287399 15:47028699-47028721 CATAATCTCATATTTGTTGGGGG - Intergenic
1126306569 15:47265245-47265267 CCTCAACTTTTATTTCTGGGTGG + Intronic
1126398293 15:48242635-48242657 GCTAATTTTTTATTTTTTGTAGG - Intronic
1126575012 15:50187965-50187987 CCTTTTTTTTTTTTTTTTGGTGG - Intronic
1126602715 15:50444920-50444942 GCTAATTTTTTAATTTTTAGTGG + Intronic
1127220695 15:56877373-56877395 CCAAATTTTTTTTTTTTTTGAGG - Intronic
1127235219 15:57042576-57042598 GCTAATTTTTAATTTTTTTGTGG + Intronic
1127268378 15:57379245-57379267 CATAAACTTTTCTTTTTGGGGGG - Intronic
1127325298 15:57888870-57888892 CCTAATTTTTTTTTTTTTTTTGG - Intergenic
1127356050 15:58201059-58201081 CTTCTTCTTTTTTTTTTTGGTGG - Intronic
1127637571 15:60886163-60886185 CATGTTCTTTGATTTTTTGGGGG - Intronic
1128367498 15:67014837-67014859 CCTCTTCTTTTTTTTTTTGCGGG + Intergenic
1128417616 15:67461208-67461230 CCTATTCTTGTATTTTTAGTAGG - Intronic
1128479591 15:68025779-68025801 GCTAATTTTTTTTTTTTTTGAGG + Intergenic
1128496027 15:68199163-68199185 CCTAACCTTTTTTTTTTGAGGGG - Intronic
1129311462 15:74712919-74712941 CCTATTTTTTTTTTTCTTGGAGG - Intergenic
1129593821 15:76942948-76942970 GGAAATCTTTTCTTTTTTGGGGG - Intronic
1129943347 15:79517895-79517917 CCTGATGGTTTTTTTTTTGGGGG + Intergenic
1130354339 15:83116420-83116442 CCTATTTTCTTATTTTATGGTGG + Intronic
1130800799 15:87261443-87261465 CATAGTCTTATATTTCTTGGAGG + Intergenic
1131186468 15:90278705-90278727 CCTAATTTTTTTTTTTTTTTAGG - Intronic
1131263261 15:90900825-90900847 CCTAATTTTTTTATTTTTTGTGG - Intergenic
1131837656 15:96407488-96407510 TCTAATTTTTTCTTTTTTGGGGG + Intergenic
1132173363 15:99686875-99686897 CGTAATCTCAAATTTTTTGGAGG + Intronic
1132484704 16:184646-184668 GCTAATTTTTTATGTTTTTGTGG - Intergenic
1132541606 16:512222-512244 ACCAATCTTTTTTTTTTGGGTGG + Intronic
1132595984 16:750169-750191 CCTCTTCTTTTGTTTTTTTGAGG - Intronic
1133017947 16:2953507-2953529 CCTAATTTTTTAATTTTTTGTGG + Intergenic
1133252147 16:4489766-4489788 GCTAATTTTATAATTTTTGGGGG + Intronic
1133254341 16:4507445-4507467 CCAATTTTTTTTTTTTTTGGCGG - Intronic
1133994410 16:10737387-10737409 ACTAATCTTTTTTTTTTTTTTGG + Intergenic
1134452053 16:14369649-14369671 GCTAATTTTTAATTTTTTGGTGG - Intergenic
1134797286 16:17053066-17053088 CCTAATCCCATATTTCTTGGAGG + Intergenic
1135116431 16:19727591-19727613 CCAAATCTTTTTTTTTGGGGGGG - Intronic
1135359682 16:21801833-21801855 CTTCTTCTTTTTTTTTTTGGTGG - Intergenic
1135574139 16:23572216-23572238 TCTACTCTTTGCTTTTTTGGGGG + Exonic
1136096023 16:27957340-27957362 TTTTATTTTTTATTTTTTGGTGG - Intronic
1136369390 16:29826460-29826482 GCTAATTTTTAATTTTTTGTAGG - Intronic
1136450050 16:30349071-30349093 AATATTCTTTTTTTTTTTGGCGG - Intergenic
1136659317 16:31742190-31742212 CCCCATCTTTTTTTTTTTTGAGG - Intronic
1137065224 16:35833908-35833930 CTTTTTCTTTTTTTTTTTGGTGG + Intergenic
1137362852 16:47835535-47835557 CCTCAGCTTTTGTTTATTGGGGG - Intergenic
1137417631 16:48298896-48298918 CTTTTTCTTTTTTTTTTTGGAGG + Intronic
1137522218 16:49204084-49204106 TTTAATCTTTGATTTTTTTGGGG - Intergenic
1137598620 16:49741340-49741362 GCTAATTTTTTATTTTTTTGGGG - Intronic
1137991616 16:53162782-53162804 CCTTTTTTTTTTTTTTTTGGTGG + Intronic
1138513630 16:57523643-57523665 GCTAATTTTTTTTTTTTTGTAGG + Intronic
1138580140 16:57935648-57935670 CCAATTCTATTTTTTTTTGGGGG - Intronic
1138606236 16:58091186-58091208 TTTTATTTTTTATTTTTTGGAGG + Intergenic
1138628147 16:58269164-58269186 GCTAATTTTTTATTTTTAGTAGG - Intronic
1138644178 16:58411225-58411247 GCTAATGTTTTATTTTTTGCAGG - Intergenic
1138672036 16:58623186-58623208 TCTTTTCTTTTTTTTTTTGGAGG - Intronic
1138812713 16:60169753-60169775 CCTAATTTTTATTTTTTTGGGGG + Intergenic
1139116411 16:63959621-63959643 CCTTTTTTTTTTTTTTTTGGCGG + Intergenic
1139259866 16:65581023-65581045 GCTAATTTTTTATTTTTTGTAGG - Intergenic
1139518844 16:67468124-67468146 GCTAATTTTTTATTTTTTAGTGG - Intronic
1139553624 16:67691513-67691535 CTTAATTTTTTTTTTTTTGGGGG - Intronic
1139605683 16:68016588-68016610 CCTAATTTTTGTTTTTTTAGGGG - Intronic
1139622051 16:68153419-68153441 TCTAACTTTTTCTTTTTTGGGGG - Intronic
1139832526 16:69811451-69811473 GCTATTTTTTTATTTTTTGTAGG - Intronic
1140086887 16:71804850-71804872 CCTGATTTATTATTTTTTTGTGG - Intronic
1140172868 16:72625571-72625593 CCTATTCCTGTATTCTTTGGTGG + Intergenic
1140222351 16:73053179-73053201 GCTTTTCTTTTCTTTTTTGGAGG + Intronic
1140404528 16:74700064-74700086 TTTTATTTTTTATTTTTTGGAGG - Intronic
1140540676 16:75753826-75753848 GCTAATTTTGTATTTTTTAGTGG - Intronic
1140621652 16:76741348-76741370 CATAATCCCTTATTTCTTGGAGG - Intergenic
1141551274 16:84808235-84808257 GCTAATTTTTTGTTTTTTGTAGG + Intergenic
1141838784 16:86560614-86560636 CCTAATTCTTTTTTTTTGGGGGG + Intergenic
1142207106 16:88788842-88788864 GCTAATTTTTTTTTTTTTTGAGG - Intergenic
1142410271 16:89912476-89912498 CCTAATCTTTTACCCTTAGGAGG + Intronic
1203076465 16_KI270728v1_random:1123935-1123957 CCTAATTTTTAAATTTTTTGTGG + Intergenic
1142498735 17:320637-320659 CCTTTTCTTTTTTTTTTGGGGGG - Intronic
1142536740 17:622853-622875 ACTAATTTTTTTTTTTTTGTAGG + Intronic
1142722890 17:1788739-1788761 ACAAATTTTTTTTTTTTTGGAGG - Intronic
1142907574 17:3055429-3055451 CCTATTCTTTTCTTATTTGGAGG + Intergenic
1142926991 17:3248830-3248852 CCTATTCTTTTCTTATTTGGAGG - Intergenic
1143851111 17:9812784-9812806 CTAACTTTTTTATTTTTTGGTGG + Intronic
1143971491 17:10799196-10799218 TTTAATTTTTTATTTTTTGGGGG + Intergenic
1144080481 17:11759685-11759707 CCTAATTTTTTTTTTTTTTTTGG + Intronic
1144275529 17:13664714-13664736 CCTCATATTTTTTTTTTTTGGGG - Intergenic
1144423066 17:15115434-15115456 CCTCATCTTTCTTTTTATGGAGG + Intergenic
1144933825 17:18881536-18881558 CCTTATTTTTTATTTTTTTGAGG + Intronic
1145165094 17:20607812-20607834 CCTTTTTTTTTTTTTTTTGGCGG + Intergenic
1145221682 17:21094615-21094637 GCTAACTTTTTTTTTTTTGGTGG - Intergenic
1145725679 17:27120878-27120900 TATACTCTTTTGTTTTTTGGTGG + Intergenic
1145873701 17:28299134-28299156 TTTAATCTTTTTTTTTTGGGGGG - Intergenic
1146147746 17:30436310-30436332 TCTATTTATTTATTTTTTGGGGG - Intronic
1146586010 17:34082299-34082321 CAGAATTTTTTATTTTTTTGAGG + Intronic
1146631392 17:34472508-34472530 CCTCATCTTCTTTTTATTGGAGG + Intergenic
1146805382 17:35860787-35860809 CCTATTTATTTATTTTTGGGAGG + Intronic
1146958942 17:36955925-36955947 ACTAATTTTTTCTTTTTTTGTGG + Intronic
1147059699 17:37865376-37865398 GCTAATTTTTTATTTTTTTAAGG - Intergenic
1147127087 17:38378513-38378535 CCTTACTTTTTCTTTTTTGGGGG - Intronic
1147292953 17:39458569-39458591 TCTAATTTTTTTTTTTTTTGAGG + Intergenic
1147397254 17:40153774-40153796 CTAAAACTTTTTTTTTTTGGCGG + Intronic
1147477991 17:40732009-40732031 CATAATATTTTATTTTTTGGGGG + Intergenic
1147569488 17:41559825-41559847 CCTAAAGTTTTCTTTTGTGGGGG - Intergenic
1147844230 17:43393643-43393665 GCTAATTTTTTTTTTTTTTGAGG - Intergenic
1147903626 17:43807957-43807979 CCCAGCCTTTTATTTTTTTGGGG - Intronic
1148012271 17:44492568-44492590 CTTAGTTTTTTATTTTTTTGAGG - Intronic
1148047944 17:44755382-44755404 CCTTATTTTTTAATTTTTTGAGG - Intergenic
1148055507 17:44792223-44792245 CCAAATTTTTTTTTTTTTGAGGG + Intergenic
1148065620 17:44867462-44867484 GCTAATTTTTTGTATTTTGGTGG + Intronic
1148402360 17:47377019-47377041 TCTAAGATTTTATTTTTTGAAGG + Intronic
1148403694 17:47391102-47391124 GCTAATTTTTTATTTTTTTGTGG + Intronic
1148572398 17:48680625-48680647 GCTAATTTTGTATTTTTTGTAGG - Intergenic
1148775442 17:50092777-50092799 GCTAATTTTATATTTTTTGTAGG + Intergenic
1148879978 17:50718304-50718326 CCAACACTTTTATTTTTGGGGGG - Intergenic
1149020157 17:51954253-51954275 CCTAAATTTTTATTGTTTTGAGG + Intronic
1149217628 17:54376185-54376207 CCTAATTTGTTTTTTCTTGGTGG + Intergenic
1149232343 17:54549697-54549719 CCTCATCTTTAATTTTCTGGAGG + Intergenic
1149387787 17:56158769-56158791 CCAAAGCTTTTATTTTAGGGGGG - Intronic
1149426493 17:56559528-56559550 CCTAATCTTGTATTTTGTTTAGG - Intergenic
1149487314 17:57052870-57052892 CCTTTTTTTTTTTTTTTTGGTGG - Intergenic
1149677673 17:58480696-58480718 CCATTTCTTTTATTTTTTGGTGG - Intronic
1149825164 17:59821715-59821737 GCTAATTTTTTATTTTTAGTAGG + Intronic
1150058099 17:62038227-62038249 GCTAATTTTTAATTTTTTTGTGG - Intronic
1150073455 17:62172204-62172226 ACTAATTTTTTTTTTTTTTGAGG - Intergenic
1150075339 17:62187364-62187386 CCTAATTTTTTTTTTTTAGATGG + Intergenic
1150104275 17:62450658-62450680 GCTGATTTTTTATTTTTTAGTGG - Intronic
1150169268 17:62975233-62975255 CCTAATCTTTCATTGGGTGGAGG + Intergenic
1150243083 17:63651315-63651337 ACTAATTTTTTATTTTTTGTAGG - Intronic
1150253459 17:63724142-63724164 TTTAATTTTTTATTTTTTGGAGG + Intronic
1150328069 17:64272820-64272842 GCTAATTTTTTATATTTTAGTGG - Intergenic
1150509212 17:65731447-65731469 CCTAATCTTTTTATTGGTGGAGG + Intronic
1150580309 17:66467720-66467742 GCTAATTTTTTAATTTTTTGTGG + Intronic
1150662355 17:67094154-67094176 CTAAATTTTGTATTTTTTGGTGG - Intronic
1150675445 17:67242789-67242811 CCTAAGTTTTTATTTTTTTAAGG + Intronic
1150913799 17:69415438-69415460 TGTAATCTTATATTCTTTGGGGG + Intronic
1151104842 17:71600792-71600814 CTTATTATTTTCTTTTTTGGTGG + Intergenic
1151122664 17:71809673-71809695 CATAATCTCATATTTCTTGGAGG - Intergenic
1151227364 17:72657059-72657081 CCTATTTATTTATTTTTTTGAGG - Intronic
1151417752 17:73977558-73977580 CCAACTCATTTATTTTATGGTGG + Intergenic
1151539136 17:74755953-74755975 CCTGTTTTTTTTTTTTTTGGAGG + Intronic
1151868909 17:76823274-76823296 CCTAATTTTTAATTTTTTTGTGG + Intergenic
