ID: 1162105732

View in Genome Browser
Species Human (GRCh38)
Location 19:8368569-8368591
Sequence GAGAGTCCCGCCGGGCGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 1, 2: 7, 3: 77, 4: 714}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162105729_1162105732 -2 Left 1162105729 19:8368548-8368570 CCAGAGAGAGAAGTGAGGAAAGA 0: 1
1: 0
2: 4
3: 70
4: 616
Right 1162105732 19:8368569-8368591 GAGAGTCCCGCCGGGCGCAGTGG 0: 1
1: 1
2: 7
3: 77
4: 714
1162105726_1162105732 12 Left 1162105726 19:8368534-8368556 CCAGAAGCTGGGACCCAGAGAGA 0: 1
1: 0
2: 9
3: 39
4: 307
Right 1162105732 19:8368569-8368591 GAGAGTCCCGCCGGGCGCAGTGG 0: 1
1: 1
2: 7
3: 77
4: 714
1162105725_1162105732 16 Left 1162105725 19:8368530-8368552 CCTTCCAGAAGCTGGGACCCAGA 0: 1
1: 0
2: 3
3: 38
4: 249
Right 1162105732 19:8368569-8368591 GAGAGTCCCGCCGGGCGCAGTGG 0: 1
1: 1
2: 7
3: 77
4: 714
1162105728_1162105732 -1 Left 1162105728 19:8368547-8368569 CCCAGAGAGAGAAGTGAGGAAAG 0: 1
1: 0
2: 5
3: 54
4: 654
Right 1162105732 19:8368569-8368591 GAGAGTCCCGCCGGGCGCAGTGG 0: 1
1: 1
2: 7
3: 77
4: 714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162105732 Original CRISPR GAGAGTCCCGCCGGGCGCAG TGG Intronic
900259336 1:1716075-1716097 GCACGTCCCGCCGGGCGCAGTGG - Intronic
900519346 1:3098188-3098210 GAGAGTCCCTCCAGGCTCATGGG + Intronic
900956286 1:5888077-5888099 GAGAGGCCCGCCGGGAGCCCTGG + Intronic
901020487 1:6252762-6252784 TAGAGTCCTGCAGGGGGCAGGGG + Intronic
901409185 1:9071120-9071142 AAGAATCCGGCCGGGCGCGGTGG + Intronic
901477739 1:9502585-9502607 GAAACTCCCGCTGGGCACAGTGG + Intergenic
901732119 1:11287640-11287662 AAAAGTTCCGCCGGGCGCGGTGG + Exonic
901778499 1:11576870-11576892 GAGACTCCAGCCGGGAGCAGTGG + Intergenic
901920411 1:12532108-12532130 GAGAGCCAGGCTGGGCGCAGTGG - Intergenic
902164822 1:14561612-14561634 GAAAGTTCTGCTGGGCGCAGTGG + Intergenic
902236629 1:15061805-15061827 GAGAATCCCGCCAGGTGCAGTGG - Intronic
902296072 1:15467799-15467821 GTGAGTTCCGCTGGGCGCCGTGG + Intronic
902437237 1:16406270-16406292 CAGAGCCAGGCCGGGCGCAGCGG - Intronic
902522302 1:17026648-17026670 GGGAGTCCGGCCAGGTGCAGTGG - Intronic
902592619 1:17485857-17485879 GAGAGTCTGGCCGGGCGTGGTGG + Intergenic
902619142 1:17640320-17640342 GAGAGTGCCTCAGGGGGCAGGGG + Intronic
902837546 1:19056939-19056961 GAGAGAGAGGCCGGGCGCAGTGG + Intergenic
903050524 1:20597159-20597181 AAGAGTCTGGCCGGGCGCCGTGG + Intronic
903243117 1:21997070-21997092 TAAAGTCCCGCCGGGCGTGGTGG + Intronic
903489329 1:23716111-23716133 GAGATTCTGGCCCGGCGCAGTGG - Intergenic
903498054 1:23784525-23784547 AAGAAAGCCGCCGGGCGCAGTGG - Intronic
903508643 1:23856702-23856724 GAGAGGCCGGCCGGGAGCGGTGG + Intronic
903509424 1:23863562-23863584 TATAGTCCTGCTGGGCGCAGTGG + Intronic
903789692 1:25884407-25884429 GAGACCCAGGCCGGGCGCAGTGG + Intronic
903856538 1:26341049-26341071 GAAAATCAGGCCGGGCGCAGTGG + Intronic
903961538 1:27060882-27060904 GAGAGTGGGGCCGGGCGCGGTGG - Intergenic
903989170 1:27253300-27253322 AGGAGGCCGGCCGGGCGCAGTGG - Intronic
904132851 1:28288181-28288203 GAGCTTCCTGCTGGGCGCAGTGG - Intergenic
904248899 1:29208277-29208299 CTGAGTCAGGCCGGGCGCAGTGG - Intronic
905089058 1:35412164-35412186 GAAAGTCCCGCCAGGTGCGGTGG - Intronic
905137033 1:35808079-35808101 CAGGGTCCCGGCGGGCGGAGGGG - Intergenic
905677078 1:39834154-39834176 GCCAGTCAGGCCGGGCGCAGTGG - Intergenic
906177818 1:43790921-43790943 GAGATGCCGGCCGGGTGCAGTGG - Intronic
906973196 1:50540257-50540279 AAGAATCCTGCCGGGTGCAGTGG - Intronic
907251485 1:53142496-53142518 GAGAGCCCGGCCGGGGGCACAGG + Exonic
907543680 1:55240361-55240383 AAGAGTACGGCCGGGCGCGGTGG - Intergenic
907567773 1:55452319-55452341 GAGACACCGGCTGGGCGCAGGGG - Intergenic
907683937 1:56591377-56591399 CAGTGTCAGGCCGGGCGCAGTGG - Intronic
907918646 1:58893476-58893498 GAGATTCCCGCCTTGAGCAGAGG + Intergenic
908214811 1:61940427-61940449 GAAATTCTAGCCGGGCGCAGTGG + Intronic
908225653 1:62053430-62053452 GAGTGTCTGGCCGGGCACAGTGG + Intronic
908741629 1:67334764-67334786 AAGAATCCGGCCGGGCGCGGTGG - Intronic
908933194 1:69341314-69341336 GGGAGTTCGGCCGGGCGCGGTGG + Intergenic
909156579 1:72085680-72085702 GTGATTCCGGCCAGGCGCAGTGG + Intronic
909594096 1:77385444-77385466 TAAAGTCTGGCCGGGCGCAGTGG - Intronic
910989542 1:93040927-93040949 GAAATTCACGCTGGGCGCAGTGG - Intergenic
911089333 1:94006044-94006066 GAGAGGCCTGCAGGGAGCAGGGG + Intronic
912346145 1:108965057-108965079 GGCAGTTCCGCCGGGCGCAGTGG - Intergenic
912907498 1:113722162-113722184 GAGAACGCAGCCGGGCGCAGTGG + Intronic
913293222 1:117294518-117294540 GAGAGGCAGGCCGGGCGCGGTGG + Intergenic
914874989 1:151506788-151506810 GAGAGACTGGCTGGGCGCAGTGG - Intergenic
915136961 1:153739350-153739372 GAAACTCCGGCCGGGCGCGGTGG - Intronic
915400305 1:155617101-155617123 GAGTGTGTGGCCGGGCGCAGTGG - Intergenic
915840631 1:159209884-159209906 GATGTTCCCGCCGGGCGCGGTGG - Intergenic
916147262 1:161750654-161750676 GGGAATCCCGCAGGGCGCGGTGG + Intronic
916626590 1:166564875-166564897 AAAAGTCCAGCTGGGCGCAGTGG + Intergenic
916683094 1:167121800-167121822 GAGATGCCCGCAGGGCGCACTGG - Intronic
916764627 1:167848334-167848356 GAAAATCTGGCCGGGCGCAGTGG - Intronic
917015877 1:170531197-170531219 GAAATCCCGGCCGGGCGCAGTGG + Intergenic
917147409 1:171907202-171907224 GTAAGTCAGGCCGGGCGCAGTGG + Intronic
917353988 1:174106886-174106908 GAGAGTCAGGCCAGGCACAGTGG - Intergenic
917892316 1:179452399-179452421 GAAAATCCCGCCGGGCGCGGTGG + Intronic
919055084 1:192560963-192560985 GCAATTCCGGCCGGGCGCAGTGG + Intergenic
919781107 1:201221770-201221792 GAGAGGCCTGCAGGGCTCAGGGG - Intronic
919890604 1:201971371-201971393 AAGAGTCTGGCCGGGTGCAGTGG + Intergenic
919902079 1:202051307-202051329 GTGAGTCTCGCCAGGCGCGGTGG - Intergenic