1152180028 17:78813683-78813705 CCTAACCTTTTTTTGTTTGAAGG - Intronic
1152191152 17:78888615-78888637 GCTAATTTTTTATTTTTTGTAGG + Intronic
1152817043 17:82414122-82414144 CCAACTTTTTTCTTTTTTGGCGG + Intronic
1152972452 18:176154-176176 CCAAATGTTTTTTTTTTGGGGGG - Intronic
1153349711 18:4065576-4065598 CCAAGTATTTTATTTTTTTGTGG - Intronic
1153382692 18:4455720-4455742 CCTAATCTTGTCTTTTTTAAGGG + Intergenic
1153495194 18:5691144-5691166 CCTTTACTTTTATTTTTTTGGGG + Intergenic
1153570483 18:6467361-6467383 GGTAAGTTTTTATTTTTTGGGGG + Intergenic
1153691928 18:7602590-7602612 GCTAATATTTTATTTTTTGTAGG + Intronic
1153846804 18:9057521-9057543 TATAATTTTTTATTTTTTTGGGG - Intergenic
1153899902 18:9608966-9608988 CTTGGTTTTTTATTTTTTGGAGG + Intronic
1154106559 18:11528454-11528476 CCTATTCTTCTATTTTCTGTTGG - Intergenic
1154210033 18:12371579-12371601 CCTAAGCATTTACCTTTTGGGGG + Exonic
1154409881 18:14132852-14132874 GCTAACGTTTTATTTTTTAGAGG - Intergenic
1154478771 18:14795850-14795872 CTTATTTTTTTTTTTTTTGGCGG + Intronic
1155997127 18:32342004-32342026 CCTTTTTTTTTCTTTTTTGGTGG - Intronic
1156017283 18:32560828-32560850 GCTAATTTTTTAATTTTTGAGGG + Intergenic
1156141101 18:34112366-34112388 CCATATCTTTTTTTTTTGGGGGG - Intronic
1156670565 18:39464511-39464533 CCTAATCTTTTCCCATTTGGGGG - Intergenic
1156737068 18:40273193-40273215 CCTAAGTGTTTCTTTTTTGGGGG + Intergenic
1157236951 18:45973879-45973901 CCTAATTTTGTATTTTTAGTAGG - Intergenic
1157406656 18:47427517-47427539 GCTAATTTTTTTTTTTTTGATGG + Intergenic
1157638246 18:49184235-49184257 CAAAATTTTTTTTTTTTTGGCGG + Intronic
1157664949 18:49478202-49478224 CTAAATTTTTTAATTTTTGGTGG + Intronic
1157877390 18:51286591-51286613 GCTAATTTTTTATTTTTTGTAGG - Intergenic
1158095011 18:53760680-53760702 GCTAATTTTTGTTTTTTTGGTGG - Intergenic
1158355061 18:56608780-56608802 GCTAATGTTTTATTTTTGTGTGG - Intronic
1158358284 18:56644185-56644207 GCAAATTTTTTATTTTTTTGTGG + Intronic
1158532086 18:58272662-58272684 CTTAATTTATTCTTTTTTGGAGG - Intronic
1158603266 18:58873007-58873029 TCTTATGTTTTATTTTTTTGAGG + Intronic
1159228408 18:65572001-65572023 AATCATCTCTTATTTTTTGGTGG + Intergenic
1159304214 18:66618137-66618159 CCTGCAGTTTTATTTTTTGGTGG - Intergenic
1159886840 18:73916274-73916296 TCTAATCTATTTTTTTTTGCTGG - Intergenic
1160562688 18:79769554-79769576 TCTAATCATTTATAATTTGGGGG - Intergenic
1160615444 18:80123669-80123691 CCTCCTCTTCTATTTTTTTGTGG + Intronic
1160792760 19:930097-930119 GCTAATTTTTTAATTTTTTGCGG - Intronic
1160923609 19:1532372-1532394 GCTAATTTTTAATTTTTTTGTGG - Intronic
1161052342 19:2171126-2171148 CTAAATTTTGTATTTTTTGGTGG + Intronic
1161558162 19:4956094-4956116 GCTAATCTTGTATTTTTAGTAGG + Intronic
1161636344 19:5391646-5391668 GCTAATTTTTTAATTTTTTGTGG - Intergenic
1161869380 19:6858596-6858618 GCTAATATTTTATTTTTTGTAGG + Intergenic
1161888491 19:7015950-7015972 CCTCCTTTTCTATTTTTTGGGGG + Intergenic
1161919752 19:7257251-7257273 CCTTATCTTTTTCTTTTTGTTGG + Intronic
1162088852 19:8264710-8264732 CCTATTTTTTTCTTTTTTTGTGG - Intronic
1162089066 19:8266544-8266566 CCTATTATTTGTTTTTTTGGAGG - Intronic
1162103970 19:8358685-8358707 CCTAATCTTTTATTTTTTGGAGG + Intronic
1162379847 19:10325022-10325044 CATAATTTTTTTTTTTTTTGAGG + Intronic
1162541371 19:11298432-11298454 CCTATTTTTTTTTTTTTTGCGGG + Intronic
1162597576 19:11640961-11640983 TATAATTTTTTTTTTTTTGGTGG + Intergenic
1162755965 19:12860111-12860133 CCTATTTTTCTTTTTTTTGGGGG + Intronic
1163107330 19:15132561-15132583 CATACTTTTTTTTTTTTTGGAGG + Intergenic
1163503519 19:17689755-17689777 TGTAATTTTTTTTTTTTTGGAGG + Intergenic
1164085508 19:21898611-21898633 CATAGTCTTATATTTCTTGGAGG + Intergenic
1164556174 19:29254276-29254298 CATAATCCCATATTTTTTGGAGG + Intergenic
1165025483 19:32958021-32958043 CATTGTATTTTATTTTTTGGCGG - Intronic
1165052269 19:33149474-33149496 CCTAATCTTTTATTGAGGGGAGG + Intronic
1165103313 19:33453147-33453169 GCTAATTTTTTATTTTTCTGTGG - Intronic
1165451970 19:35889044-35889066 CCAAATCTTTTTTTTTTTTTTGG - Intronic
1165583892 19:36895474-36895496 CCTAATCTGTTAATTTTTTATGG - Intronic
1166143351 19:40817970-40817992 CTTACTTTTTTTTTTTTTGGGGG + Intronic
1166559455 19:43722376-43722398 CCTAATCCTTTAATTGTTGATGG - Intergenic
1166771099 19:45282829-45282851 CCTAATTTTTAATTTTTTAGGGG - Intronic
1167238700 19:48330526-48330548 GTTAAGGTTTTATTTTTTGGAGG - Exonic
1167330579 19:48853498-48853520 TCTAATTTTTTTTTTTTTGGGGG - Intronic
1167877369 19:52425578-52425600 GCTAATTTTTTATTTTTAGTAGG + Intergenic
1167889918 19:52530982-52531004 GCTAATTTTTCTTTTTTTGGGGG - Intronic
1167980994 19:53275368-53275390 CCTAAGATTTTATTTTTGCGTGG + Intergenic
1168233934 19:55050109-55050131 CCTATTTTTTTTTTTTTGGGGGG + Intronic
1168457198 19:56521779-56521801 GCTAATTTTTTATTTTTAGTAGG - Intronic
924968307 2:99429-99451 CCTAAACTTTTATTTTTTTGGGG - Intergenic
925360322 2:3275685-3275707 CCTAATCTTTTATTCTCTCTTGG - Intronic
925392537 2:3506458-3506480 CCTAAGCATTTCATTTTTGGGGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
926398655 2:12471894-12471916 GCTAATTTTTTATTTTTTGTAGG + Intergenic
926403196 2:12521654-12521676 ACTCACCTTTTTTTTTTTGGAGG + Intergenic
926485981 2:13458976-13458998 GTTAATTTTTTATTTTTTGTAGG + Intergenic
926580373 2:14628163-14628185 TTTAATATTTTATTTTTTTGTGG - Intergenic
926773229 2:16396864-16396886 CCTTCTCTTTTTTTTTTTTGTGG + Intergenic
927035462 2:19170741-19170763 GCTAATTTTTTATTTTTTGTAGG + Intergenic
927530831 2:23798499-23798521 CATACTTTTTTTTTTTTTGGTGG - Intronic
927595186 2:24390164-24390186 CTTCATATTTTTTTTTTTGGTGG + Intergenic
928156982 2:28885823-28885845 GCTAATTTTTTATTTTTTGTAGG - Intergenic
928531735 2:32199693-32199715 CCCAATATTTTAGTTTTTTGAGG + Intronic
928554097 2:32404824-32404846 GCTAATTTTTTATTTTTTTGTGG + Intronic
928784075 2:34860800-34860822 GCTCAACTTTTAGTTTTTGGAGG - Intergenic
928851521 2:35753249-35753271 CTTTATTTTTTATTTTTTGTAGG - Intergenic
928911122 2:36422178-36422200 CCTATTATTTTGTTTCTTGGGGG + Intronic
928957836 2:36889601-36889623 CATATTCTTCTTTTTTTTGGGGG + Intronic
929095497 2:38259732-38259754 GCTAATTTTTAATTTTTTTGTGG + Intergenic
929150698 2:38745653-38745675 CCTAATTTTTTTTTTTTTCTGGG - Intronic
929223917 2:39493584-39493606 CCTTCTTTTTTATTTTTTGGTGG + Intergenic
929258083 2:39835275-39835297 CCTACACTTTTTTTTGTTGGAGG + Intergenic
929369694 2:41207666-41207688 CCTAATCTATTAAGTTGTGGAGG - Intergenic
929673246 2:43896369-43896391 CCTAATCTTGCATTTTTTAAGGG + Intronic
930009605 2:46925938-46925960 GCTAAGATCTTATTTTTTGGAGG + Intronic
930015845 2:46970152-46970174 GCTAATTTTTTCTATTTTGGGGG + Intronic
930085970 2:47497535-47497557 GCTAATTTTTTTTTTTTTTGGGG + Intronic
930188212 2:48431118-48431140 TTTAATTTTTTTTTTTTTGGAGG - Intergenic
930311080 2:49740426-49740448 TCTAATCTTTTAATTTTTGGTGG - Intergenic
930413902 2:51064912-51064934 TCTTTTCTTTTTTTTTTTGGTGG - Intergenic
930448085 2:51499979-51500001 CATAATCCTATATTTCTTGGAGG + Intergenic
930671332 2:54154046-54154068 CCTAAGGTTTTTTTTTTTGATGG + Intronic
930824758 2:55685361-55685383 ACTAATTTTTTTTTTGTTGGGGG - Intronic
930839290 2:55827312-55827334 CATAATCTCATATTTCTTGGAGG - Intergenic
931201843 2:60105267-60105289 CCAAATCTCTTATTTGCTGGTGG + Intergenic
931342649 2:61416804-61416826 CCTAATCTTTTTTTTTTTGGGGG + Intronic
931455075 2:62403473-62403495 CCTATTTATTTATTTTTTTGAGG + Intergenic
931504768 2:62912847-62912869 CCTATTCTTCTACTTGTTGGAGG - Intronic
931723955 2:65090791-65090813 ACTAATCTTTTATTTATTACAGG + Intronic
931728490 2:65132518-65132540 GGTAATTTTTTTTTTTTTGGTGG - Intergenic
931729532 2:65140794-65140816 CAGAATTTTTTTTTTTTTGGGGG - Intergenic
931921328 2:67019305-67019327 CATAATCCTATATTTCTTGGAGG - Intergenic
931922343 2:67034466-67034488 GCTAAGATTTTATATTTTGGGGG + Intergenic
932240381 2:70151642-70151664 CTTGTTTTTTTATTTTTTGGGGG - Intronic
932793789 2:74678083-74678105 CCTGGTCTTTTAGTTTTTTGGGG + Intronic
933042968 2:77492421-77492443 GCTAATCTTTTAATTTTGTGTGG + Intronic
933734031 2:85480644-85480666 ATTAATTTTTTATTTTTTAGTGG - Intergenic
933897278 2:86823442-86823464 GCTAATTTTTTAATTTTTTGTGG + Intronic
934072435 2:88396866-88396888 GCTAATTTTTTTATTTTTGGAGG - Intergenic
934099904 2:88642714-88642736 CATAATCTCATATTTTTTGGAGG - Intergenic
935044659 2:99469713-99469735 CCTAATGTTTTATCTTTTGCTGG + Intronic
935082585 2:99813030-99813052 GATTATCTTTTTTTTTTTGGAGG - Intronic
935113406 2:100112524-100112546 GCTAATTTTTTATTTTTTGTAGG - Intronic
935459754 2:103316480-103316502 TTTCATTTTTTATTTTTTGGAGG + Intergenic
935495757 2:103779312-103779334 TCTCATCTTTTTTTTTTTTGTGG - Intergenic
935608844 2:104999696-104999718 GATAATCTTTTAGTTTTTTGAGG - Intergenic
935823716 2:106920196-106920218 TTTAATCTTTTATTTTCTTGGGG + Intergenic
936097942 2:109548174-109548196 CCTAGTTTTTTTTTTTTTTGAGG - Intronic
936506059 2:113108227-113108249 TCTTATCTTTTTTTTTTGGGGGG + Intronic
936740462 2:115500396-115500418 CTTATTTTTTTATTTTGTGGAGG - Intronic
936832605 2:116666906-116666928 CCTTCTCTTTTAATTTTTGAAGG + Intergenic
937191628 2:120106991-120107013 AATCATCTTTTTTTTTTTGGAGG + Intronic
937545209 2:123008660-123008682 CCTACTCTTCAATTTTTTGGGGG - Intergenic
937689466 2:124738564-124738586 GCTAATTTTTTATTTTTAGTAGG - Intronic
937774785 2:125763294-125763316 TCTTTTCTTTTCTTTTTTGGCGG - Intergenic
937857781 2:126685030-126685052 GCTATTCATTTATTTCTTGGGGG + Intronic
938136538 2:128763167-128763189 TCAATTCGTTTATTTTTTGGAGG + Intergenic
938524746 2:132118777-132118799 GCTAATTTTTTATTTGTTGAGGG + Intergenic
938800949 2:134762848-134762870 CCTGCTCTTTTATTTCTTGTGGG - Intergenic
939065815 2:137482183-137482205 CCTTTTTTTTTTTTTTTTGGTGG - Intronic
939457236 2:142453162-142453184 ACTAATCTTTTTTTTGTTGTTGG - Intergenic
939594368 2:144105581-144105603 CATAGTCTTATATTTCTTGGAGG - Intronic
940018073 2:149127641-149127663 CATTTTCTTTAATTTTTTGGTGG + Intronic
940055949 2:149512474-149512496 CTTTTTCTTTTTTTTTTTGGCGG - Intergenic
940210976 2:151256516-151256538 CCCAATGTTTTATTTTTTTATGG - Intronic
940370703 2:152897355-152897377 CATAATCCCATATTTTTTGGAGG - Intergenic
941042749 2:160641737-160641759 TCTACTCTTTTTTTTTTTTGAGG + Intergenic
941056333 2:160793272-160793294 CTTAACATTTTTTTTTTTGGTGG - Intergenic
941497730 2:166227964-166227986 CATAACCTTTTATTTTTTAAAGG + Intronic
941521893 2:166555517-166555539 CCTCATCTATTTTTTTTTTGTGG - Intergenic
941553032 2:166940110-166940132 CCTAATCCAATATTTCTTGGAGG + Intronic
941922585 2:170866276-170866298 GCTAATTTTTTGTATTTTGGTGG + Intergenic
942079950 2:172390738-172390760 TCTAATCTGTTATTTTTTATGGG + Intergenic
942081307 2:172401893-172401915 CTTAATCTTTTTTTCTCTGGGGG + Intergenic
942286612 2:174423951-174423973 GCTAATTTTTAATTTTTTTGTGG + Intronic
942385235 2:175435882-175435904 CCTCAAGTTTTAATTTTTGGGGG + Intergenic
942940873 2:181615165-181615187 CCTATTGTTGTATTTTTTTGGGG + Intronic
943001341 2:182332012-182332034 CATAGTCTTATATTTCTTGGCGG + Intronic
943130112 2:183843355-183843377 CATAGTTTTATATTTTTTGGAGG - Intergenic
943525035 2:189005939-189005961 CTTAAACTTTTATTTATTAGAGG + Intronic
943627773 2:190218299-190218321 CCTTATATTTTATTTTTTAACGG - Intronic
943678943 2:190747336-190747358 CCTAATGTTTCTTTTTTTAGTGG - Intergenic
943721164 2:191204874-191204896 GCTAATTTTTTAATTTTTTGTGG + Intergenic
944246817 2:197539036-197539058 CCTGTTTTTTTCTTTTTTGGGGG + Intronic
944365357 2:198912882-198912904 GCTAATTTTTTATTTTTTGTAGG + Intergenic
944818452 2:203404114-203404136 CCAAGTCTTCTCTTTTTTGGAGG + Intronic
945243272 2:207696312-207696334 CTTAATTTTTTATATTTTAGTGG + Intergenic
945273716 2:207967157-207967179 TTTTATTTTTTATTTTTTGGTGG + Intronic
945592394 2:211749631-211749653 CCTATATTTTTATTCTTTGGTGG + Intronic
945627066 2:212222764-212222786 CCTAATTTTGCATATTTTGGGGG + Intronic
945807761 2:214511120-214511142 GCTAATTTTTAAATTTTTGGTGG - Intronic
945810053 2:214537900-214537922 CCTTTTTTTTTTTTTTTTGGTGG + Intronic
945815976 2:214605350-214605372 CCTAATTTTGTATTTTTTTAAGG - Intergenic
946454516 2:219813377-219813399 TCTAATTTTTTTTTTTTAGGAGG + Intergenic
946758287 2:222968248-222968270 CCTTATTTTTTGTTTTGTGGAGG + Intergenic
947402926 2:229746648-229746670 GCTAATTTTTTAATGTTTGGTGG - Intergenic
947426912 2:229992158-229992180 TTTAATCTTTTTTTTTTTTGAGG + Intronic
947682890 2:232051925-232051947 TCCAATCTTTTATATTTGGGGGG - Intronic
947857921 2:233336929-233336951 GCTAATGTTTTAATTTTTTGTGG - Intronic
947862282 2:233369133-233369155 CCATTTATTTTATTTTTTGGGGG + Intronic
947995584 2:234524489-234524511 GCAAACCTTTTTTTTTTTGGTGG - Intergenic
948141129 2:235672045-235672067 AATAATATTTTTTTTTTTGGTGG - Intronic
948416668 2:237811431-237811453 GCTAATTTTTTAATTTTTTGTGG + Intronic
948549057 2:238756064-238756086 ACCAGTCTTTTCTTTTTTGGGGG + Intergenic
948965300 2:241374946-241374968 CCAAATCTTTTTCTTTTTTGAGG + Intronic
948997354 2:241589250-241589272 CCAAATGTTGTTTTTTTTGGTGG - Intronic
1168733169 20:104803-104825 CATAATCTCATATTTCTTGGTGG - Intergenic
1168790332 20:571986-572008 CTTCTTCTTTTTTTTTTTGGTGG + Intergenic
1168794130 20:599973-599995 GCTAATTTTTTATTTTGAGGGGG - Intergenic
1168846794 20:950666-950688 CCTTATCTGGTATTTTTTAGAGG - Intergenic
1168872060 20:1138098-1138120 CCTCCTCTTCTATTTTTTGGAGG - Intronic
1168907044 20:1413769-1413791 CCTCTGCTTCTATTTTTTGGAGG - Intergenic
1169017309 20:2302426-2302448 TCTAAGCTATTGTTTTTTGGGGG - Intronic
1169151984 20:3296540-3296562 GCTAATTTTTTATTTTTTGTAGG + Intronic
1169782269 20:9322259-9322281 CCTAGTCTTTAATTTTTGAGGGG + Intronic
1170050002 20:12131838-12131860 CCTATACTTTCATTTTGTGGGGG - Intergenic
1171329284 20:24323476-24323498 CCTAATTTTTAAATTTTTTGTGG + Intergenic
1171443395 20:25185497-25185519 CGTAGTCTTGTATTTCTTGGAGG + Intergenic
1172076365 20:32301025-32301047 GCTAATTTTTAAATTTTTGGTGG + Intronic
1172177629 20:32982156-32982178 GCTAATCTTTTTTTTTTTTTTGG - Intergenic
1172307086 20:33888556-33888578 CCATATCTTTTTTTTTTTGAGGG + Intergenic
1172418015 20:34787863-34787885 CCTAATTTTTTTTTTTTTTTTGG + Intronic
1172632338 20:36386749-36386771 GCTAATTTTTTATTTGTTGTAGG + Intronic
1172660619 20:36565880-36565902 CTTAATTTTTTATTTTTCGTAGG + Intergenic
1172994603 20:39060839-39060861 TTTCATCTTTTTTTTTTTGGAGG + Intergenic
1173088613 20:39949157-39949179 CCTAACTGTTTATATTTTGGGGG + Intergenic
1173435353 20:43027472-43027494 TCTAATTTTTTTTTTTTTTGAGG - Intronic
1173472274 20:43333108-43333130 CTTAATCATTTGTTTTTTGGGGG + Intergenic
1173700365 20:45064686-45064708 CCTGGTATTTTATTTTTTTGTGG + Intronic
1173925066 20:46775005-46775027 CCTAATTGTTTAATTTTTTGTGG + Intergenic
1174236304 20:49095477-49095499 GCTAATTTTTTATTTTTTTGTGG + Intronic
1174419916 20:50392736-50392758 GCAAATTTTTTATTTTTTGTAGG - Intergenic
1174467119 20:50726200-50726222 GCTAATTTTGTATTTTTTAGTGG + Intergenic
1174468881 20:50740543-50740565 TCTAAGTTTTTATTTATTGGTGG + Intronic
1174529401 20:51199130-51199152 CCTAATTTTTTTTTTTTTTAAGG - Intergenic
1174650819 20:52123859-52123881 AGTAAACTTTTCTTTTTTGGGGG + Intronic
1174941379 20:54932446-54932468 ACTAATTTTTTAGTTTTTTGAGG + Intergenic
1175111181 20:56649220-56649242 ACTATGCTTTTTTTTTTTGGAGG + Intergenic
1175150408 20:56929090-56929112 CTCAATCTTTTGTATTTTGGGGG + Intergenic
1175851446 20:62096194-62096216 GCTAATTTTTAATTTTTTGGTGG - Intergenic
1176001547 20:62833856-62833878 ACTAATTTTTTGTGTTTTGGGGG + Intronic
1176345758 21:5745113-5745135 CATAATCTTATATTTTTCAGAGG + Intergenic
1176352572 21:5865697-5865719 CATAATCTTATATTTTTCAGAGG + Intergenic
1176499069 21:7579342-7579364 CATAATCTTATATTTTTCAGAGG - Intergenic
1176540079 21:8143183-8143205 CATAATCTTATATTTTTCAGAGG + Intergenic
1176559030 21:8326228-8326250 CATAATCTTATATTTTTCAGAGG + Intergenic
1176605134 21:8824090-8824112 GCTAATTTTTTTTTTTTTAGTGG - Intergenic
1176863341 21:14026999-14027021 GCTAACGTTTTATTTTTTAGAGG + Intergenic
1177064644 21:16414747-16414769 CCTCTGCTTTTATGTTTTGGAGG + Intergenic
1177079074 21:16616231-16616253 CAGAATCTTTTTTTTTTTGCGGG + Intergenic
1177149546 21:17441274-17441296 TCTTTTCTTTTATTTTTTGTGGG - Intronic
1177704357 21:24682184-24682206 CATTATCATTTTTTTTTTGGTGG - Intergenic
1177709142 21:24748240-24748262 CTCAATTTTTTCTTTTTTGGAGG - Intergenic
1177723287 21:24935217-24935239 GCTAAGTTTTTATTTTTTGTAGG + Intergenic
1178006106 21:28221110-28221132 CCTAATTTTCTATTTTTTCTTGG + Intergenic
1178053906 21:28777734-28777756 CCTTATCTTTAATCTTTTGGAGG - Intergenic
1178207746 21:30488945-30488967 GCTATTTTTTGATTTTTTGGTGG - Intronic
1178242420 21:30918039-30918061 CCAAATTATTTATTTCTTGGGGG - Intergenic
1178289538 21:31355169-31355191 CCTTTTTTTTTTTTTTTTGGTGG - Intronic
1178302381 21:31463811-31463833 CCTATTCTTTTTTTTTTTTTTGG - Intronic
1178451844 21:32708948-32708970 CTTTATTTTTTATTTTTTAGAGG - Intronic
1178706424 21:34877320-34877342 CCTGAACTTCAATTTTTTGGGGG + Intronic
1178792459 21:35712895-35712917 CTGAGTCTTTTTTTTTTTGGTGG - Intronic
1179592845 21:42421848-42421870 TCTTTTCTTTTCTTTTTTGGGGG - Intronic
1179605253 21:42512072-42512094 CATTATTTTTTTTTTTTTGGTGG - Intronic
1179919833 21:44501764-44501786 CCTTCTTATTTATTTTTTGGGGG - Intronic
1180261897 21:46676318-46676340 CCTAAACTTTTGTTTTTTTTTGG + Intergenic
1180347427 22:11715695-11715717 GCTAATTTTTTTTTTTTTAGTGG - Intergenic
1180419599 22:12801219-12801241 ATTATTCTTTTCTTTTTTGGAGG - Intergenic
1181156378 22:20924020-20924042 GCTAATTTTTTAATTTTTTGTGG - Intronic
1181228763 22:21408198-21408220 GCTAATTTTTTTTTTTTTTGAGG + Intergenic
1181249887 22:21526667-21526689 GCTAATTTTTTTTTTTTTTGAGG - Intergenic
1181348400 22:22237629-22237651 GCTAATTTTTTAATTTTTTGTGG - Intergenic
1182237903 22:28890920-28890942 GCTAATTTTTTATTTTTTGTAGG + Intronic
1182367162 22:29786973-29786995 CCTTATTTATTATTTTCTGGAGG + Intergenic
1182476185 22:30577654-30577676 CCCTTTCTTTTTTTTTTTGGGGG + Intronic
1182528879 22:30940137-30940159 CCTACTCTTTTTTTCCTTGGTGG - Intronic
1182738832 22:32551505-32551527 CCTTGTCATTTATTTGTTGGTGG - Intronic
1182788110 22:32924925-32924947 CCTAAGTTTTAAATTTTTGGTGG - Intronic
1182918156 22:34054526-34054548 CTTTCTCTTTTTTTTTTTGGTGG + Intergenic
1182990226 22:34760625-34760647 CCTGAGCTTTTATGTTTTTGGGG - Intergenic
1183549441 22:38472862-38472884 GCTAATTTTGTATTTTTTAGTGG + Intronic
1183913381 22:41096157-41096179 CATAATCTTTTTTTTTTGGAGGG - Intronic
1184158642 22:42685228-42685250 GCTAATTTTTTTTTTTTTTGAGG + Intergenic
1184344707 22:43906092-43906114 AATAATTGTTTATTTTTTGGTGG + Intergenic
1184919204 22:47593803-47593825 CCTAATCTTTTCTTCTTATGAGG - Intergenic
1185286738 22:50004241-50004263 ACTAATTTTTTAATTTGTGGTGG + Intronic
1185401462 22:50620337-50620359 GCTAATTTTGTATTTTTTAGTGG - Intergenic
1185412537 22:50692441-50692463 GCTAATTTTGTATTTTTTAGAGG + Intergenic
1203245024 22_KI270733v1_random:59542-59564 CATAATCTTATATTTTTCAGAGG + Intergenic
949149270 3:745135-745157 GCTAATTTTTTATATTTTTGTGG - Intergenic
949580451 3:5382952-5382974 CCTAGTCTCATATTTCTTGGAGG + Intergenic
949798748 3:7879576-7879598 CCTAATCTCATATTTCTTGGTGG - Intergenic