920124787 1:203685136-203685158 GAGATTAAGGCCGGGCGCAGTGG - Intronic
920344788 1:205299163-205299185 CAGCTTCTCGCCGGGCGCAGTGG + Intergenic
920579301 1:207089982-207090004 GGAATTCCGGCCGGGCGCAGCGG + Intronic
921354085 1:214269053-214269075 AAGAATACAGCCGGGCGCAGTGG + Intergenic
921673979 1:217956810-217956832 GAATGTCCGGCCGGGCACAGTGG + Intergenic
921874167 1:220175502-220175524 GGTATTCCGGCCGGGCGCAGTGG - Intronic
922501542 1:226100503-226100525 TAGAGTGCAGCCGGGCGCGGTGG - Intergenic
923180355 1:231511833-231511855 GAGAGTGTTGGCGGGCGCAGTGG - Intergenic
923664958 1:235991618-235991640 GGGAGGCCGGCCGGGCACAGTGG - Intronic
923907247 1:238399081-238399103 AAGAATCACGCCAGGCGCAGTGG + Intergenic
924240170 1:242032749-242032771 GAGGCTCGGGCCGGGCGCAGTGG + Intergenic
1062801469 10:384523-384545 GTGGGTCTCGCCGGGCGCAGTGG - Intronic
1062869390 10:886800-886822 GTGACTACCGCCGGGCACAGTGG + Intronic
1062901816 10:1152328-1152350 GTGGGTCAGGCCGGGCGCAGTGG - Intergenic
1063088035 10:2837103-2837125 GAGAGGCGCGCCGGGGGCCGGGG - Intergenic
1063097707 10:2922877-2922899 GAGAGGCAGGCCGGGCGCAGTGG + Intergenic
1063783850 10:9357357-9357379 TAGAGCCCAGCCAGGCGCAGTGG - Intergenic
1064204552 10:13312190-13312212 TCGATTCCAGCCGGGCGCAGTGG + Intergenic
1064334420 10:14425861-14425883 GAGTGAGCGGCCGGGCGCAGTGG + Intronic
1064512264 10:16108461-16108483 TTGACTCCGGCCGGGCGCAGTGG + Intergenic
1064661042 10:17608313-17608335 GAGAGTCTGGCCAGGCGCAGTGG - Intronic
1064684174 10:17842249-17842271 GAGATTTTCGCCAGGCGCAGTGG - Intronic
1064966314 10:21018741-21018763 GAGCTTCAGGCCGGGCGCAGTGG + Intronic
1065598163 10:27337921-27337943 GATAATCCAGCCGGGCGCGGTGG - Intergenic
1065601032 10:27368896-27368918 GAAAAGCCGGCCGGGCGCAGTGG - Intergenic
1065872414 10:29966838-29966860 GAGAATTCAGCCGGGTGCAGCGG - Intergenic
1066287971 10:33987194-33987216 GAAAGCCAGGCCGGGCGCAGTGG - Intergenic
1066352608 10:34650722-34650744 CACAGTCCAGCCGGGCACAGCGG + Intronic
1066800471 10:39183192-39183214 GGGAATCCGGCCGGGCGCGGTGG + Intergenic
1068506615 10:57908316-57908338 GAAACTCCAGCCGGGCGCGGTGG - Intergenic
1068693197 10:59939131-59939153 AAGAGTCAGGCCGGGCGCGGTGG - Intergenic
1069283784 10:66688682-66688704 CAGAGACCGGCCGGGCGCGGTGG + Intronic
1069523893 10:69150341-69150363 GAAAGTTGGGCCGGGCGCAGTGG - Intronic
1069712556 10:70499410-70499432 GACACTCCCGCCTGGCCCAGAGG - Intronic
1070623045 10:78028788-78028810 GTGAATCCAGCCGGGCGCGGTGG - Intronic
1071363733 10:84877863-84877885 GAAAGTCTGGCCGGGCGCGGTGG - Intergenic
1072282258 10:93877558-93877580 GAGAGTGAGGCCAGGCGCAGTGG + Intergenic
1072571590 10:96662591-96662613 GAAACTCCGGCCGGGCGCGGTGG + Intronic
1072687684 10:97548506-97548528 TAGAGTCAGGCTGGGCGCAGTGG + Intronic
1073037642 10:100575320-100575342 GCAAGTCCCGGCCGGCGCAGTGG - Intergenic
1073447173 10:103588657-103588679 GAGAGGAAGGCCGGGCGCAGCGG + Intronic
1073751408 10:106531536-106531558 GTGAGAGCAGCCGGGCGCAGTGG - Intergenic
1073780761 10:106836185-106836207 GGGAGGTGCGCCGGGCGCAGTGG + Intronic
1074337645 10:112594192-112594214 TGGAGACCGGCCGGGCGCAGTGG - Intronic
1074586054 10:114768368-114768390 CAGAGCCCCGCCCGGCGCCGCGG - Intergenic
1074893107 10:117751689-117751711 GATAGGCAGGCCGGGCGCAGTGG + Intergenic
1074997071 10:118766845-118766867 GAATGTGCTGCCGGGCGCAGTGG + Intergenic
1075061386 10:119259349-119259371 GAGTGTTAGGCCGGGCGCAGTGG - Intronic
1075247262 10:120833814-120833836 GAGTGTCCAGCTGGGAGCAGTGG + Intergenic
1075598599 10:123750344-123750366 GAGAGGCCGGCTGGGAGCAGTGG - Intronic
1075601005 10:123769299-123769321 GAGGGGCCGGCCGGGCGCAGCGG + Intronic
1075766601 10:124898417-124898439 AAAAGTCTGGCCGGGCGCAGTGG - Intergenic
1076639825 10:131907451-131907473 CACAGACTCGCCGGGCGCAGTGG + Intronic
1076832096 10:133000717-133000739 GAGAGGACAGCCAGGCGCAGTGG - Intergenic
1076884821 10:133257526-133257548 GAGAGGCCCGGAGGGAGCAGGGG - Intergenic
1077369574 11:2175278-2175300 CAGTGTCAGGCCGGGCGCAGTGG - Intergenic
1077505685 11:2929034-2929056 GAAAGTCCTGCAGGGCGCGGCGG + Exonic
1078163596 11:8863518-8863540 AAGAGGCAGGCCGGGCGCAGTGG - Intronic
1079059605 11:17236735-17236757 GAAAGCGCAGCCGGGCGCAGTGG + Intronic
1079926819 11:26504734-26504756 TAGAAGCCCGCCGGGCGCGGTGG + Intronic
1081383349 11:42442845-42442867 GAGAAACCGGCCGGGCGCGGTGG - Intergenic
1081831966 11:46121671-46121693 GAGGGGGCCGCCGGGCGGAGTGG + Intergenic
1081904771 11:46661228-46661250 CATAGTTCTGCCGGGCGCAGTGG + Intronic
1081997141 11:47373063-47373085 GACAGCCCGGCCGGGCGCAGTGG + Intronic
1082034999 11:47638272-47638294 CTGAGTCCCGCCGGGCGCGGTGG + Intronic
1083411308 11:62494721-62494743 GCCAGGACCGCCGGGCGCAGTGG + Intronic
1083563534 11:63693832-63693854 GAGACTCTGGCCGGGCACAGTGG + Intronic
1083721864 11:64607456-64607478 GCGGGGCCCGCCGGGCGCAGTGG - Exonic
1083826633 11:65207623-65207645 GAGACTCAAGCCGGGCTCAGTGG + Intronic
1084043698 11:66557046-66557068 CAGAGCCCCGCCGAGCGCGGTGG - Intronic
1084100049 11:66941813-66941835 GAAATTCCGGCCAGGCGCAGTGG + Intronic
1084174375 11:67415849-67415871 GAGGGTCCCGCCGCGGGGAGCGG - Intronic
1084376953 11:68784148-68784170 AAGAATCAGGCCGGGCGCAGTGG - Intronic
1084676532 11:70638717-70638739 GAGAGTCCAGCCGGGCACGGTGG + Intronic
1084737025 11:71112104-71112126 AAGAATCCTGCCGGGCACAGTGG + Intronic
1084743436 11:71153677-71153699 AAGAGTTCAGCCGGGTGCAGTGG + Intronic
1085129578 11:74026680-74026702 TAGATTCAGGCCGGGCGCAGTGG + Intronic
1085461476 11:76696535-76696557 GAGAGTCTGGCCGGGCACGGTGG - Intergenic
1085555627 11:77418021-77418043 CAGAATCCGGCTGGGCGCAGTGG - Intronic
1085576628 11:77610776-77610798 CAGAGTTCGGCCGGGCACAGTGG + Intronic
1086040616 11:82472661-82472683 GAACTTCCGGCCGGGCGCAGTGG - Intergenic