950727740 3:14928237-14928259 CCAATTTTTTTATTTTTTGTAGG + Intronic
950755656 3:15169838-15169860 CAAAATCTTTTCTTTGTTGGAGG + Intergenic
950859208 3:16132642-16132664 CTGATTCTTTTTTTTTTTGGAGG - Intergenic
951195774 3:19821858-19821880 GCTAATTTTGTATTTTTTGTAGG - Intergenic
951264346 3:20548601-20548623 ACTGGTTTTTTATTTTTTGGTGG - Intergenic
951435803 3:22662937-22662959 CATAATATTTTATTTTTTCTAGG - Intergenic
951601097 3:24376847-24376869 AGTAATTTTTTATTTTATGGTGG - Intronic
951695381 3:25440771-25440793 TTTAATTTTTTATTTTTGGGGGG - Intronic
951728667 3:25786319-25786341 GCTATTCTTTTTTTTTTTTGAGG - Intronic
951733837 3:25840786-25840808 CCTGGGCTTTTATTTTATGGAGG - Intergenic
952015386 3:28950662-28950684 GCTTTTCTTTTATTTCTTGGAGG + Intergenic
952259846 3:31729418-31729440 CTTAGACTTTTCTTTTTTGGAGG + Intronic
952510993 3:34055426-34055448 CCCAATCTTTTTTCCTTTGGTGG + Intergenic
952548457 3:34449036-34449058 CATAATCCCATATTTTTTGGAGG + Intergenic
952560833 3:34591711-34591733 CATAATCTTATATTTTTCAGAGG + Intergenic
952762917 3:36931243-36931265 CTTAATATTTTGTTTTTTGGGGG - Intronic
952772093 3:37011028-37011050 CCCAATCTTTTCTTGGTTGGCGG - Intronic
953051134 3:39345008-39345030 CATCATATTTTCTTTTTTGGGGG - Intergenic
953091372 3:39729403-39729425 CCTAATGTTTTATTTTTGAAGGG + Intergenic
953092448 3:39742629-39742651 CATAATCCTATATTTCTTGGAGG + Intergenic
953281051 3:41557599-41557621 GCTAATTTTTTTTTTTTTGGTGG - Intronic
953295140 3:41707663-41707685 GCTAATTTTTTATTTTTCTGCGG - Intronic
953415827 3:42716237-42716259 CCTGATTTTTTTTTTTTTGGAGG - Intronic
953630595 3:44613086-44613108 TCTAGTTTTTTTTTTTTTGGTGG - Intronic
953731444 3:45452800-45452822 CCTGATCTTTTCTTTGATGGAGG + Intronic
953822327 3:46218335-46218357 CCTAGACTTTTTTTTTTTGTTGG - Intronic
953861942 3:46551963-46551985 ACTAATTTTTTAATTTTTTGTGG + Intronic
953973312 3:47363691-47363713 TCTAATTTTTTAATTTTTTGTGG - Intergenic
954030332 3:47814886-47814908 AATAATTTTTTTTTTTTTGGTGG + Intronic
954067292 3:48116947-48116969 TCTAATTTTTTAATTTTTTGTGG - Intergenic
954230260 3:49211393-49211415 CCTAAGTATTTCTTTTTTGGGGG + Intronic
954264904 3:49464420-49464442 GCTAATGTTTTTTTTTTTTGAGG - Intergenic
954347533 3:50012905-50012927 GCTAATTTTATATTTTTTAGTGG + Intronic
954407320 3:50352519-50352541 GCTAATTTTTGGTTTTTTGGGGG - Intronic
954498803 3:50990133-50990155 CATAATCTCATACTTTTTGGGGG - Intronic
954728767 3:52639434-52639456 TCTTTTCTTTTTTTTTTTGGAGG + Intronic
955499774 3:59572208-59572230 CCTCAGCTTTTATTTTTTCCAGG + Intergenic
955678151 3:61471193-61471215 GCTAATTTTTTATTTTTAGTAGG + Intergenic
955739664 3:62076744-62076766 GCTAATTTTGTATTTTTTGTAGG + Intronic
956112297 3:65881624-65881646 CCTAACTTTTTTTTTTTTTGAGG - Intronic
956830769 3:73045522-73045544 CCTAATTTTTTTTTTTTTTTTGG + Intronic
957542874 3:81598092-81598114 CCTAATGTTCTATTTATTTGTGG + Intronic
957872964 3:86111493-86111515 TCTTTTCTTTTATTTTTTTGAGG + Intergenic
957990365 3:87619251-87619273 CCTTATATTTAGTTTTTTGGGGG + Intergenic
958068092 3:88571533-88571555 TCTATTTTTTTAGTTTTTGGAGG - Intergenic
958462795 3:94419780-94419802 CATAATTTTATATTTATTGGAGG - Intergenic
958639765 3:96790666-96790688 TCTAACTTTTTTTTTTTTGGTGG + Intergenic
958702970 3:97616759-97616781 CATAATCCTATATTTCTTGGAGG - Intronic
959125652 3:102287458-102287480 CATAATCTTTTATATTTCTGTGG + Intronic
959644814 3:108686588-108686610 CCTTAGTTTTTATTTATTGGTGG + Intronic
960076372 3:113490475-113490497 CCTAATTTTTGTGTTTTTGGTGG - Intronic
960300640 3:115998933-115998955 TTCAATCTTTTATTTTTTGAAGG - Intronic
960322153 3:116249548-116249570 CCTAATTTTTGTATTTTTGGTGG + Intronic
960651265 3:119952600-119952622 TCTCATGTTTTTTTTTTTGGTGG - Intronic
960793018 3:121453708-121453730 CATAATCTCATATTTCTTGGAGG - Intronic
960928364 3:122818946-122818968 CACAATATTTTTTTTTTTGGGGG - Intronic
961209475 3:125114588-125114610 CATATTTTTGTATTTTTTGGTGG + Intronic
961238451 3:125389121-125389143 ACTAATTTTTTATTGTTTTGTGG - Intergenic
962192696 3:133328014-133328036 ACTAATTTTTCATCTTTTGGGGG + Intronic
962717970 3:138143961-138143983 CCTAAGTATTTAATTTTTGGGGG - Intergenic
962972802 3:140420287-140420309 ACTACTTTTTTTTTTTTTGGCGG - Intronic
962993984 3:140606659-140606681 CATAATCTCATATTTCTTGGAGG - Intergenic
963674389 3:148290853-148290875 GCAAATTTTTTATTATTTGGAGG + Intergenic
963790148 3:149575092-149575114 CCCCATCTTTTTTTTTTGGGGGG - Intronic
963889953 3:150623372-150623394 CTTAATCTTTTTATTTTGGGGGG + Intronic
963890228 3:150626965-150626987 AATCATCTTTAATTTTTTGGGGG + Intronic
964036005 3:152197198-152197220 CCCAATTTTTTTCTTTTTGGTGG - Intergenic
964110509 3:153082625-153082647 ACTAATTTTTTATTTTTTGTAGG - Intergenic
964209430 3:154210942-154210964 ACAAATTTTTTTTTTTTTGGTGG - Intronic
964221719 3:154354563-154354585 CCTTTTCCTTTTTTTTTTGGAGG + Intronic
964320262 3:155488360-155488382 GCTAATTTTTTATTTTTAGTAGG + Intronic
964355042 3:155842841-155842863 GCTAATTTCTTATTTTTTGTAGG - Intronic
964504361 3:157382261-157382283 CTTAATCTTTCATTCTTTGAAGG - Intronic
964561562 3:158002317-158002339 CCTGGGCTTTTATTTGTTGGTGG + Intergenic
964581749 3:158247041-158247063 CATAATCTTGTATTTCTCGGAGG + Intronic
964610401 3:158608818-158608840 CATTATCTTTTGTTGTTTGGGGG - Intergenic
964821351 3:160773793-160773815 TCTCATCTTTGATTTTTTGTTGG + Intronic
964950746 3:162289634-162289656 CCTAATCTTATAGTTGTTTGTGG - Intergenic
965018301 3:163190235-163190257 CTTAATCATTTATTCTTTTGTGG - Intergenic
965528822 3:169750020-169750042 TATAATTTTTTTTTTTTTGGGGG - Intergenic
965757072 3:172038438-172038460 CCTTTTTTTTTTTTTTTTGGAGG - Intergenic
965769077 3:172161972-172161994 GATAATTTTTTTTTTTTTGGGGG + Intronic
966290050 3:178344630-178344652 CATAATCTCATATTTCTTGGAGG - Intergenic
966320676 3:178698282-178698304 CATAATCCCATATTTTTTGGAGG + Intronic
966572671 3:181463669-181463691 CCTTTTTTTTTTTTTTTTGGAGG - Intergenic
966574369 3:181482987-181483009 CCTAATCAGTTCATTTTTGGGGG + Intergenic
966723219 3:183085462-183085484 GCTAATTTTTTATTTTTTGTAGG - Intronic
966848541 3:184149511-184149533 CCTTTTTTTTTTTTTTTTGGAGG - Intronic
967272360 3:187741975-187741997 TCTAAGGTTTTTTTTTTTGGTGG - Intronic
967428303 3:189352604-189352626 CCTTATCTTTTATTTTTTTCTGG + Intergenic
967494562 3:190128412-190128434 CCTAATTTATGATTTTTTTGTGG + Intergenic
967512577 3:190329108-190329130 GCAAATTTGTTATTTTTTGGGGG + Intronic
967575051 3:191079544-191079566 CATATTCTGTTATTTTTGGGTGG - Intergenic
967602591 3:191407006-191407028 CCTCCTATTCTATTTTTTGGAGG + Intergenic
967718148 3:192787737-192787759 CCTTACCTATTATTTTTTAGGGG - Intergenic
967797929 3:193618481-193618503 TCTTTTCTTTTTTTTTTTGGGGG - Intronic
967909216 3:194527495-194527517 CCTTTTTTTTTTTTTTTTGGAGG + Intergenic
968199880 3:196743121-196743143 ACCAGTATTTTATTTTTTGGGGG - Intronic
968261024 3:197324341-197324363 CCCATTATTTTATTTTTTTGAGG + Intergenic
968384411 4:123724-123746 GCTAACATTTTATTTTTTAGAGG + Intergenic
968390131 4:185468-185490 CATATTCTGTTATTTTTGGGTGG + Intergenic
968410438 4:385731-385753 GCTAACATTTTATTTTTTAGAGG + Intergenic
968419838 4:474574-474596 CCTAACATTTTATTTTTTAGAGG - Intronic
968421736 4:490582-490604 GCTAACATTTTATTTTTTAGAGG + Intronic
968678898 4:1902388-1902410 GTTAATTTTTTATTTTTTGTAGG + Intronic
968723483 4:2225834-2225856 GCTAATTTTTTATTTTTGTGTGG - Intronic
968780563 4:2577581-2577603 GCTAATTTTTTAATTTTTAGTGG + Intronic
969708090 4:8823762-8823784 CCTAATTTTTTTTTTTTAGATGG - Intergenic
969779780 4:9390942-9390964 TCTAATATCTTATTTTTTTGAGG - Intergenic
969783045 4:9426016-9426038 CTTCATCTTTTATTTTATTGTGG - Intergenic
969802723 4:9582027-9582049 ACCAACCTTTTATTTTGTGGGGG - Intergenic
970285333 4:14506952-14506974 CATAATCCTATATTTCTTGGAGG + Intergenic
970288772 4:14549124-14549146 GCTTTTCTTTTTTTTTTTGGTGG - Intergenic
970963840 4:21905118-21905140 TCTAATCATTTTATTTTTGGTGG - Intronic
971078481 4:23178669-23178691 ACGTATCTTTTTTTTTTTGGGGG - Intergenic
971106143 4:23525951-23525973 CATAATCTCATACTTTTTGGAGG - Intergenic
971288556 4:25313262-25313284 CCTAATTTTTTATTTTTGAAGGG - Intronic
971320139 4:25598958-25598980 CCTGTTTTTTTTTTTTTTGGTGG + Intergenic
971403543 4:26299105-26299127 CCAACTCCTTTATTTTTTTGAGG - Intronic
971466031 4:26961914-26961936 GCTTATTTTTTATTTTTTGTTGG + Intronic
971529525 4:27668246-27668268 ACTAATATTTTATTATTTGTAGG - Intergenic
971554806 4:28000778-28000800 CCTAATCTTTTCTGGTTTGGAGG + Intergenic
971934607 4:33131808-33131830 CCTGATTCTTTTTTTTTTGGGGG + Intergenic
972046216 4:34667612-34667634 TCTAATCTTTTCTTTTTTCATGG - Intergenic
972308385 4:37854350-37854372 CTTTTTCTTTTCTTTTTTGGAGG + Intronic
972442183 4:39105309-39105331 GCTAATTTTTTAATTTTTGGTGG + Intronic
972531700 4:39967138-39967160 GCTAACTTTTTATATTTTGGTGG - Intronic
972775731 4:42238591-42238613 CTTAATCTTTTTTTTTTAAGTGG + Intergenic
973087834 4:46089960-46089982 CCTATGTTTTTATTTTTTTGAGG - Intronic
973109452 4:46378824-46378846 CCTACTTTTTTTTTTTTTTGAGG - Intronic
973362183 4:49176054-49176076 AGTATTCTTTTCTTTTTTGGAGG + Intergenic
973398913 4:49620806-49620828 ATTATTCTTTTCTTTTTTGGAGG - Intergenic
973658124 4:53072555-53072577 CCTAATCTTTTATTATTCTCTGG - Intronic
973666682 4:53166828-53166850 CCTTTTTTTTTTTTTTTTGGTGG - Intronic
973681532 4:53325347-53325369 GTTAATCATTTATGTTTTGGTGG - Intronic
973712119 4:53640634-53640656 CCTAAACTAATATATTTTGGGGG - Intronic
973914117 4:55615911-55615933 CTTAAATTTTTATTATTTGGTGG + Intronic
973963525 4:56136017-56136039 TGTACTCTTTTTTTTTTTGGTGG + Intergenic
973972130 4:56223921-56223943 GCTAATTTTTTAATTTTTTGTGG + Intronic
974529211 4:63085327-63085349 CATAATCTCATATTTTTTGGAGG + Intergenic
974567027 4:63591080-63591102 CATAGTCTCTTATTTCTTGGAGG - Intergenic
974788143 4:66649298-66649320 CCTAATCTGTTATTGGCTGGTGG + Intergenic
974852287 4:67418246-67418268 TCTCATCTTTTATTTATTGGAGG + Intergenic
974933120 4:68382774-68382796 AATAATTTTTTTTTTTTTGGGGG - Intergenic
974953634 4:68612084-68612106 CCTGGACTTTTATTTATTGGAGG - Intronic
974955292 4:68632101-68632123 TCTCCTCTTTTATTTTTTGGAGG + Intronic
975022367 4:69504579-69504601 CAAAATCTCATATTTTTTGGAGG - Intronic
975231181 4:71935370-71935392 CCTAATCTTTTATGTCTCTGTGG + Intergenic
975247470 4:72136400-72136422 TCTAGTCTTTTTTTTTCTGGTGG - Intronic
976078556 4:81327323-81327345 ACTAAACTGTTATTTTTTGGGGG - Intergenic
976167758 4:82273228-82273250 CGTAGTCTTATATTTCTTGGAGG - Intergenic
976175568 4:82348153-82348175 CCTTTCCTTTTTTTTTTTGGTGG - Intergenic
976298471 4:83495575-83495597 CGTAATGTTTTTTTTTTTTGGGG + Intronic
976340226 4:83938910-83938932 CATAGTCATATATTTTTTGGGGG + Intergenic
976470696 4:85425286-85425308 GCTAATTTTTAATTTTTTTGTGG + Intergenic
976594726 4:86884467-86884489 GCTAATTTTTTAATTTTTTGTGG + Intronic
976630276 4:87229418-87229440 CCTTTTTTTTTTTTTTTTGGTGG + Intronic
976656270 4:87491951-87491973 GCTAATTTTTTTTTTTTTGGGGG - Intronic
976852735 4:89567247-89567269 CATAGTCTTATATTTCTTGGAGG + Intergenic
976913718 4:90343160-90343182 CTTTCTCTTCTATTTTTTGGGGG + Intronic
977202767 4:94136489-94136511 GCTAATTTTTTAATTTTTTGTGG - Intergenic
977550448 4:98436503-98436525 CCTTATCTTTTATTTGTGGAGGG + Intronic
977680165 4:99789959-99789981 ACTAATCCTGTCTTTTTTGGAGG + Intergenic
978499498 4:109393835-109393857 CCAAACCTGTTATTCTTTGGTGG + Intergenic
978567724 4:110101949-110101971 CTCAATTTTTTACTTTTTGGGGG - Intronic
978572724 4:110156519-110156541 GCTAATTTTTTAATTTTTTGTGG - Intronic
978740714 4:112134920-112134942 CATAAGCTTTTTTTTTGTGGGGG - Intergenic
979008709 4:115338849-115338871 TCTAATCTTTGACTTTTTAGTGG + Intergenic
979201052 4:117978561-117978583 CCTTTTTTTTTTTTTTTTGGTGG - Intergenic
979255000 4:118599897-118599919 CATATTCTTTTTTTTTTTTGAGG - Intergenic
979557136 4:122061961-122061983 CCTTATGATTTTTTTTTTGGGGG + Intergenic
979585732 4:122414258-122414280 CCAAATGTCTTTTTTTTTGGGGG + Intronic
979698150 4:123637923-123637945 CATAGTCTCATATTTTTTGGAGG + Intergenic
979704421 4:123705120-123705142 CCTGATCTTTTTTTTTTTAAGGG - Intergenic
979912149 4:126381021-126381043 CATAATCTCATATTTCTTGGAGG + Intergenic
980062831 4:128150455-128150477 ACTAATTTTTTACTTTTTTGTGG + Intronic
980131811 4:128823493-128823515 CATAATTTTTTTTCTTTTGGAGG + Intronic
980250384 4:130307220-130307242 CTTAATCTGTTATTCTTTGGGGG - Intergenic
980330520 4:131404385-131404407 GCTAATTTTTCAATTTTTGGTGG + Intergenic
980335133 4:131463336-131463358 CATAATCTTTTTTCTTTTGGAGG - Intergenic
980513344 4:133822397-133822419 CATAGTCCCTTATTTTTTGGAGG + Intergenic
980583786 4:134787583-134787605 CATAATCTCATATTTCTTGGAGG + Intergenic
980608273 4:135122302-135122324 CCTAAACATTTATTTTTTAAGGG - Intergenic
980769467 4:137352344-137352366 CATAGTCTCTTATTTCTTGGAGG - Intergenic
980935034 4:139218350-139218372 GCTAATTTTTTGTATTTTGGTGG + Intergenic
981063113 4:140448364-140448386 CATAATCTCATATTTCTTGGAGG + Intronic
981100534 4:140825000-140825022 CATAGTCTTATATTTCTTGGAGG + Intergenic
981401940 4:144323213-144323235 CATAATCCTATATTTTATGGAGG - Intergenic
981653235 4:147082565-147082587 CCCAAGCTTTTCTTGTTTGGAGG - Intergenic
981896115 4:149802031-149802053 TCTATTCTTTTAATTTTTTGTGG - Intergenic
982223990 4:153149133-153149155 GCTAATTTTTTATTTTTGGTAGG + Intergenic
982561212 4:156930406-156930428 CCTAATATCACATTTTTTGGCGG + Intronic
983276187 4:165620796-165620818 CATAATCTTTTAGTTAGTGGAGG - Intergenic
983598143 4:169493769-169493791 CATAATCTTATATTTCTTGAAGG - Intronic
983756621 4:171346552-171346574 TTTAATCTTTTATTTTTAAGTGG - Intergenic
984571070 4:181394583-181394605 CCTAATCTCTTATTTTTATCTGG - Intergenic
984962460 4:185111041-185111063 CCTATTTTTTTTTTTTTTTGGGG - Intergenic
985160791 4:187042183-187042205 GCTAATTTTGTATTTTTTAGTGG - Intergenic
985270514 4:188190259-188190281 CCCAATCTTTTTTTTTTAGGAGG - Intergenic
985597672 5:803952-803974 CTTAATCTTTTTTTTTTTTCTGG - Intronic
985981013 5:3463490-3463512 CCTAATTATTTCTTTTTTTGGGG - Intergenic
986432197 5:7692150-7692172 CCTCATCTGTTATGTTTTGATGG + Intronic
986866192 5:11991093-11991115 CTTTATCTTTTATTTTTTAGAGG - Intergenic
986915308 5:12612589-12612611 CATAATTTTATATTTTTTGGAGG + Intergenic
987064887 5:14280303-14280325 CCTAATGTTTGTTTTTTAGGTGG + Exonic
987155385 5:15083945-15083967 GCTAATCTTTTAATTTTTTTTGG - Intergenic
987273099 5:16333383-16333405 CCTAAGGATTTATTTTTTTGGGG - Intergenic
987439248 5:17935767-17935789 GCTTATCATTTATATTTTGGTGG - Intergenic
987530749 5:19116003-19116025 CATAATCTCATATTTCTTGGAGG - Intergenic
987583646 5:19826208-19826230 CATAATCTCATATTTCTTGGAGG - Intronic
987751246 5:22040740-22040762 CCTCATCTTTTACTTGTTTGAGG - Intronic
988095832 5:26608665-26608687 CCCATTTTTTTTTTTTTTGGCGG + Intergenic
988161452 5:27522878-27522900 CATGATCTTTTATTGTTTAGAGG - Intergenic
989052331 5:37333964-37333986 GCTAATTTTTTATTTTTAGTGGG + Intronic
989058943 5:37390879-37390901 GCTAATTTTTTATTTTTAGTAGG + Intronic
989749184 5:44870839-44870861 CCTCCTTTTTTATTTTTTGAAGG + Intergenic
989966323 5:50469947-50469969 CATAGTCTTATATTTCTTGGAGG + Intergenic
989971401 5:50529181-50529203 CCTAATTTTTTTTTTTTTTTTGG + Intergenic
990139314 5:52684388-52684410 ACTAACATATTATTTTTTGGTGG - Intergenic
990224140 5:53630543-53630565 CATAATCGTATATTTCTTGGAGG + Intronic
990377320 5:55184622-55184644 CCCAATTCTTTATTTTATGGTGG - Intergenic
990434858 5:55778890-55778912 CCACATCTTTTTTTTTTTTGAGG - Intronic
990455959 5:55988127-55988149 CCTTTTTTTTTTTTTTTTGGAGG - Intronic
990661716 5:58022745-58022767 TCTAATCCTTTGTTTTTTGGTGG - Intergenic
990840576 5:60075670-60075692 CATAATATCTTATTTCTTGGAGG + Intronic
991429898 5:66533585-66533607 GCTAATTTTTTAATTTTTTGAGG + Intergenic
991440659 5:66644865-66644887 CCCACTCTTTTAATTTTGGGAGG + Intronic
991529804 5:67602989-67603011 CATAGTCTTATATTTCTTGGAGG + Intergenic
991673660 5:69072084-69072106 GCTAATTTTGTATTTTTTGTAGG - Intergenic
992083556 5:73258143-73258165 CCTTTTTTTTTTTTTTTTGGGGG + Intergenic
992291103 5:75281029-75281051 CCAACTCTTTTTTTTTTTGCGGG - Intergenic
992573432 5:78084317-78084339 GCTAATTTTTTAATTTTTGTTGG - Intronic
992898485 5:81269360-81269382 GCTAATTTTTAATTTTTTTGTGG + Intergenic
993052633 5:82943580-82943602 GCTAATTTTGTATTTTTTAGTGG - Intergenic
993404090 5:87489277-87489299 CATAGTCTTGTATTTCTTGGAGG - Intergenic
993772596 5:91949059-91949081 CCTATTTTTTTTTTTTTTGATGG - Intergenic
993994464 5:94705503-94705525 CCTTTTTTTTTTTTTTTTGGTGG - Exonic
994268253 5:97743655-97743677 CATATTTTATTATTTTTTGGAGG + Intergenic
994604482 5:101950072-101950094 ACCCAGCTTTTATTTTTTGGAGG - Intergenic
994742634 5:103640742-103640764 CATAGACTTTTTTTTTTTGGAGG + Intergenic
994868621 5:105314595-105314617 CCTAATCTTATATATGTTGCTGG + Intergenic
995285502 5:110383967-110383989 CCTCATCTTTTTTTTTTTTTTGG - Intronic
995406214 5:111799652-111799674 CCTAAGGTTTTATTTCTTAGTGG - Intronic
995631398 5:114136882-114136904 CCTAAGCTTTTATTTATCAGAGG - Intergenic
995691521 5:114831051-114831073 CATAATCTCATATTTATTGGAGG - Intergenic
995772998 5:115692150-115692172 GCTAATTTTTTTTTTTTTTGAGG - Intergenic
995965731 5:117905798-117905820 CCTAATCTTTAATTATTTTTAGG + Intergenic
996005160 5:118411523-118411545 TCTAATTTTTCTTTTTTTGGGGG - Intergenic
996323938 5:122251462-122251484 CATAATCCTATATTTCTTGGAGG + Intergenic
996351459 5:122546986-122547008 CTTATTCTTTTATATATTGGGGG + Intergenic
996477791 5:123941028-123941050 AATAGTCTTTTATTATTTGGTGG + Intergenic
996712766 5:126559916-126559938 CTTCATCTTTTATTTCTCGGGGG + Intronic
996834770 5:127778627-127778649 CCTTATCTTCTGTATTTTGGAGG + Intergenic
997144082 5:131413289-131413311 GCTAATCTTTAAATTTTTTGTGG + Intergenic
997152245 5:131510575-131510597 CCAAGTCTTTTATATTTTGTAGG - Intronic
997188261 5:131903130-131903152 CATAATCACATATTTTTTGGAGG - Intronic
997244221 5:132332442-132332464 CTTAATCTCATAATTTTTGGTGG - Intronic
997517386 5:134500361-134500383 CCTTTTCTTTTTTTTTTTTGAGG + Intergenic
997567055 5:134896325-134896347 CCTAATATTTTATTATTTCAAGG + Exonic
997774705 5:136591734-136591756 CCTAAACATTTTATTTTTGGTGG + Intergenic
997907087 5:137828670-137828692 CCTATTCTTTTATTTTATTTGGG + Intergenic
998006098 5:138657972-138657994 CCTAATTTTTGTATTTTTGGTGG - Intronic
998291575 5:140920270-140920292 TGTAATCTTATATTTTTTAGAGG + Intronic
998491038 5:142546558-142546580 AATAAACTTTTATTTATTGGAGG + Intergenic
998617736 5:143759249-143759271 GCTAAGCTTTTATTTTTGGGGGG + Intergenic
999517620 5:152316862-152316884 CATACTCTTTTTTTTTTTTGAGG + Intergenic
999946527 5:156602337-156602359 TCTAATAATTTTTTTTTTGGTGG + Intronic
1000683523 5:164218164-164218186 CCTAATCTCCTATTCTTTTGAGG - Intergenic
1000758678 5:165193535-165193557 CCTATTTTTTTAATTTTTGGAGG + Intergenic
1000795497 5:165659493-165659515 CATAATTTTTCATTTCTTGGGGG + Intergenic
1000902761 5:166929629-166929651 CTTACTCTTTTATTCCTTGGTGG - Intergenic
1001104722 5:168843418-168843440 TGTAATTTTTTATTTTTAGGAGG + Intronic
1001429802 5:171650298-171650320 CCTACTTTTTTTTTTTTTGGTGG - Intergenic
1001905821 5:175472258-175472280 GCTAATTTTTTAATTTTTTGTGG + Intergenic
1002124836 5:177035179-177035201 CCTAATTTTTTTATTTTTGGTGG + Intronic