1088657696 11:112016095-112016117 CAGGGTCTCGCCGGGCGCGGTGG - Intronic
1088878276 11:113953715-113953737 AAGAGTGAGGCCGGGCGCAGTGG - Intergenic
1089194160 11:116682749-116682771 GTGAGTCCTGCTGGGTGCAGTGG + Intergenic
1089336704 11:117729911-117729933 GGGAGTCAGGCCGGGCGCAGTGG + Intronic
1089540522 11:119186849-119186871 CCGATTCCCGCTGGGCGCAGTGG + Intronic
1089622821 11:119731518-119731540 GAGAGTGCAGCCGGGTACAGTGG - Intergenic
1091478034 12:796561-796583 GAGATTTCAGCTGGGCGCAGTGG - Intronic
1092520421 12:9266848-9266870 GTGAGTGCGGCCGGGCGCGGTGG - Intergenic
1092624565 12:10312700-10312722 AAAAGTGCGGCCGGGCGCAGTGG + Intergenic
1092829201 12:12427465-12427487 GAAAGTCTGGCCGGGCGCGGTGG - Intronic
1093476064 12:19555674-19555696 GAAATTCCAGTCGGGCGCAGTGG - Intronic
1093690010 12:22100253-22100275 GAGATTCTGGCCGGGCGCGGTGG + Intronic
1093711612 12:22334809-22334831 GAGGGTCCCGGCGGGCGAGGCGG - Intronic
1094606793 12:31956347-31956369 TACATTGCCGCCGGGCGCAGTGG - Intergenic
1094681503 12:32671406-32671428 GAAAATACAGCCGGGCGCAGTGG + Intergenic
1095286886 12:40423240-40423262 GAACTACCCGCCGGGCGCAGTGG - Intronic
1096065266 12:48734712-48734734 GAGAGTTTGGCCAGGCGCAGTGG + Intergenic
1096694432 12:53339436-53339458 GAGAGTGGGGCCGGGTGCAGTGG + Intronic
1096698747 12:53368204-53368226 CCGAGTGCAGCCGGGCGCAGCGG + Intergenic
1097047338 12:56196892-56196914 CAGAGACCCGCTGGGCACAGTGG - Intergenic
1098161096 12:67648834-67648856 GGGAGGCCCGCGGCGCGCAGGGG + Exonic
1098879440 12:75902209-75902231 AAGAGCCCGGCCGGGCGCGGTGG + Intergenic
1099059773 12:77892700-77892722 GATAGTTGGGCCGGGCGCAGTGG - Intronic
1099460107 12:82911165-82911187 CCGAGACCCGCCGGGCGCAGTGG - Intronic
1099518751 12:83631968-83631990 GAAAGGCCGGCCGGGCGCGGTGG - Intergenic
1100276575 12:93076993-93077015 GGTGTTCCCGCCGGGCGCAGTGG - Intergenic
1100488549 12:95055664-95055686 CAGATCCCGGCCGGGCGCAGTGG + Intronic
1100676555 12:96874902-96874924 GAGATCCCGGCCGGGCGCGGTGG - Intronic
1101395000 12:104339001-104339023 CAGAGACTGGCCGGGCGCAGTGG - Intronic
1101670936 12:106872379-106872401 CAGAGTCAGGCCGGGCACAGTGG + Intronic
1101764669 12:107686677-107686699 AAAAGTCCCGCCGGGCGCGGTGG + Intronic
1101944360 12:109124999-109125021 GAGAGTTGGGCCGGGCACAGTGG - Intronic
1102045048 12:109824466-109824488 CTTAGTCCGGCCGGGCGCAGTGG + Intronic
1102170479 12:110838699-110838721 AAGAATCAGGCCGGGCGCAGCGG - Intergenic
1102391358 12:112551531-112551553 AAGAGGCTGGCCGGGCGCAGTGG + Intergenic
1103318219 12:120074196-120074218 GAGATTGTGGCCGGGCGCAGTGG - Intronic
1103333183 12:120169006-120169028 GAAAGCCTGGCCGGGCGCAGTGG + Intronic
1103651910 12:122439579-122439601 GTGAATGCGGCCGGGCGCAGTGG + Intergenic
1104192990 12:126501369-126501391 TAGAATCAGGCCGGGCGCAGTGG + Intergenic
1104451583 12:128873181-128873203 GAGAGTCAGGCCAGGTGCAGTGG - Intronic
1105522154 13:21140724-21140746 ATGAGTCCCGCAGGGTGCAGAGG + Intronic
1105651685 13:22385217-22385239 GAGATTTAGGCCGGGCGCAGTGG - Intergenic
1106142237 13:27020961-27020983 GTGAATCCAGCCGGGTGCAGTGG + Intergenic
1106280480 13:28264249-28264271 GAAAAACGCGCCGGGCGCAGTGG + Intronic
1106630185 13:31463515-31463537 AAGAAGCCCGCCAGGCGCAGTGG - Intergenic
1107428888 13:40320892-40320914 AAGGGCCCAGCCGGGCGCAGTGG + Intergenic
1107910880 13:45104905-45104927 CAGATTCTGGCCGGGCGCAGCGG + Intergenic
1109403111 13:61861141-61861163 GAGATCCCTGCCGGGCGCGGTGG + Intergenic
1109411996 13:61982509-61982531 AAGAGCCCGGCCAGGCGCAGTGG + Intergenic
1110100798 13:71598538-71598560 AAGCGTCAGGCCGGGCGCAGTGG - Intronic
1110228065 13:73140583-73140605 GAGAATACTGCCGGGCACAGTGG - Intergenic
1111684490 13:91485503-91485525 GAAGGGCCGGCCGGGCGCAGTGG - Intronic
1113764812 13:112874624-112874646 GAGAGTCCCGCCCAGGTCAGGGG - Intronic
1114468098 14:22939073-22939095 AAAAGTCATGCCGGGCGCAGTGG + Intergenic
1114485202 14:23057759-23057781 GAGTGCCCTGCCGGGCGCTGCGG - Intergenic
1115542569 14:34435915-34435937 AGCAGTCCTGCCGGGCGCAGTGG - Intronic
1115551242 14:34507125-34507147 GAACATCTCGCCGGGCGCAGTGG + Intergenic
1116314203 14:43366568-43366590 GAAAGTCCAGCCAGGCGCAGTGG + Intergenic
1116347445 14:43812572-43812594 GAGACTTCGGCCAGGCGCAGTGG - Intergenic
1117267038 14:54100113-54100135 TAGATTCAGGCCGGGCGCAGTGG - Intergenic
1117698272 14:58388191-58388213 GAGAGGCCGGCCGGGTGCGGTGG - Intergenic
1118049856 14:62014719-62014741 GAGAAACCAGCCGGGCGCAATGG - Intronic
1118213816 14:63789492-63789514 TAGAATCTGGCCGGGCGCAGTGG + Intergenic
1118275811 14:64385393-64385415 GAGAGTCCAGCTGGGAGCTGTGG - Intergenic
1119304690 14:73598084-73598106 GGGAGACCTGCCGGGTGCAGTGG + Intergenic
1119522343 14:75295247-75295269 GTGTGTACCGCCGGGCCCAGAGG + Intergenic
1119602861 14:75988803-75988825 GACAATCCAGCCGGGCGCAGTGG - Intronic
1119617935 14:76111168-76111190 CAGATTCCAGCCGTGCGCAGTGG + Intergenic
1120140190 14:80921674-80921696 AACAGTCCGGCCGGGCGCAGTGG + Intronic
1121192491 14:92042629-92042651 CAGAGCCCGGCCGGGCGCAGTGG + Exonic
1121287265 14:92746106-92746128 GAGATTCTCGCTGGGCGCGGTGG - Intronic
1121366541 14:93317290-93317312 TATATTCCGGCCGGGCGCAGTGG - Intronic
1122071831 14:99209956-99209978 GAGAGTCTCGGGGGGCTCAGAGG - Intronic
1122098433 14:99388308-99388330 GAAAGTCCAGCCGGGCGCAGTGG - Intergenic
1122548324 14:102537227-102537249 GAGGGTCCAGCCGGGCGCAGTGG - Intergenic
1122974535 14:105165667-105165689 GAGAGTCACTCAGGGGGCAGGGG + Intronic
1123691461 15:22841792-22841814 GAGTGTCCGGCCGGGCGCGGTGG - Intronic
1123988405 15:25665322-25665344 GAGTGTTCCGCAGGGTGCAGGGG + Intergenic
1124139432 15:27064325-27064347 GAGAGTCCCTCCAGGCCCGGCGG + Intronic
1124446589 15:29739730-29739752 CAGAGACTGGCCGGGCGCAGTGG - Intronic
1124578004 15:30926378-30926400 GAGAGTCCTGCCAGGCCCAAGGG - Intronic