1002137969 5:177119988-177120010 CCTTATGTTTTTTTGTTTGGGGG - Intergenic
1002537517 5:179885590-179885612 CTCCATCTTTTTTTTTTTGGGGG - Intronic
1002704439 5:181150810-181150832 GCTAATTTTTTAATTTTTTGTGG - Intergenic
1002725188 5:181289963-181289985 CATATTCTTTTTTTTTTTTGAGG - Intergenic
1002968439 6:1990737-1990759 GCTAATTTTTTTTTTTTTTGGGG + Intronic
1003025762 6:2554360-2554382 CGGCATCTTTTATTTTTTGAAGG - Intergenic
1003095277 6:3138022-3138044 CCTATTCTTTTTTTTTTAGATGG + Intronic
1003393445 6:5732808-5732830 CCTGATTTTTTTTTTTTTGAAGG - Intronic
1003483479 6:6554392-6554414 CCTAATCTCTTAGCTTTTTGAGG + Intergenic
1003530604 6:6934457-6934479 GCTAATTTTTTAATTTTTTGTGG - Intergenic
1003944587 6:11062801-11062823 CCTCCTCTTCTATTTTCTGGAGG - Intergenic
1004076358 6:12347408-12347430 TCTAATATTTTATTCTTTGTGGG + Intergenic
1004210546 6:13637664-13637686 CCTACGCTTTTATTCTCTGGGGG + Intronic
1004706027 6:18124534-18124556 CCTAAACTCTTATTTTTAAGGGG + Intergenic
1004920906 6:20374774-20374796 CCTAATCATTTATCTTTTGGTGG + Intergenic
1004967161 6:20866325-20866347 GCTAATCTTTTCTTTTTTCTTGG - Intronic
1005052574 6:21698611-21698633 CATAAACTTTTTTTTTTCGGTGG + Intergenic
1005095996 6:22116929-22116951 CCCAATATTTATTTTTTTGGTGG + Intergenic
1005208387 6:23431425-23431447 CATAGTCTTATATTTCTTGGAGG + Intergenic
1005376139 6:25184698-25184720 CATAGTCCCTTATTTTTTGGAGG + Intergenic
1005508026 6:26486987-26487009 GCTAATTTTTTATTTTTTTGTGG + Intergenic
1005569987 6:27135660-27135682 CCAAATATTTTACTATTTGGGGG - Intergenic
1005729012 6:28677671-28677693 CCTAATCCTTTCTGTTTTAGAGG + Intergenic
1005748584 6:28862893-28862915 GCTAATTTTTTTTTTTTTAGTGG - Intergenic
1005815824 6:29551941-29551963 CCTAATTTTTCATTTTTCAGAGG - Intergenic
1005870841 6:29973686-29973708 ATTAATTTTTTAGTTTTTGGAGG - Intergenic
1006505658 6:34487003-34487025 CCTAATTTTTTTTTTTTTTTTGG - Intronic
1006775361 6:36588276-36588298 TTTAATGTTTTATGTTTTGGGGG - Intergenic
1007598118 6:43064357-43064379 GCTAATTTTTTAATTTTTTGTGG - Intronic
1007620598 6:43211770-43211792 ACTTATCTTTTAAATTTTGGGGG - Intronic
1007623188 6:43227248-43227270 GCTAATTTTTTAATTTTTAGTGG - Intronic
1007913449 6:45538481-45538503 TCTAAGCTGTTATTTTTAGGAGG + Intronic
1008245724 6:49170296-49170318 GCTAATTCTTTATTTTTTGTAGG + Intergenic
1008268230 6:49459012-49459034 CCTAGTTTTTTATTTTTTGGGGG - Intronic
1008288948 6:49688863-49688885 TCTTTTCTTTTATTTTTTTGGGG + Intergenic
1008317795 6:50068119-50068141 TCTAATAGTTTTTTTTTTGGTGG + Intergenic
1008371523 6:50737143-50737165 GCTAATTTTTGATTTTTTGGTGG + Intronic
1008585054 6:52941105-52941127 CCTTTTTTTTTATTTTTTGGTGG - Intergenic
1008824736 6:55680096-55680118 TATAATCTTTTGATTTTTGGGGG + Intergenic
1008835337 6:55820581-55820603 CCAATTTTTTTATTTTTTGTAGG + Intronic
1009027896 6:58022111-58022133 ACTAATTTTTTAATTTTTTGTGG - Intergenic
1009171443 6:60405628-60405650 ACTAATTTTTTATTTTTAGTAGG + Intergenic
1009265602 6:61550936-61550958 CCAATTTTTGTATTTTTTGGTGG + Intergenic
1009354415 6:62723814-62723836 TCTATTCTTTTATTTCTTTGTGG - Intergenic
1009626473 6:66143471-66143493 CCTAATCCCTTAGTTGTTGGTGG - Intergenic
1009655750 6:66542383-66542405 CATAGTCTTATATTTCTTGGAGG - Intergenic
1009719458 6:67448002-67448024 TTTATTCATTTATTTTTTGGTGG - Intergenic
1009775282 6:68197450-68197472 CATAATCTCATATTTTCTGGAGG - Intergenic
1010389383 6:75319827-75319849 TCTTTTCTTTTTTTTTTTGGGGG - Intronic
1010419248 6:75653193-75653215 GCTAATTTTGTATTTTTTAGAGG + Intronic
1010681139 6:78800608-78800630 CATAATCCCATATTTTTTGGAGG + Intergenic
1010899976 6:81414991-81415013 CCTAATATTGTAATTTTTGGGGG + Intergenic
1011293554 6:85803237-85803259 GCTAATTTTTTATTTGTTTGTGG - Intergenic
1011533660 6:88352286-88352308 CATAATCCCATATTTTTTGGAGG - Intergenic
1012093555 6:94930837-94930859 CATAATCCCATATTTTTTGGAGG + Intergenic
1012117226 6:95317290-95317312 CCTAATCTTTATTTTTATGCAGG - Intergenic
1012299765 6:97571357-97571379 CCAATTCTTTTATTTTCTGCAGG - Intergenic
1012669000 6:102016603-102016625 TCTAATCCCATATTTTTTGGAGG - Intronic
1012714111 6:102647739-102647761 CCTAAATTTTTTTTTTTTGAAGG + Intergenic
1012874916 6:104714711-104714733 TCTAAGCTTTTATTCTTTGCTGG - Intergenic
1012917499 6:105186336-105186358 TCTATTCTTTTTTTTTTTGGGGG + Intergenic
1012929870 6:105305838-105305860 CCTTTTCTTTTTTTTTTGGGGGG + Intronic
1013672747 6:112422842-112422864 CATAGTCTTATATTTCTTGGAGG - Intergenic
1013802942 6:113968544-113968566 CATACTCTTTTAATTTTTGTGGG - Intronic
1013883326 6:114932089-114932111 CATAATCTCATATTTCTTGGAGG + Intergenic
1013983015 6:116156155-116156177 CATCATCTTTTATTTTGGGGAGG + Intronic
1014035094 6:116757750-116757772 CCTTTTTTTTTTTTTTTTGGTGG - Intronic
1014040965 6:116824606-116824628 CCTGAGCTATTATTTATTGGGGG - Intronic
1014413257 6:121152664-121152686 CATAGTCTCATATTTTTTGGAGG + Intronic
1014628289 6:123756956-123756978 CCTAGCCTTTTATTGTTTGCAGG + Intergenic
1014844521 6:126258730-126258752 TTTAATCTTTTATTTTTTTGGGG + Intergenic
1015091618 6:129365361-129365383 CTTTTTATTTTATTTTTTGGGGG + Intronic
1015297454 6:131613881-131613903 CCTAAGCTTTTTTCTCTTGGGGG - Intronic
1015500914 6:133932172-133932194 CGTAATCCTGTATTTCTTGGAGG - Intergenic
1015887807 6:137937530-137937552 CCTCCTCTTTAATTTTTTGGAGG + Intergenic
1015936389 6:138409179-138409201 GCTAATTTATTATTTTTTGTAGG + Intronic
1016027902 6:139307352-139307374 GCTAAGTTTTTATTTTTTGTAGG + Intergenic
1016100165 6:140090166-140090188 CCTAATATTTTATATATTTGTGG + Intergenic
1016105219 6:140153814-140153836 CATGATTTTTTTTTTTTTGGTGG + Intergenic
1016281999 6:142428896-142428918 ACTTATCTTTTAATTTTTGCAGG - Intronic
1016310229 6:142726263-142726285 CCTAATTTTTTTTTTTTTACAGG - Intergenic
1016483351 6:144506927-144506949 CATAGTCTCTTATTTCTTGGAGG + Intronic
1016741662 6:147534819-147534841 CATAATTTTTAATTTTGTGGCGG + Intronic
1016841265 6:148527971-148527993 CTAAAGCTTTTTTTTTTTGGGGG + Intronic
1016846400 6:148572197-148572219 GCTAATTTTTTAATTTTTGGGGG + Intergenic
1016885826 6:148958742-148958764 TCTAAGCTTGTATTTTTTGGGGG + Intronic
1017044834 6:150337661-150337683 CTTATTTTTGTATTTTTTGGCGG - Intergenic
1017347947 6:153406331-153406353 CCTAATTTTTTTTTTTTTTGAGG + Intergenic
1017670873 6:156768522-156768544 CTTATTTTTGTATTTTTTGGTGG + Intergenic
1017741404 6:157409822-157409844 TTTATTATTTTATTTTTTGGGGG + Intronic
1018578816 6:165289170-165289192 CTTTTTCTTTTTTTTTTTGGAGG - Intronic
1018609944 6:165638186-165638208 CTTTTTCTTTTCTTTTTTGGTGG - Intronic
1018796910 6:167193056-167193078 GCTAATATTTTATTTTTTGAAGG - Intronic
1018819429 6:167362131-167362153 GCTAATATTTTATTTTTTGAAGG + Intronic
1018989354 6:168661607-168661629 ACTAATATTCTTTTTTTTGGGGG - Intronic
1019295371 7:271168-271190 GCTAATTTTCTAATTTTTGGGGG - Intergenic
1019430013 7:994603-994625 CCGGATTTTTTATTTTTTGTTGG + Intergenic
1019460126 7:1153778-1153800 GCTAATCTTTTATATTTTAGTGG - Intronic
1019843935 7:3477676-3477698 GCTAATTTTTAATTTTTTTGTGG + Intronic
1020113061 7:5458694-5458716 GCTAATTTTTTTTTTTTTGGGGG - Intronic
1020132690 7:5568407-5568429 TTTAATTTTTTAATTTTTGGTGG - Intergenic
1020252706 7:6483001-6483023 ACTTATTTTTTTTTTTTTGGAGG - Intronic
1020662721 7:11001604-11001626 AATATTATTTTATTTTTTGGGGG + Intronic
1021048452 7:15952718-15952740 CCCATTCTTTTTTTTTTTGGCGG - Intergenic
1021128130 7:16878112-16878134 TCCAATTTTTTTTTTTTTGGAGG + Intronic
1021328990 7:19311247-19311269 CCTAATTTTTGAATTTTTAGTGG - Intergenic
1021582544 7:22172110-22172132 GCTACTATTTTAATTTTTGGGGG + Intronic
1021852881 7:24825779-24825801 CCTTTTCTGTTATTTATTGGAGG - Intronic
1021956160 7:25826689-25826711 GCTAATTTTTTATTTTTTTTTGG - Intergenic
1022317623 7:29260318-29260340 CCTGATATTTTATTTTTTAATGG - Intronic
1023144601 7:37137538-37137560 AGTAATTTTTTTTTTTTTGGAGG + Intronic
1023785542 7:43704478-43704500 CATAATCCCATATTTTTTGGAGG + Intronic
1023823233 7:43991643-43991665 TCTCATCTTTTTTTTTTTGAGGG - Intergenic
1023880387 7:44316550-44316572 CCTCCTCTTCTACTTTTTGGGGG + Intronic
1024057757 7:45675743-45675765 ACTAATATCTGATTTTTTGGGGG - Intronic
1024230220 7:47358140-47358162 CTTCATCTTTTTTTTTTTGACGG + Intronic
1024641727 7:51334433-51334455 GCTAGTTTTTTTTTTTTTGGTGG - Intergenic
1024769126 7:52697619-52697641 CATGATCTTTTATCTTTAGGAGG - Intergenic
1024840472 7:53580339-53580361 CCTCATCTTTAATATTTTGGAGG - Intergenic
1024863467 7:53874581-53874603 CATAATCACTTCTTTTTTGGGGG - Intergenic
1025227297 7:57176926-57176948 ACTAATTTTTTAATTTTTTGTGG + Intergenic
1025230396 7:57200362-57200384 GCTAATTTTTTAATTTTTTGTGG + Intergenic
1025251050 7:57351753-57351775 GCAAATGTTTTATTTTTTGTAGG + Intergenic
1025727448 7:64080313-64080335 CATAATCTGTTATTTCTTGGAGG + Intronic
1025928698 7:65978931-65978953 GCTAATTTTTTAATTTTTTGTGG + Intronic
1025973760 7:66353303-66353325 GCTAATTTTTTCTTTTTTTGAGG - Intronic
1026016101 7:66671979-66672001 GCTAATTTTTGATTTTTTGTAGG + Intronic
1026095451 7:67342896-67342918 CCTGGCTTTTTATTTTTTGGTGG - Intergenic
1026262339 7:68765988-68766010 GCTAATTTTTAATTTTTTGTAGG + Intergenic
1026522022 7:71125961-71125983 TTTAATCTTTTCTTTTTTTGAGG + Intergenic
1027387985 7:77677460-77677482 CCTAAGTATTTAATTTTTGGGGG + Intergenic
1027561485 7:79737138-79737160 CCTTTTTTTTTTTTTTTTGGTGG + Intergenic
1027852745 7:83469796-83469818 TATTATCTTTTATTTTTTTGAGG + Intronic
1027917319 7:84342037-84342059 ACTAATTTTTTTTTTTTTGACGG + Intronic
1028024460 7:85820611-85820633 TATAATCTTTTATTTTATGCAGG - Intergenic