1125815147 15:42577438-42577460 TAGTGTCCGGCTGGGCGCAGTGG - Intronic
1125899649 15:43333132-43333154 GAAAATCTGGCCGGGCGCAGTGG + Intronic
1126045326 15:44634569-44634591 GAGAATCTGGCTGGGCGCAGTGG - Intronic
1126235149 15:46374973-46374995 GAGAGTTCAGCCAGGTGCAGTGG - Intergenic
1127150717 15:56071930-56071952 GAGAGTAAGGCCGGGCGCGGTGG - Intergenic
1127343197 15:58067154-58067176 GAGAATCAGGCCGGGTGCAGTGG - Intronic
1127907725 15:63388933-63388955 GAGAGTCCAGCCAGGCACGGTGG + Intergenic
1127983971 15:64054275-64054297 CAGAGTTGAGCCGGGCGCAGTGG + Intronic
1128263277 15:66247747-66247769 GATGGTTCAGCCGGGCGCAGTGG + Intronic
1128418670 15:67470463-67470485 AAGACTCCAGCCAGGCGCAGTGG - Intronic
1128433641 15:67624050-67624072 GAGAGCTAGGCCGGGCGCAGTGG + Intronic
1128595826 15:68948351-68948373 GAGAATCAGGCCGGGCGCAGTGG + Intronic
1128888022 15:71306018-71306040 GAGAGACGGGCCAGGCGCAGTGG + Intronic
1128973572 15:72130848-72130870 AAAAATCCTGCCGGGCGCAGTGG - Intronic
1129282882 15:74500049-74500071 GAGATTCCTGCCGGGCGCAGTGG + Intergenic
1129417397 15:75393660-75393682 GATAGTCCCACTGGGCACAGTGG - Intronic
1129444262 15:75605585-75605607 AAGAGGCCCGGTGGGCGCAGTGG - Intronic
1129533731 15:76292848-76292870 TATATTCCGGCCGGGCGCAGTGG + Intronic
1129717637 15:77861441-77861463 GAGATCCCGGCCGGGCGTAGTGG - Intergenic
1129988613 15:79941523-79941545 CACAGTTCCGCTGGGCGCAGTGG + Intergenic
1131267221 15:90923653-90923675 GTGAGGCTGGCCGGGCGCAGTGG - Intergenic
1132095462 15:98981203-98981225 GAAAGTCTGGCCGGGCGCGGTGG + Intronic
1132103515 15:99045583-99045605 GAGAGATTGGCCGGGCGCAGTGG - Intergenic
1132129430 15:99261942-99261964 GTGAGACCAGCCGGGCACAGTGG - Intronic
1132370386 15:101293944-101293966 GTGAGTTGGGCCGGGCGCAGTGG + Intronic
1132602568 16:780182-780204 GAGGGTCCCGGCGGGAGCAGGGG + Intronic
1132622318 16:873646-873668 GAGGGTCCCCGCGAGCGCAGGGG - Intronic
1133618962 16:7507848-7507870 CAGATTCCGGCCGGGCGCCGTGG - Intronic
1134282528 16:12830358-12830380 GATATTTCAGCCGGGCGCAGTGG - Intergenic
1134451921 16:14368876-14368898 GAGATTCTCGCTGGGCACAGTGG + Intergenic
1134621052 16:15689650-15689672 GAGAGAACAGCTGGGCGCAGTGG + Intronic
1135325488 16:21522867-21522889 ACCAGTCTCGCCGGGCGCAGTGG - Intergenic
1135497384 16:22964347-22964369 GAGTCTTCGGCCGGGCGCAGTGG - Intergenic
1135562015 16:23483932-23483954 CACAGCCCAGCCGGGCGCAGTGG - Intronic
1135691411 16:24540199-24540221 GAGAGACCCGCCGGGAGGTGCGG + Exonic
1135763702 16:25158420-25158442 AACAGACCGGCCGGGCGCAGTGG - Intronic
1135781153 16:25301872-25301894 GACAGTCAGGCTGGGCGCAGAGG + Intergenic
1136363189 16:29794861-29794883 GAGAATTTGGCCGGGCGCAGTGG - Intronic
1136375744 16:29864065-29864087 GAGAGGCCCACCAGGCGAAGGGG + Intergenic
1136381290 16:29897072-29897094 GAGAGTCTGGCCGGCCGGAGGGG + Exonic
1136448501 16:30338551-30338573 GAGGGGACAGCCGGGCGCAGTGG - Intergenic
1136502972 16:30682906-30682928 CAGTGACCTGCCGGGCGCAGTGG + Intergenic
1137868450 16:51926283-51926305 GAAAGTCCAGCCGGGCGTGGTGG - Intergenic
1138475226 16:57266646-57266668 GAGAGACCTGCAGGGCCCAGGGG - Intronic
1138579782 16:57933213-57933235 GTGAGGCCAGCCGGGCCCAGTGG - Intronic
1138827081 16:60333624-60333646 GAGACTCCAGCCAGGCGCAGTGG - Intergenic
1138862379 16:60774317-60774339 GAGAAAGCGGCCGGGCGCAGTGG + Intergenic
1138953311 16:61940686-61940708 AATAGTCCGGCTGGGCGCAGTGG - Intronic
1139036705 16:62955996-62956018 CAAAGACCGGCCGGGCGCAGTGG + Intergenic
1139941256 16:70607390-70607412 GAAAATCCAGCCGGGTGCAGTGG - Intronic
1140750773 16:78021532-78021554 GAGAGACTCGCCGGGCGTGGTGG - Intergenic
1141607116 16:85160337-85160359 CAGAGTCCGGCCGTGCGCTGTGG - Intergenic
1141691232 16:85597756-85597778 AAGAATCCAGCCAGGCGCAGTGG - Intergenic
1142417191 16:89949136-89949158 GGGCGGCCCGCCCGGCGCAGGGG + Intronic
1142742368 17:1938583-1938605 GAGATTCTGGCCGGGCGCGGTGG - Intronic
1142823263 17:2489365-2489387 GTGATTTCGGCCGGGCGCAGTGG + Intronic
1142985402 17:3692032-3692054 CAAAGACCAGCCGGGCGCAGTGG + Intronic
1143150598 17:4805662-4805684 GAGACTCTGGCCGGGCGCGGTGG + Intergenic
1143360754 17:6368456-6368478 GAGGGGCCGGCCGGGCGCAGTGG + Intergenic
1143883025 17:10044765-10044787 GAGTGTCCGGCCAGGCGCGGTGG + Intronic
1144107206 17:11997165-11997187 GCCGGTCCCGCGGGGCGCAGAGG + Intronic
1144597510 17:16583509-16583531 AAGGGTCCTGCCGGGCACAGTGG + Intergenic
1144903821 17:18624201-18624223 AAGGGTCCGGCCGGGCGCGGTGG + Intergenic
1145956785 17:28860262-28860284 GAGAGGGTGGCCGGGCGCAGTGG - Intronic
1146002966 17:29142217-29142239 CAGTGTCCAGCCAGGCGCAGTGG - Intronic
1146261845 17:31427246-31427268 GCCAGGCCAGCCGGGCGCAGTGG - Intronic
1146698336 17:34929799-34929821 GAGAGTCAGGCCAGGCGCAGTGG - Intronic
1146779325 17:35653761-35653783 CATATTCCAGCCGGGCGCAGTGG - Intronic
1147220311 17:38924978-38925000 CAGAGACCAGCCGGGCGCAGTGG - Intergenic
1147463544 17:40591813-40591835 GAGAAACTGGCCGGGCGCAGTGG - Intergenic
1147542463 17:41371944-41371966 GAGATTCAGGCCGGGTGCAGTGG - Intronic
1147595924 17:41717203-41717225 AAGACTCAAGCCGGGCGCAGTGG + Intergenic
1147866701 17:43557741-43557763 GGAATTCCGGCCGGGCGCAGTGG - Intronic
1148069118 17:44896927-44896949 CAGAGTCCAGCTGGGTGCAGTGG + Intronic
1148507145 17:48136456-48136478 GAAGGTCAGGCCGGGCGCAGGGG - Intronic
1148708182 17:49655222-49655244 GAAATTCTTGCCGGGCGCAGTGG + Intronic
1148880670 17:50723920-50723942 GAAATGCCAGCCGGGCGCAGTGG - Intronic
1149214636 17:54339323-54339345 GTGTTTCCGGCCGGGCGCAGTGG - Intergenic
1149556189 17:57575115-57575137 GAGAATGCGGCCGGGCACAGTGG - Intronic
1149703450 17:58674380-58674402 GAAAGTCCGGCCAGGCGCAGTGG + Intronic
1150214928 17:63462026-63462048 GAGAGTCAGGCCGGGCGCGGTGG - Intergenic
1150250125 17:63700327-63700349 GCGAGGCCCGCGGGGCGCTGCGG - Intronic