1028084047 7:86615229-86615251 CCTAATGTTTTTTTTCTGGGAGG - Intergenic
1028476596 7:91260536-91260558 TCTAATTTTTTAATTTTTTGTGG - Intergenic
1028515542 7:91674139-91674161 CATAATTTTTTATTATTTTGAGG - Intergenic
1028692168 7:93665071-93665093 CTTATTCTTTTATGTTTTGTTGG - Intronic
1028819426 7:95189399-95189421 CATAATCCTAAATTTTTTGGAGG + Intronic
1028859527 7:95633128-95633150 CCTAATTTATTATGTTATGGTGG - Intergenic
1028861185 7:95652455-95652477 CATAAGTTTTTATTTTTAGGGGG + Intergenic
1029151300 7:98482516-98482538 GCTAATTTTGTATTTTTTAGTGG + Intergenic
1029181934 7:98708452-98708474 CATACTTTTTTTTTTTTTGGGGG - Intergenic
1029335406 7:99894668-99894690 TCTTTTCTTTTTTTTTTTGGGGG - Intronic
1029479865 7:100805801-100805823 CTGGATCTGTTATTTTTTGGGGG - Intronic
1029626798 7:101724898-101724920 TCAAGTCTTTTTTTTTTTGGTGG - Intergenic
1029830977 7:103258789-103258811 CCTGGGCTTTTTTTTTTTGGGGG + Intergenic
1030056657 7:105589201-105589223 GCTAATTTTTTTTTTTTTGTAGG + Intronic
1030253682 7:107482135-107482157 AAAAATCTTTTTTTTTTTGGTGG + Intronic
1030509056 7:110460580-110460602 CCTTTTTTTTTTTTTTTTGGAGG + Intergenic
1030807464 7:113935374-113935396 CATAATCATCTATTTCTTGGAGG + Intronic
1031255966 7:119449346-119449368 CATGATCTTTTATTTTTCAGAGG + Intergenic
1031413553 7:121468266-121468288 CCTTTTCTTTTTTTTTTTTGGGG - Intergenic
1031629561 7:124031489-124031511 ACTAATTTTTTTTTTTTTGGCGG - Exonic
1031820839 7:126499409-126499431 TCTAGTTTTTTTTTTTTTGGAGG - Intronic
1031837636 7:126697400-126697422 CCTTCTTTTTTATTTTTTGGTGG - Intronic
1032033450 7:128503831-128503853 GCTGATTTTTTATTTTTTAGTGG - Intronic
1032270567 7:130400883-130400905 CCTGACCTTTTATTCCTTGGGGG - Intronic
1032358502 7:131232344-131232366 ACTACTCTTTTATTTCTTTGTGG - Intronic
1033246904 7:139725062-139725084 CCTAATCTTTTTTTATGTAGAGG - Intronic
1033561200 7:142533276-142533298 CCAAATCTTTCTTTTTTGGGGGG + Intergenic
1033895887 7:146069419-146069441 CTTAATCTTTTGTTATTTGTCGG - Intergenic
1033978345 7:147130449-147130471 TTTATTCTTTTATTTTTGGGGGG - Intronic
1034975539 7:155447297-155447319 ACTAATTTTTTTTTGTTTGGGGG + Intergenic
1035098001 7:156371851-156371873 CCTAGTATTTTATCATTTGGGGG + Intergenic
1035131671 7:156660462-156660484 ACTGATTTTTTATTTTTTGCAGG + Intronic
1035167777 7:157001784-157001806 CCTGATTTTTAATTTTTTGAGGG + Intronic
1035184549 7:157115976-157115998 CCTAATTTTTTTTTTTTAGATGG - Intergenic
1035188802 7:157147263-157147285 CCTAAGCGTTTATTTTTAAGGGG + Intronic
1036006373 8:4668704-4668726 GGTAATGTTTTATTTTTGGGAGG - Intronic
1036434092 8:8716948-8716970 GCTAATTTTTTAATTTTTTGTGG - Intergenic
1036516122 8:9445972-9445994 CATAGTCTCATATTTTTTGGAGG + Intergenic
1036529925 8:9575469-9575491 CCTTATCTTTTCTTTTTGGTTGG - Intronic
1036741217 8:11363333-11363355 TCTATTTTTTTTTTTTTTGGTGG - Intergenic
1036836016 8:12068042-12068064 CTTCATCTTTTATTTTATTGTGG + Intronic
1036857859 8:12314612-12314634 CTTCATCTTTTATTTTATTGTGG + Intergenic
1036982991 8:13492138-13492160 TCAAATGTTTTACTTTTTGGGGG - Intronic
1037021641 8:13978719-13978741 CTGAATCTTTTATTTATTGCAGG + Intergenic
1038067660 8:23979996-23980018 TATAATTTTTTTTTTTTTGGCGG + Intergenic
1038272124 8:26083574-26083596 CTTCTTCTTTTGTTTTTTGGAGG - Intergenic
1038375292 8:27034130-27034152 GCTAATTTTTTATTTTTAGTAGG - Intergenic
1038418433 8:27415050-27415072 GCTAATATTTTGTTGTTTGGGGG + Intronic
1038541770 8:28395779-28395801 GCTAATTTTTTTTTTTTTTGAGG - Intronic
1038786374 8:30620762-30620784 GCTAATTTTTTTTTTTTTTGTGG - Intronic
1038799276 8:30734453-30734475 GCTAATTTTTAATTTTTTTGTGG - Intronic
1038821444 8:30955683-30955705 GCTAATTTTTAATTTTTTGTAGG + Intergenic
1039025200 8:33251370-33251392 CCTAATCTCTTCTGTTTTGTAGG + Intergenic
1039054149 8:33521332-33521354 CTTTATTTTTTATTTTTTTGAGG + Intergenic
1039057071 8:33545518-33545540 CCTGATCCTTTCTTTGTTGGGGG - Intergenic
1039058606 8:33556023-33556045 ACTAATTTTTTAATTTTTTGTGG - Intronic
1039104089 8:33971491-33971513 CTGGATTTTTTATTTTTTGGTGG + Intergenic
1039250360 8:35657402-35657424 CATTATTTTTTATTTTTTAGAGG + Intronic
1039250365 8:35657484-35657506 CATTATTTTTTATTTTTTAGAGG + Intronic
1039262213 8:35783869-35783891 CCTTCTGTTTTCTTTTTTGGAGG - Intronic
1039281000 8:35984572-35984594 GCTAAACTTTTAGTTTTTTGAGG + Intergenic
1039410341 8:37349705-37349727 TCTCATCTTTTTTTTTTTGGTGG + Intergenic
1039605275 8:38875436-38875458 GCTAATTTTTAATTTTTTTGCGG + Intergenic
1039644058 8:39260784-39260806 CCTACTCTTCAGTTTTTTGGAGG + Intronic
1039749044 8:40459603-40459625 GCTAATTTTTTATTTCTTTGTGG - Intergenic
1040505777 8:48046416-48046438 CCTAATTTTGTATTTTTAGTGGG + Intronic
1040650035 8:49437265-49437287 CCTAATTTATTTTTTTTTGAGGG + Intergenic
1040973191 8:53160278-53160300 CCTACTCATTTCTTTTTTTGTGG + Intergenic
1041103241 8:54417572-54417594 GCTAATTTTTAATTTTTTTGTGG + Intergenic
1041205040 8:55490598-55490620 TTTAATTTTATATTTTTTGGGGG - Intronic
1041655645 8:60347564-60347586 GCTATACTTTTATTTTTAGGAGG - Intergenic
1041779219 8:61559036-61559058 TCTAATTTTTTAATTTTTGTAGG + Intronic
1041786238 8:61637530-61637552 ACAAATTTTTTTTTTTTTGGTGG - Intronic
1041883737 8:62783786-62783808 CTAAATTTTTTATTTTTTTGTGG + Intronic
1041899105 8:62961113-62961135 CTAATTTTTTTATTTTTTGGTGG - Intronic
1042000383 8:64116705-64116727 TCTAAGATTTTTTTTTTTGGTGG - Intergenic
1042186710 8:66142986-66143008 GCTTTTCTTTTCTTTTTTGGAGG + Intronic
1042314358 8:67409783-67409805 GCTAATTTTTTATTTTTTGTAGG - Intergenic
1042552480 8:70006455-70006477 GCTAATTTTTTAATTTTTGTAGG - Intergenic
1042614130 8:70630532-70630554 CATAGTCCTTTATTTCTTGGAGG + Intronic
1042786918 8:72558032-72558054 CTTATTCATTCATTTTTTGGGGG + Intronic
1043092418 8:75922768-75922790 ACTTATGTTTTATTTTTGGGGGG + Intergenic
1043179997 8:77076676-77076698 ACTTTTCTTTTTTTTTTTGGGGG - Intergenic
1043434325 8:80223483-80223505 CCTAATTTTTTTATTTTTAGTGG - Intronic
1043477643 8:80621079-80621101 TATAATTTTTTATTTTTTTGTGG + Intergenic
1043612656 8:82084317-82084339 CTCAATTTTTTGTTTTTTGGAGG + Intergenic
1043840334 8:85094706-85094728 CATAATCCCTTATTTCTTGGAGG + Intergenic
1044294818 8:90515914-90515936 TCTAGTCACTTATTTTTTGGAGG + Intergenic
1044313964 8:90727898-90727920 CATAATCTCATATTTCTTGGAGG - Intronic
1044441051 8:92224079-92224101 CTTAAGCTTCTATTTTTTGATGG + Intergenic
1044746804 8:95378594-95378616 TCTTATGTTTTTTTTTTTGGGGG + Intergenic
1044943457 8:97367443-97367465 ACTAATAGTTTATTTCTTGGGGG + Intergenic
1045124725 8:99077096-99077118 CCTAAGCTTTTCTTTTAGGGTGG + Intronic
1045233624 8:100329995-100330017 CCTAATTTGTTTTTTTGTGGGGG + Intronic
1045374200 8:101554959-101554981 CTGAATCTGTTATTTTCTGGTGG + Intronic
1046191523 8:110801685-110801707 CCTTTTTTTTTTTTTTTTGGAGG + Intergenic
1046319619 8:112555894-112555916 TCAAATCTTTTATTTTTAGAAGG - Intronic
1046319663 8:112556540-112556562 CATAATCTTCTAGTTTGTGGGGG - Intronic
1046546505 8:115657977-115657999 TCTAATATTTTAGTTTCTGGAGG - Intronic
1046639990 8:116718919-116718941 CCTAACTTTTTCTTTTTTGGGGG - Intronic
1047256843 8:123220258-123220280 CTTCATCTTTTATTTTTTCTGGG + Exonic
1047274266 8:123393750-123393772 CCTAATTTTTGTGTTTTTGGTGG - Intronic
1047414284 8:124651444-124651466 CATGGTCTTTTTTTTTTTGGTGG + Intronic
1047450510 8:124961301-124961323 CTTGATCTTTTGTTTTCTGGAGG + Intergenic
1047940051 8:129820916-129820938 CCTTATCTTCTATTTTCTGTGGG - Intergenic
1047972438 8:130096959-130096981 GCTAATTTTGTATTTTTTAGTGG - Intronic
1048061858 8:130927682-130927704 TCTAACCATTTTTTTTTTGGTGG + Intronic
1048132447 8:131712671-131712693 CCAAATATTTGCTTTTTTGGTGG - Intergenic
1049123126 8:140758091-140758113 CCTACTTATTTATTTTTTAGAGG + Intronic
1049627831 8:143634051-143634073 GCTAATTTTTTGTTTTTTAGTGG - Intergenic
1049739495 8:144230676-144230698 CCTCCTCTTTAATTTTTTGGAGG + Intronic
1049874059 8:145003751-145003773 CTAAATCTTTAATTTTTTGGGGG + Intergenic
1050517803 9:6463114-6463136 GCTAATTTTGTATTTTTTAGTGG - Intronic
1050570642 9:6934473-6934495 CCAATTTTTTTTTTTTTTGGCGG - Intronic
1050662978 9:7903585-7903607 CATAATTTGTTATTTTTTTGGGG + Intergenic
1050759236 9:9045871-9045893 CCTAATCATTTCTTTTATGCAGG - Intronic
1051164631 9:14248433-14248455 ACTAATCTTTTATTTTTTTGTGG + Intronic
1051373238 9:16376794-16376816 GCTAATTTTTTATTTTTAGTAGG - Intergenic
1051429289 9:16965609-16965631 ATTAATCTTTTATTTTATTGTGG + Intergenic
1051511885 9:17887530-17887552 GCTAATTTTTTATTTTTTTGTGG - Intergenic
1051548615 9:18304642-18304664 CCTAAACTTTTTTTTTTTTTAGG + Intergenic
1051758153 9:20428919-20428941 CCTAATTTTTATTTTTTTGGGGG - Intronic
1051891462 9:21946503-21946525 CATAATCTTCTATTTCTTGTAGG - Intronic
1051920924 9:22263061-22263083 CCTAATTTTTTTTTTTGTAGGGG + Intergenic
1051954010 9:22667640-22667662 CCTTTTTTTTTTTTTTTTGGTGG - Intergenic
1052019987 9:23514640-23514662 GCTCATCTTTTATTTTTTCTGGG + Intergenic
1052937150 9:34102279-34102301 ATTATTCTTTTTTTTTTTGGAGG - Intronic
1053088585 9:35251262-35251284 CCTACTCTTCCATTTTTTGCTGG + Intronic
1053298494 9:36932108-36932130 GCTAATTTTTAATTTTTTTGTGG - Intronic
1053354594 9:37435084-37435106 GCTAATTTTTTATTTTTTATAGG - Intronic
1053395212 9:37767346-37767368 GCTAATTTTTAATTTTTTAGAGG - Intronic
1054785951 9:69210295-69210317 GCTACTTTTTTTTTTTTTGGGGG - Intronic
1054820169 9:69514423-69514445 ACTAATCTTGTATTTTTAGTAGG - Intronic
1054989635 9:71308557-71308579 CCTAATCATTTTCTTTTTGTAGG + Intronic
1055106590 9:72519594-72519616 TTTCATTTTTTATTTTTTGGGGG - Intergenic
1055109940 9:72549910-72549932 CCTAATTTTTGTGTTTTTGGTGG + Intronic