1150254865 17:63736338-63736360 GTGTGTCCAGCCGGGCGCGGTGG + Intronic
1150331870 17:64300914-64300936 GAAAAGGCCGCCGGGCGCAGTGG + Intergenic
1150491317 17:65576379-65576401 GATAGCCCGGCTGGGCGCAGTGG - Intronic
1151278829 17:73056454-73056476 CAGAGTCCAGCCGGGTGCGGTGG - Intronic
1151652335 17:75477721-75477743 GACAGGGCGGCCGGGCGCAGTGG + Intronic
1151782012 17:76253117-76253139 CAGAGTCCGGCTGGGCGCGGTGG - Intergenic
1152075073 17:78154259-78154281 GAGAGTCTGGCTGGGTGCAGTGG + Intronic
1152092328 17:78253917-78253939 CAGATTCCGGCCGGGCGCAGTGG - Intergenic
1152432531 17:80257275-80257297 GAGCCTCCGGCCGGGCTCAGTGG - Intergenic
1152860691 17:82695475-82695497 GTGAGGGCAGCCGGGCGCAGTGG - Intronic
1153004019 18:481415-481437 GAGATGTCGGCCGGGCGCAGTGG + Intronic
1153254493 18:3156894-3156916 AAGTGTCTCGCCGGGCGCGGTGG - Intronic
1154098664 18:11446849-11446871 GCAAGGCCCGCCGGGCGCGGTGG - Intergenic
1154350122 18:13576134-13576156 TGGATTCCAGCCGGGCGCAGTGG + Intronic
1154504445 18:15021370-15021392 AAGAGTCCGGCCGGGTGCGGTGG + Intergenic
1154998170 18:21661348-21661370 TAAACTCCAGCCGGGCGCAGTGG + Intronic
1155147389 18:23095382-23095404 GAAAGTTCGGCTGGGCGCAGTGG + Intergenic
1156300282 18:35830493-35830515 GAAAGTACTGCCAGGCGCAGTGG + Intergenic
1157253869 18:46120519-46120541 AAAAGTCAGGCCGGGCGCAGTGG - Intronic
1158579866 18:58671711-58671733 GAGGGTCGCGCCGGCCGGAGGGG - Exonic
1158700493 18:59741419-59741441 GACAATCTGGCCGGGCGCAGTGG - Intergenic
1160002118 18:75034587-75034609 AAAAAACCCGCCGGGCGCAGTGG - Intronic
1160053149 18:75455601-75455623 CAGGGCCCCGCAGGGCGCAGCGG - Intergenic
1160713865 19:566131-566153 GAGCGTGGGGCCGGGCGCAGTGG + Intergenic
1160825870 19:1080382-1080404 GAGTGTCCGGCGGGGCCCAGGGG + Intronic
1160875802 19:1295754-1295776 GAGCGGCCCCCCGGGCGCCGCGG - Exonic
1160968577 19:1757474-1757496 GAGCCTCCCGCAGGGCGCTGGGG + Intronic
1160968738 19:1758059-1758081 GAGTGTCCTGCCGGGCGCCGGGG + Intronic
1161256679 19:3313744-3313766 GACAGTCACGCCGGGAGCAGTGG + Intergenic
1161345007 19:3764368-3764390 GACAGCCCGGCCGGGCGCGGCGG - Intronic
1161345113 19:3765059-3765081 CAGAGTCCAGCCAGGGGCAGAGG + Intronic
1161397063 19:4050346-4050368 GAGAGACCGGCCGGGCGCGGTGG - Intronic
1161523600 19:4739411-4739433 TAGAGACTGGCCGGGCGCAGTGG - Intergenic
1161525279 19:4750900-4750922 GAGGGTCAGGCCGGGCACAGTGG - Intergenic
1161704153 19:5810644-5810666 GAGGTTACAGCCGGGCGCAGTGG + Intergenic
1161726401 19:5931743-5931765 GAGAAACCTGCCGGGCACAGTGG + Intronic
1161753531 19:6114796-6114818 GAGACTCTTGCCGGGCGCGGTGG + Intronic
1161865835 19:6831597-6831619 GAGAAGCCAGCCGGGCGCGGTGG - Intronic
1162105732 19:8368569-8368591 GAGAGTCCCGCCGGGCGCAGTGG + Intronic
1162388725 19:10376887-10376909 GAAAGTCAGGCCGGGCGCGGTGG - Intronic
1162557548 19:11396953-11396975 CAGGGTCCGGCCAGGCGCAGTGG - Intronic
1162631343 19:11929448-11929470 ATGAGTCAGGCCGGGCGCAGTGG - Intronic
1162647353 19:12059550-12059572 AAGAAACCGGCCGGGCGCAGTGG - Intergenic
1162815501 19:13191804-13191826 AAGAGTCAGGCCGGGCACAGTGG - Intergenic
1163250401 19:16123318-16123340 GAAAATCCAGCCAGGCGCAGTGG + Intronic
1163301669 19:16451236-16451258 GAGAGTCTGGGCGGGCGCGGTGG - Intronic
1163468267 19:17482229-17482251 GAAGTGCCCGCCGGGCGCAGTGG + Intronic
1163825621 19:19522763-19522785 CAAAGACCTGCCGGGCGCAGTGG - Intronic
1164042017 19:21501113-21501135 CAGTGACCAGCCGGGCGCAGTGG - Intronic
1164637436 19:29801783-29801805 AAGAGGCCAGCCGGGCGCAGTGG - Intergenic
1165097093 19:33415382-33415404 GAGCGGCAGGCCGGGCGCAGTGG + Intronic
1165246215 19:34499986-34500008 GACTCTTCCGCCGGGCGCAGGGG - Intronic
1165777649 19:38414210-38414232 CAGTGTCTAGCCGGGCGCAGTGG - Intronic
1166014399 19:39969428-39969450 GCGAGTCCAGCCAGGCACAGTGG + Intergenic
1166792771 19:45407767-45407789 CAGAGGCCAGCCAGGCGCAGTGG + Intronic
1166973045 19:46583217-46583239 GAAATACCAGCCGGGCGCAGTGG + Intronic
1166984954 19:46654197-46654219 GGGAGTCAGGCCGGGCGCAGTGG + Intronic
1167008371 19:46789685-46789707 GATAATACGGCCGGGCGCAGTGG + Intergenic
1167070178 19:47217169-47217191 GAAAGATCGGCCGGGCGCAGTGG - Intergenic
1167122074 19:47523313-47523335 GAGACGCTCGCCGGGCGCGGTGG - Intronic
1167174716 19:47857877-47857899 GAAAGTTCTGCCGGGCGCAGTGG - Intergenic
1167620872 19:50559844-50559866 CAGATTCTGGCCGGGCGCAGTGG + Intronic
1167842958 19:52137129-52137151 GAAAATCCTGCCGGGCACAGTGG + Intronic
1167870101 19:52361462-52361484 GAGATTGTGGCCGGGCGCAGTGG - Intronic
1167936063 19:52909532-52909554 AAAAGTGCCCCCGGGCGCAGTGG - Intergenic
1168014601 19:53562400-53562422 AAGATTCACGCCGGGTGCAGTGG + Intronic
1168180220 19:54657287-54657309 GAGATTCCGGCCGGGCGCGGTGG - Intronic
1168255902 19:55165181-55165203 GAAACTCCGGCCGGGCGCGGTGG - Intronic
1168261801 19:55199319-55199341 GAGAGAGAGGCCGGGCGCAGTGG + Intronic
1168271572 19:55252823-55252845 GAGTGTACAGCCAGGCGCAGTGG - Intronic
1168724453 19:58573054-58573076 GAGCGGCCCGCTGAGCGCAGAGG - Exonic
925472628 2:4179279-4179301 GGGTTTCCGGCCGGGCGCAGTGG + Intergenic
925682538 2:6438005-6438027 GAAAGACCAGCCGGGCGCCGTGG + Intergenic
926905612 2:17802346-17802368 GACGGTTCCGCCGGGTGCAGTGG - Intergenic
927166312 2:20325906-20325928 GAGAGTCAGGCTGGGCACAGTGG - Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
928565489 2:32543085-32543107 AAGCTTCCAGCCGGGCGCAGTGG - Intronic
928996405 2:37296608-37296630 AAGAGTCAGGCCGGGCGCAGTGG + Intronic
929144472 2:38694607-38694629 GAAAGTCAGGCTGGGCGCAGTGG + Intronic
929189001 2:39122479-39122501 CACAGACCGGCCGGGCGCAGTGG + Intronic
929441976 2:41971858-41971880 CAGTTTCCCGCCAGGCGCAGTGG + Intergenic
930504024 2:52259101-52259123 AAGATCACCGCCGGGCGCAGTGG + Intergenic
930795445 2:55385563-55385585 GACAGTCTAGCCGGGCGCGGTGG + Intronic
930827822 2:55712002-55712024 CAGAGTCTCGCCAGGCGCGGCGG - Intergenic
931097973 2:58963337-58963359 GAGGCTCAGGCCGGGCGCAGTGG - Intergenic
931613246 2:64126447-64126469 GGGAGACCCGCTGGGCACAGTGG - Intronic
932315293 2:70776991-70777013 GAGACTCCCACGGGGCACAGTGG + Intergenic
932387945 2:71355241-71355263 AAAAATGCCGCCGGGCGCAGTGG - Intronic
932762967 2:74451699-74451721 CAGAATCTCGCCGGGCGCGGTGG + Intergenic
933255819 2:80079525-80079547 ATGAGTCCGGCTGGGCGCAGTGG + Intronic
933724246 2:85417769-85417791 GAGGGTATGGCCGGGCGCAGTGG - Intronic
935043968 2:99462798-99462820 GAAAGTTGGGCCGGGCGCAGTGG + Intronic
935684727 2:105673247-105673269 GACAGACTTGCCGGGCGCAGTGG - Intergenic
935946033 2:108287657-108287679 TAAAGTTCAGCCGGGCGCAGTGG + Intergenic
935975322 2:108572669-108572691 AAGAGTCAGGCCGGGCGTAGTGG - Intronic
936161136 2:110084975-110084997 GAGAATCAGGCCGGGCGCGGTGG + Exonic
936183527 2:110286379-110286401 GAGAATCAGGCCGGGCGCGGTGG - Intergenic
936377790 2:111957206-111957228 GCAGGTCTCGCCGGGCGCAGTGG - Intronic
937416410 2:121718437-121718459 GAGACTCCAGCCGTGCACAGTGG + Intergenic
937965840 2:127509419-127509441 TATAATGCCGCCGGGCGCAGTGG + Intronic
938010682 2:127826518-127826540 GAGTTTCTGGCCGGGCGCAGTGG + Intergenic
938503633 2:131851579-131851601 AAGAGTCCGGCCGGGTGCCGTGG + Intergenic
938699155 2:133860906-133860928 GTGATTCAAGCCGGGCGCAGTGG - Intergenic
938934691 2:136117766-136117788 TTGAGTCCCGCCGCGCGCGGCGG - Intronic
939164933 2:138630107-138630129 GTGAGTCCAGCCAGGGGCAGTGG - Intergenic
939819371 2:146937428-146937450 GACAGTCTAGCCGGGCGCGGTGG - Intergenic
940258997 2:151761075-151761097 TAGAGTGCGGCCGGGCGCGGTGG - Intergenic
941446225 2:165603180-165603202 GAGATTCAGGCCGGGCGCGGTGG - Intronic
941723796 2:168839624-168839646 GAGTCTACAGCCGGGCGCAGTGG + Intronic
941784330 2:169480963-169480985 GAAAATGTCGCCGGGCGCAGTGG - Intronic
941960743 2:171250870-171250892 GAAAGGTCGGCCGGGCGCAGTGG + Intergenic
942269465 2:174259593-174259615 AAGAGTCTGGCCGGGCGCAGTGG + Intergenic
942404817 2:175643068-175643090 GAAACTACGGCCGGGCGCAGTGG + Intergenic
943706731 2:191043064-191043086 GAGAATACGGCCGGGCGCAGTGG - Intronic
945174245 2:207025935-207025957 TATAGTCCGGCCGGGCGCGGTGG + Intergenic
946273699 2:218614939-218614961 GAAAGTCTGGCCGGGTGCAGTGG + Intronic
946286664 2:218709010-218709032 GAGTTCCCGGCCGGGCGCAGTGG - Intergenic
946358425 2:219204080-219204102 TGTATTCCCGCCGGGCGCAGTGG + Intronic
946754385 2:222929492-222929514 AAGATTCTGGCCGGGCGCAGTGG + Intronic
946837650 2:223788232-223788254 GGCAGTCCAGCCTGGCGCAGTGG - Intronic
947101908 2:226630213-226630235 GAAAGTTCGGCCGGGCGCGGTGG - Intergenic
947636209 2:231681743-231681765 GTGAGCCCTGCCGGGCGCTGGGG - Intergenic
948138251 2:235653176-235653198 CACATTCCGGCCGGGCGCAGTGG + Intronic
948468547 2:238163624-238163646 CAGGGGCCTGCCGGGCGCAGGGG - Intronic
948641661 2:239379198-239379220 GAGAGTCCAGCCAGGGGGAGTGG + Intronic
948747083 2:240104884-240104906 GAGAATTTGGCCGGGCGCAGTGG + Intergenic
949001141 2:241614596-241614618 GGGAATACCGCCGGGCGCAGTGG + Intronic
1168882726 20:1221761-1221783 GAAAGTCAGGCTGGGCGCAGTGG - Intergenic
1169688905 20:8308327-8308349 GAATGTTCAGCCGGGCGCAGTGG + Intronic
1170316895 20:15052036-15052058 TATAGGCCGGCCGGGCGCAGTGG - Intronic
1170491132 20:16875999-16876021 GAGAGTCAGACCGGGTGCAGCGG - Intergenic
1171133467 20:22676019-22676041 GCCAGACCCGCCGGGCGCGGTGG - Intergenic
1172351367 20:34245046-34245068 GAGAGTCAGGCCGGGCACAGTGG + Intronic
1172922931 20:38501690-38501712 GAAAGTCACGCTGGGCACAGTGG - Intronic
1172960771 20:38797848-38797870 CAGATTCCAGCCGGGTGCAGTGG - Intergenic
1173209748 20:41022919-41022941 CAGAATCAGGCCGGGCGCAGTGG - Intergenic
1173472729 20:43336314-43336336 AAAAGTCCTGCCGGGTGCAGTGG + Intergenic
1173502184 20:43562124-43562146 GAGATACCAGCCAGGCGCAGTGG + Intronic
1174185255 20:48701927-48701949 AAGAGGCTGGCCGGGCGCAGTGG + Intronic
1174307353 20:49623178-49623200 GCTAGTTCCGCCGGGTGCAGTGG + Intergenic
1174469028 20:50741831-50741853 CAGAGTGCGGCCGGGCGCGGTGG - Intronic
1174521895 20:51138136-51138158 AAGTGTCTGGCCGGGCGCAGTGG + Intergenic
1174611274 20:51800759-51800781 GAGAGTCCCTCCAGGCGCCTGGG + Intronic
1174820374 20:53721683-53721705 GAGAGGCCAGGTGGGCGCAGTGG - Intergenic
1175102197 20:56587284-56587306 TAAAGACCAGCCGGGCGCAGTGG - Intergenic
1175225263 20:57440785-57440807 GAGAGGCCAGCCGTGGGCAGTGG - Intergenic
1175760534 20:61559804-61559826 GAGAATCCGGCTGGGTGCAGTGG - Intronic
1177021125 21:15859480-15859502 GAGAAAGCGGCCGGGCGCAGTGG - Intronic
1177163999 21:17579569-17579591 GTGAGACCGGCGGGGCGCAGTGG - Intronic
1177205255 21:18002834-18002856 AAGAGCCCGGCCGGGCGCTGTGG + Intronic
1177558319 21:22718873-22718895 GAAATTCCCGCCGGGCGCGGTGG - Intergenic
1178068616 21:28935551-28935573 GAAAATCCCGCCGGGCGCAGTGG + Intronic
1178103693 21:29297135-29297157 CAGATTCCGGCCGGGAGCAGTGG - Intronic
1178556692 21:33597592-33597614 GAGAGTGCCGGCGGACACAGTGG - Intronic
1178984469 21:37291057-37291079 GGGATTCCGGCCGGGCGCGGTGG + Intergenic
1179295464 21:40058157-40058179 GTGAGTCCGGCCAGGCGCAGTGG - Intronic
1180196425 21:46197599-46197621 GAAACTGCTGCCGGGCGCAGTGG + Intronic
1180226796 21:46398305-46398327 GACAGTCCCAGCGAGCGCAGGGG - Intronic
1180683658 22:17647839-17647861 CAAAGTCCCTCCGGGCGCAGTGG + Intronic
1180698943 22:17771384-17771406 GAAAGACCAGCCGGGCGCGGTGG - Intronic
1180788567 22:18560579-18560601 GAGAGTCCCTCCTGGAGCTGTGG - Intergenic
1181233170 22:21434739-21434761 GAGAGTCCCTCCTGGAGCTGTGG + Intronic
1181245480 22:21500104-21500126 GAGAGTCCCTCCTGGAGCTGTGG - Intergenic
1181505196 22:23350908-23350930 AAGATTCCCGCCAGGCACAGTGG - Intergenic