1055219819 9:73915357-73915379 TCTAATATTTTCTTTTTTGTTGG + Intergenic
1055527043 9:77145444-77145466 GCTAATTTTTTATTTTTTTTTGG + Intergenic
1055823404 9:80295533-80295555 CCTAATGTTTTCTTTTTTGTTGG - Intergenic
1056160589 9:83887927-83887949 CCTATTCCCTTATTTTTTGTGGG + Intronic
1056359624 9:85841970-85841992 CCTATTCCCTTATTTTTTGTGGG - Intergenic
1056704138 9:88937432-88937454 ACTAGTTTTTTATGTTTTGGTGG + Intergenic
1056937256 9:90925331-90925353 CTTAATTTTTTTTTTTTTGACGG - Intergenic
1057061758 9:92010224-92010246 GCTAATTTTTTGTATTTTGGTGG - Intergenic
1057087988 9:92228281-92228303 CATAATCTTTTTTTTTTCAGAGG + Intronic
1057149066 9:92780084-92780106 CCTAATCAAATATTTATTGGAGG + Intergenic
1057718470 9:97514224-97514246 GCTAATGTTTTTTTTTTGGGGGG + Intronic
1057817266 9:98304762-98304784 CCTGTTCTTTCCTTTTTTGGAGG + Intronic
1058239417 9:102538169-102538191 CAGAATTTTTTTTTTTTTGGTGG - Intergenic
1058580273 9:106448831-106448853 CCCAGGCTATTATTTTTTGGGGG - Intergenic
1058598536 9:106643945-106643967 CCTAATTTTTTTTTAATTGGTGG - Intergenic
1058629005 9:106966790-106966812 CCTTGTCTTTTATTTTTTCTTGG + Intronic
1058673844 9:107383630-107383652 GCTAATATTTAATTTTTTTGTGG + Intergenic
1059302618 9:113326998-113327020 ACTAATTTTTTAATTTTTTGTGG + Intronic
1059391968 9:114004961-114004983 GCTAATCTTTTATTCCTTAGTGG - Intronic
1059595852 9:115719971-115719993 CTTTTTCTTTTATTTTTTGGAGG - Intergenic
1059630589 9:116117577-116117599 CCTGGGCTTTTATTTGTTGGAGG + Intergenic
1059715063 9:116905849-116905871 CCTGTTTTTTTTTTTTTTGGGGG + Intronic
1060465196 9:123897801-123897823 CCTAATTTTTAAATTTTTGGTGG - Intronic
1060902485 9:127272483-127272505 CCAACTCTTTTTTTTTTTTGAGG + Intronic
1060924821 9:127448989-127449011 GCTAATTTTGTATTTTTTGGTGG + Intronic
1060930148 9:127484525-127484547 GCTAATTTTTTTTTTTTTTGAGG + Intronic
1061142788 9:128778674-128778696 GCTAATTTTTTATTTTTTGTAGG - Intergenic
1062251880 9:135602102-135602124 CCTAAACTTTTCTTTCATGGTGG - Intergenic
1062484501 9:136768423-136768445 CCTCAACTTTTATTTATTTGTGG + Intergenic
1203461360 Un_GL000220v1:42621-42643 CATAATCTTATATTTTTCAGAGG + Intergenic
1185973618 X:4693434-4693456 TCTAATTTTATAATTTTTGGTGG - Intergenic
1186678265 X:11843720-11843742 ACTTATTTTTTATTTTTTTGTGG + Intergenic
1186978721 X:14936322-14936344 CTTATTTTTTTATTTTTTTGTGG - Intergenic
1187075988 X:15935438-15935460 CATTATCTTTTATTCTTTGATGG - Intergenic
1187152621 X:16694827-16694849 GCTAATTTTTTATGTTTTTGTGG - Intronic
1187250763 X:17596037-17596059 CTTCATCTTTTTTTTTTTGGAGG - Intronic
1187256323 X:17646105-17646127 GCTAATTTTTTATTTTCTGTAGG + Intronic
1187313459 X:18168792-18168814 CCTAATATTTTGTTATTTGAGGG - Intronic
1187511289 X:19921699-19921721 GCCAATTTTTTATTTTTTTGAGG - Intronic
1187539419 X:20177101-20177123 CATAATATTTTATTTTTTGGAGG + Intronic
1187890876 X:23933880-23933902 GCTATTTTTTTTTTTTTTGGGGG - Intronic
1187908596 X:24089739-24089761 GCTAATTTTTTAATTTTTTGTGG - Intergenic
1187994881 X:24915228-24915250 CCTATTATTTTATTTTTTAATGG + Intronic
1188149716 X:26656732-26656754 CATAATCCTATATTTCTTGGAGG + Intergenic
1188170702 X:26920799-26920821 TTTAATTTTTTATTTTTTGCTGG - Intergenic
1188217763 X:27500217-27500239 ACAAGTCTTTTATTTTTTGGTGG - Intergenic
1188489948 X:30726622-30726644 TCTAATATTTAATATTTTGGGGG + Intronic
1188588140 X:31801818-31801840 CCAAATCTTATATTTATTTGTGG - Intronic
1188884492 X:35532547-35532569 CATAGTCCTGTATTTTTTGGAGG - Intergenic
1189132151 X:38511035-38511057 ACTAAAATTTGATTTTTTGGAGG + Intronic
1189278758 X:39806197-39806219 CTAAATTTTGTATTTTTTGGTGG - Intergenic
1189344046 X:40227021-40227043 GCTAATTTTTTAATTTTTAGTGG + Intergenic
1189557957 X:42164890-42164912 CATAATCCTATATTTCTTGGAGG + Intergenic
1189782305 X:44527039-44527061 CATTATTTTTTTTTTTTTGGTGG - Intronic
1189926937 X:45964968-45964990 GCTAATTTTTTATATTTTTGTGG + Intergenic
1189997205 X:46650482-46650504 CCTTCTCCTTTTTTTTTTGGTGG + Intronic
1190173008 X:48126717-48126739 GCTAATTTTGTATTTTTTTGTGG + Intergenic
1190218011 X:48492989-48493011 CCTAATTTTGTATTTTTAGTAGG - Intergenic
1190601792 X:52100389-52100411 CCTACCTTTTTATTTTTTGTGGG + Intergenic
1190772133 X:53524005-53524027 GCTAATTTTTTATTTTTTGTAGG - Intergenic
1191134636 X:57050380-57050402 CATAATCCTATATTTCTTGGAGG - Intergenic
1191155497 X:57268329-57268351 CATAATCTCATTTTTTTTGGGGG - Intergenic
1191162585 X:57347223-57347245 CATAATCTCATATTTCTTGGAGG + Intronic
1191227040 X:58054534-58054556 CCAAATATTTTATATTTTGGCGG - Intergenic
1191594459 X:62927218-62927240 CCTTTTCTTTTATTTTTTACTGG + Intergenic
1191779680 X:64852044-64852066 CAGAATCTCTTTTTTTTTGGAGG + Intergenic
1191882298 X:65855303-65855325 CATAATCTCATATTTCTTGGAGG + Intergenic
1191933705 X:66403627-66403649 CCTAATCTTATATTTCTCAGAGG + Intergenic
1192013758 X:67305056-67305078 TCTCTTCTTTAATTTTTTGGAGG - Intergenic
1192401958 X:70844929-70844951 CTTAGTCTTTTTTTTTTTTGAGG - Intronic
1192422494 X:71045911-71045933 GCTAATCTTTTTATTTTTTGTGG + Intergenic
1192598704 X:72438791-72438813 CATAGTCCTTTATTTCTTGGAGG - Intronic
1192624283 X:72711806-72711828 AATAATTTTTTTTTTTTTGGTGG + Intronic
1192779395 X:74278650-74278672 GTTAATTTTTTATTTTTTTGTGG + Intergenic
1192831618 X:74756259-74756281 CCTAAATTTTTAATTTTTGTGGG + Intronic
1192853507 X:74982362-74982384 CATAATCTCAAATTTTTTGGAGG - Intergenic
1193052153 X:77112843-77112865 CATAATCCTGTATTTCTTGGAGG - Intergenic
1193128039 X:77890460-77890482 CTTAGTTTTTAATTTTTTGGTGG + Intronic
1193279846 X:79633947-79633969 CATAAACTTTCATTTCTTGGGGG + Intergenic
1193299183 X:79868844-79868866 CATAATCTTATACTTCTTGGAGG - Intergenic
1193347220 X:80417971-80417993 CATAATCCTGTATTTCTTGGAGG + Intronic
1193357762 X:80541965-80541987 TTTAATCTTTAAATTTTTGGGGG + Intergenic
1193597999 X:83471929-83471951 CCTAATAGAGTATTTTTTGGTGG - Intergenic
1193773352 X:85614251-85614273 CCTAGGCTTTTTTTTTTTTGTGG + Intergenic
1193817800 X:86125156-86125178 CATAATCTCATATTTATTGGAGG + Intergenic
1193877526 X:86879292-86879314 CTAAAACTTTTATTTTTTGCAGG + Intergenic
1193911078 X:87307638-87307660 ACTAGTCATTTATTTTATGGGGG + Intergenic
1194097533 X:89661187-89661209 TCTTATTTTTTATTTTTTGGAGG + Intergenic
1194661852 X:96636636-96636658 CCAAAACTTATTTTTTTTGGAGG - Intergenic
1194973574 X:100370791-100370813 TATAATCTTTCATTTTTAGGAGG + Intronic
1195056043 X:101145918-101145940 TCAAATCTTTCATTTTTTGGGGG - Intronic
1195172772 X:102285246-102285268 CATAATCTCATATTTCTTGGAGG + Intergenic
1195186094 X:102401849-102401871 CATAATCTCATATTTCTTGGAGG - Intronic
1195631162 X:107056874-107056896 TATTATCTTTTTTTTTTTGGGGG + Intergenic
1195723447 X:107889782-107889804 CATAGTCTCATATTTTTTGGAGG + Intronic
1196042145 X:111216190-111216212 CCTTATTTTTAAGTTTTTGGAGG + Intronic
1196318534 X:114259775-114259797 CCTAAACTTTTATTTTTGCCAGG + Intergenic
1196427441 X:115585988-115586010 TCTAATTTTTTTTTTTTTGACGG + Intronic
1196601245 X:117604035-117604057 CATAATCCTATATTTCTTGGAGG - Intergenic
1196611051 X:117715100-117715122 CCTACTCTTTTAGCTGTTGGTGG - Intergenic
1196657375 X:118232453-118232475 GCTAATTTTTTAATTTTTTGTGG + Intergenic
1196840912 X:119858274-119858296 GCTAATTTTTTAATTTTTTGTGG - Intergenic
1197090065 X:122525470-122525492 CATAATCTCATATTTCTTGGAGG - Intergenic
1197107503 X:122733210-122733232 CATAATCCTATATTTGTTGGAGG - Intergenic
1197225376 X:123951414-123951436 CCTAATTTTTAATTTTTTTTTGG + Intergenic
1197234739 X:124048181-124048203 CCTGATCTTGAATTTTTTTGGGG + Intronic
1197259079 X:124297321-124297343 CCTAAAGTTTTCTTTTTTGTTGG - Intronic
1197370284 X:125618137-125618159 CCTAAAGTTTTCTTTTTTGTTGG + Intergenic
1197558366 X:127986171-127986193 GCTAACCTTTTGTTTTTTTGAGG - Intergenic
1197624749 X:128789395-128789417 CCTAATCTCATATTTCTTGGAGG - Intergenic
1197993593 X:132347027-132347049 CCTAGGTTTTTTTTTTTTGGGGG - Intergenic
1198206941 X:134475043-134475065 GCTAATTTTTTTTTTTTTGCAGG + Intronic
1198470206 X:136939348-136939370 GCTAATTTTTAATTTTTTTGTGG + Intergenic
1198841960 X:140866487-140866509 CATAATCCTATATTTTTCGGAGG - Intergenic
1198913921 X:141645120-141645142 CATAATGTTTTATTTTTTGTGGG + Intronic
1198959103 X:142165173-142165195 CCTATATATTTATTTTTTGGTGG + Intergenic
1199121864 X:144064112-144064134 CATAATCTTTTATATTTCTGTGG - Intergenic
1199184938 X:144905262-144905284 CTTAAATTTTTAATTTTTGGGGG + Intergenic
1199245704 X:145601129-145601151 CCTAATCCCATATTTCTTGGGGG - Intergenic
1199423011 X:147667995-147668017 CCTAATCTCTATTATTTTGGAGG - Intergenic
1199428317 X:147729339-147729361 AATAATCTTTTTTTTTCTGGAGG + Intergenic
1199446181 X:147924814-147924836 CCTAATATTTTATATTTTTATGG + Intronic
1199773952 X:150994713-150994735 CATAATTTTTTTTTTTTTTGTGG + Intergenic
1199913138 X:152309117-152309139 CATAATCCTATATTTCTTGGGGG - Intronic
1200254841 X:154575012-154575034 GCTAATTTTTTATTTTTTCGTGG + Intergenic
1200262928 X:154629396-154629418 GCTAATTTTTTATTTTTTCGTGG - Intergenic
1200450553 Y:3322561-3322583 TCTTATTTTTTATTTTTTGGAGG + Intergenic
1200631066 Y:5588533-5588555 CTTCAGCTTTTGTTTTTTGGGGG + Intronic
1201312464 Y:12609371-12609393 CCTAATCATATGTTTTTAGGTGG - Intergenic
1201395259 Y:13540737-13540759 CCTAATCCCATATTTCTTGGAGG - Intergenic
1201488767 Y:14519578-14519600 CTTAATTTTTTTTTTTTTTGAGG + Intergenic
1201714567 Y:17030157-17030179 CCCAAATTTTTATTTTTTGATGG - Intergenic
1201737131 Y:17279819-17279841 CATAATTTTTTTTTTTTTTGAGG + Intergenic
1201752113 Y:17444389-17444411 CATAGTCTTATATTTCTTGGAGG + Intergenic
1201944013 Y:19491229-19491251 CCTGAGCTTTTCTTTTTTGAAGG - Intergenic