1181790293 22:25260242-25260264 GCGAGTCAGGCCGGGCGTAGTGG - Intergenic
1181959918 22:26615799-26615821 GAAAGTGGGGCCGGGCGCAGTGG - Intronic
1181991041 22:26837106-26837128 GAGAGTGAGGCTGGGCGCAGTGG - Intergenic
1181996283 22:26885410-26885432 GAGAGTCCCACCAGACTCAGTGG - Intergenic
1182505949 22:30782473-30782495 GAAAATGCAGCCGGGCGCAGTGG - Intronic
1182535766 22:31001750-31001772 CAGATTCAGGCCGGGCGCAGTGG + Intergenic
1182663087 22:31938896-31938918 AAGAGTCGAGCCGGGCGCAGTGG + Intronic
1182904825 22:33926335-33926357 CAGAGTCTCGCCAGGAGCAGTGG - Intergenic
1183253711 22:36747285-36747307 GAGTTTCCAGCCGAGCGCAGTGG - Intergenic
1183312267 22:37116844-37116866 GAGAGGGGGGCCGGGCGCAGTGG + Intergenic
1183447404 22:37867369-37867391 GAAATTCTGGCCGGGCGCAGTGG + Intronic
1183508272 22:38221095-38221117 GAGAGTCTCGCGGGGAGGAGGGG + Exonic
1183596693 22:38816980-38817002 GAGAGTCAGGCTGGGCGCGGTGG + Intergenic
1183883018 22:40852028-40852050 AAGAATCAGGCCGGGCGCAGTGG - Intronic
1183961080 22:41412393-41412415 GAGAGTGAGGCCGGGCGCAGTGG - Intergenic
1184063650 22:42102190-42102212 ATCAGTCCAGCCGGGCGCAGTGG - Intergenic
1184276357 22:43411632-43411654 AAGAGGGGCGCCGGGCGCAGTGG + Intronic
1185110708 22:48898728-48898750 GAGAGTCCCCCCGGGTGCCTAGG + Intergenic
949178871 3:1102441-1102463 AACAGTCCTGCCGGGCGCGGTGG + Intronic
949557856 3:5173447-5173469 CAGAATGCCGCCGGGCGCGGTGG + Intronic
950255692 3:11503469-11503491 GATATTCAGGCCGGGCGCAGTGG + Intronic
950514021 3:13452225-13452247 GAGAATGCGGCCGGGCGCCGTGG + Intergenic
950712418 3:14821812-14821834 CAGAGTAAGGCCGGGCGCAGTGG + Intronic
951443929 3:22754971-22754993 GATAATCCAGCCAGGCGCAGTGG + Intergenic
951543844 3:23806671-23806693 GAGAGGCCGGCGGGGGGCAGGGG - Intronic
951721962 3:25709900-25709922 GAGGGTCCGGCTGGGCGCAGTGG + Intergenic
951898230 3:27631848-27631870 TATAATCCAGCCGGGCGCAGTGG + Intergenic
952434289 3:33256863-33256885 GAGACTCCAGCCTGGCCCAGTGG + Intergenic
952438615 3:33299327-33299349 AGGATTCCGGCCGGGCGCAGTGG - Intronic
952450844 3:33431448-33431470 GAAAGTTCCGCCGGGTGCAGTGG + Intronic
953258352 3:41311852-41311874 GAGAGTTTGGCCGGGTGCAGTGG - Intronic
953302500 3:41792885-41792907 TAGAGTATGGCCGGGCGCAGTGG + Intronic
953334170 3:42079766-42079788 GAGCTTCCAGCAGGGCGCAGTGG - Intronic
953700438 3:45191446-45191468 GGGAGGCAGGCCGGGCGCAGTGG - Intergenic
954000656 3:47554343-47554365 GAAAGCCCTGCCGGGCACAGTGG - Intergenic
954337602 3:49928921-49928943 CAAAGTCCGGCCAGGCGCAGTGG + Intronic
954514816 3:51164333-51164355 GAGATTCAGGCCGGGCGCGGTGG + Intronic
954619612 3:51988151-51988173 GAAAGTACGGCTGGGCGCAGTGG - Intronic
954815306 3:53275828-53275850 GGAATTCCGGCCGGGCGCAGTGG + Intergenic
954905793 3:54061755-54061777 GAAAGTACAGCCGGGCACAGTGG - Intergenic
955918411 3:63929556-63929578 GAAAGGCAGGCCGGGCGCAGTGG - Intronic
956403608 3:68905453-68905475 CAGAGACCGGCCGGGCGCAGTGG - Intronic
956841792 3:73146880-73146902 CATAGTCAGGCCGGGCGCAGTGG - Intergenic
957193460 3:77039599-77039621 GAGAGCCCCGCCGGCTGCCGAGG - Intronic
957378700 3:79395034-79395056 GTGAGACCGGCCGGGCGCGGTGG + Intronic
957991927 3:87636968-87636990 GCAAGTCCGGCCGGGCGCGGTGG + Intergenic
960599838 3:119445550-119445572 AAAATTCCCGCCGGGCGCGGTGG - Intronic
960822201 3:121746765-121746787 GTGAGTTAGGCCGGGCGCAGTGG - Intronic
961423312 3:126824864-126824886 GAAAGTCAGGCCGGGCACAGTGG - Intronic
961534446 3:127561205-127561227 GAGAATCTGGCCGGGCGCTGTGG + Intergenic
963569196 3:146970791-146970813 TATAGTTCCGCCGGGCGCGGTGG + Intergenic
964445881 3:156756778-156756800 GAAAGGCAGGCCGGGCGCAGTGG - Intergenic
964966980 3:162506343-162506365 GAGAGTCTCGCCCTGTGCAGTGG - Intergenic
965641873 3:170837213-170837235 GAGAAACCGGCCGGGCGCGGTGG - Intronic
965721228 3:171664744-171664766 GAGATTCCGGCCGGGCGTGGTGG - Intronic
966386370 3:179403503-179403525 AAAAGTCAGGCCGGGCGCAGTGG + Intronic
966513215 3:180787076-180787098 GGGAGTTTAGCCGGGCGCAGTGG - Intronic
966724185 3:183094334-183094356 CAGAGGGCAGCCGGGCGCAGTGG - Intronic
966727912 3:183124543-183124565 AAGAGACCAGCCGGGCACAGTGG + Intronic
966845292 3:184124343-184124365 GAAAGTTCGGCCGGGCGCGGTGG + Intergenic
966922465 3:184622341-184622363 GAGATTTGCGCCGGGCGCGGTGG + Intronic
966932178 3:184682891-184682913 TGGAGTCCGGCTGGGCGCAGTGG - Intronic
966979414 3:185117066-185117088 GAGGGTCAGGCCGGGCGCGGTGG - Intronic
967169660 3:186813107-186813129 GAGGGTCTGGCCGGGAGCAGTGG + Intergenic
968405636 4:337221-337243 GCGAGGCCCGCAGGGCGCTGGGG + Intergenic
968503372 4:961211-961233 GAGAGGCCAGCCGGGCTCAGCGG + Intronic
968503416 4:961330-961352 GAGAGGCCAGCCGGGCTCAGCGG + Intronic
968503442 4:961392-961414 GAGAGGCCAGCTGGGCTCAGCGG + Intronic
968889481 4:3360045-3360067 GAAAATCTCGCCAGGCGCAGTGG - Intronic
969189557 4:5506166-5506188 AAGAGTCCAGCCAGGCACAGTGG + Intergenic
969506590 4:7591775-7591797 GACAGGCCCGCCGGGGTCAGAGG - Intronic
969917809 4:10507767-10507789 GAGTTTCAGGCCGGGCGCAGTGG - Intronic
970121929 4:12763768-12763790 AAAAGTTCGGCCGGGCGCAGTGG - Intergenic
970405390 4:15757927-15757949 GAAAATCCCACCGGGCGCGGTGG - Intergenic
970831817 4:20348534-20348556 GTGAGTCAGGCCGGGTGCAGTGG - Intronic
970974951 4:22033086-22033108 GAGATACTGGCCGGGCGCAGTGG + Intergenic
971213489 4:24642150-24642172 AAGATTCCGGCCGGGTGCAGTGG + Intergenic
971456835 4:26852904-26852926 TAGAATCCGGCCGGGTGCAGTGG - Intergenic
973629661 4:52808181-52808203 GAAAGTTCGGCCGGGCGCGGTGG + Intergenic
974026348 4:56736750-56736772 GATAGTCTCGCCGGGCGCGGTGG + Intergenic
974047421 4:56908826-56908848 GCGCGTCCTGCCGGGCGCCGTGG + Intronic
975602837 4:76120712-76120734 GAGATCCTGGCCGGGCGCAGTGG - Intronic
976423040 4:84867881-84867903 GCAATTCCTGCCGGGCGCAGTGG + Intronic
976910108 4:90294222-90294244 AATAGTCTTGCCGGGCGCAGTGG + Intronic
977602446 4:98948848-98948870 GAGATTTCCACCAGGCGCAGTGG + Intergenic
978451570 4:108839952-108839974 AAGAGTAGGGCCGGGCGCAGTGG + Intronic
978571574 4:110143766-110143788 GAGGGGCAGGCCGGGCGCAGTGG + Intronic
979385365 4:120058342-120058364 GTGATTTCAGCCGGGCGCAGTGG + Exonic
979523317 4:121692944-121692966 TAGTGTCCCACCAGGCGCAGTGG + Intronic
979890154 4:126082245-126082267 GAGAGTCCGGCCGGGCGCAGTGG + Intergenic
980010378 4:127588499-127588521 GAAATTCCGGCCGGGCACAGTGG + Intergenic
980418360 4:132522647-132522669 GATATTCCAGCCGGGCGCAGTGG - Intergenic
980434492 4:132750728-132750750 GAGAGATAGGCCGGGCGCAGTGG - Intergenic
981709205 4:147692294-147692316 GAGAATTAGGCCGGGCGCAGTGG + Intergenic
982640279 4:157950207-157950229 GATAATCCGGCCGGGCGCGGTGG + Intergenic
982708450 4:158736261-158736283 GCCAGTCTCGCTGGGCGCAGTGG - Intergenic
983246521 4:165293801-165293823 GAGAATTGGGCCGGGCGCAGTGG - Intronic
985055661 4:186033655-186033677 AAGAGTCGGGCCGGGCGCAGTGG - Intergenic
985800724 5:2004099-2004121 GAGAGTCCAGCCGAGAGCAGAGG - Intergenic
986954370 5:13133096-13133118 GAAAGTGAGGCCGGGCGCAGTGG - Intergenic
987176377 5:15314997-15315019 GAAGGTCCGGCCGGGCGCGGTGG + Intergenic
987296878 5:16561208-16561230 GTACTTCCCGCCGGGCGCAGTGG + Intronic
987447142 5:18034126-18034148 AAGATTCCGGCCGGGCGCGGTGG + Intergenic
989055990 5:37367019-37367041 AAGAGTTCGGCCGGGTGCAGTGG - Intronic
989167076 5:38442976-38442998 TAGAGTCAGGCCAGGCGCAGTGG + Intronic
990496504 5:56353616-56353638 CAAAGGCCGGCCGGGCGCAGTGG + Intergenic
990573697 5:57104540-57104562 AAGAGTTGCGCCGGGCGCGGTGG - Intergenic
991364489 5:65854225-65854247 GACAGAGCAGCCGGGCGCAGTGG + Intronic
991376727 5:65975591-65975613 GACAATCTAGCCGGGCGCAGTGG - Intronic
992250201 5:74868293-74868315 GAGAATCAGGCCTGGCGCAGTGG - Intergenic
993648742 5:90492593-90492615 GAGACATCAGCCGGGCGCAGTGG + Intronic
994632057 5:102298152-102298174 GACTGGCCAGCCGGGCGCAGAGG + Intergenic
995391173 5:111641311-111641333 GACAATCCGGCCGGGCGCGGTGG + Intergenic
996616839 5:125452382-125452404 GAAATTCCGGCCGGGCGCGGTGG + Intergenic
996736148 5:126760426-126760448 GAAAATCGGGCCGGGCGCAGTGG - Intergenic
996737047 5:126767647-126767669 GAGATTCCTGCCGGGCGCGGTGG + Intergenic
996929288 5:128866847-128866869 GAGTTTCCAGCTGGGCGCAGTGG + Intronic
998379524 5:141714219-141714241 GAAAGGCCAGCAGGGCGCAGAGG - Intergenic
999040673 5:148407635-148407657 GAAAAACCGGCCGGGCGCAGTGG + Intronic
999129476 5:149271925-149271947 GAGCGGGCCGCAGGGCGCAGGGG - Exonic
999292415 5:150434975-150434997 GAGAATGCAGCCAGGCGCAGTGG + Intergenic
999404503 5:151294914-151294936 GAGATTTCGGCCGGGTGCAGTGG - Intronic
999529015 5:152441149-152441171 GAGAAGCTGGCCGGGCGCAGTGG - Intergenic
999767801 5:154754807-154754829 GCCAGGCCCGCCGGGCACAGGGG + Intronic
1000618047 5:163451764-163451786 GAGAATCAGGCCAGGCGCAGTGG + Exonic
1000890440 5:166795486-166795508 GGTTGTCCGGCCGGGCGCAGTGG - Intergenic
1001031544 5:168266779-168266801 GAAAGGCGGGCCGGGCGCAGTGG + Intergenic
1001426524 5:171626077-171626099 GAGAGCCCCTCCGGAAGCAGAGG + Intergenic
1001786488 5:174418407-174418429 GGGAGTCCGGCCGGGCACAGTGG + Intergenic
1001989771 5:176106739-176106761 AAGAGTCACACCGGGCACAGTGG + Intronic
1001990080 5:176109286-176109308 AAGAGTCACACCGGGCACAGTGG + Intronic
1001995267 5:176152375-176152397 AAGAGTCCCGCCTGCAGCAGTGG - Intergenic
1002034195 5:176453766-176453788 GAGATACTGGCCGGGCGCAGTGG + Intronic
1002226792 5:177728852-177728874 AAGAGTCACACCGGGCACAGTGG - Intronic
1002227100 5:177731398-177731420 AAGAGTCACACCGGGCACAGTGG - Intronic
1002267045 5:178042374-178042396 AAGAGTCACACCGGGCACAGTGG + Intronic
1002404732 5:179021155-179021177 AAGAATCCCGCCGGGCGCAGTGG - Intergenic
1002428294 5:179188387-179188409 GAGAGTGCAGCCAGGAGCAGGGG + Intronic
1002438817 5:179253354-179253376 GACATCCCGGCCGGGCGCAGTGG + Intronic
1002497527 5:179625206-179625228 GAGAGTCCGGCCAGGTGCGGTGG + Intronic
1002516706 5:179764371-179764393 GAGGGGCCGGCCGGGCGCAGTGG + Intronic
1002715915 5:181227158-181227180 GAGAGTATGGCCAGGCGCAGTGG - Intronic
1002895443 6:1377508-1377530 GACAGACCCGTCGGGCGCGGTGG - Intergenic
1004170513 6:13292267-13292289 CAGAGAGCGGCCGGGCGCAGTGG - Intronic
1004684490 6:17929685-17929707 GAGAGTGCGGCCGGGCGCGGTGG - Intronic
1004688815 6:17974363-17974385 GAGGTTCCCGCCGGGCGCAGTGG - Intronic
1006088460 6:31613836-31613858 CAGAGTCCAGCCAGGTGCAGTGG + Intergenic
1006182440 6:32162505-32162527 GAAAATCTGGCCGGGCGCAGTGG - Intronic
1006489519 6:34375057-34375079 CAGAGTTCGGCCGGGCGCTGTGG + Intronic
1006496546 6:34427396-34427418 GAAAGTGGGGCCGGGCGCAGAGG + Intergenic
1006758493 6:36438707-36438729 GCTAATCCTGCCGGGCGCAGTGG - Intronic
1006954356 6:37854236-37854258 GAAAGGCAAGCCGGGCGCAGTGG - Intronic
1007404667 6:41627650-41627672 GAGAGCCTTGCCGGGCGCGGTGG - Intergenic
1007452320 6:41949514-41949536 GAAATTTCCGCCAGGCGCAGTGG + Intronic
1007580731 6:42958184-42958206 GAGGGCTCCGCCAGGCGCAGTGG - Intergenic
1007799689 6:44381565-44381587 CAGAGCTCGGCCGGGCGCAGTGG - Intergenic
1007900114 6:45403518-45403540 GAAAGTCAGGCCAGGCGCAGTGG - Intronic
1008502352 6:52196400-52196422 CAGAGTCCAGCTGGGCGCACTGG + Intergenic
1008711076 6:54227894-54227916 GAGATCCAGGCCGGGCGCAGTGG + Intronic
1009566541 6:65318152-65318174 GAGCCTCCAGCCGGGCGCGGTGG - Intronic
1009946745 6:70348883-70348905 GAGAATCCCGCCAGGTGCAGTGG + Intergenic
1010195810 6:73239275-73239297 GACAGCTCAGCCGGGCGCAGTGG + Intronic
1011277921 6:85647232-85647254 GATAGTGCCGCCGGGCGCGGTGG - Intergenic
1012707486 6:102550635-102550657 GAAATTCCGGCCGGGCGCGGTGG + Intergenic
1012805736 6:103890785-103890807 GAGGTTCAAGCCGGGCGCAGTGG + Intergenic
1013118900 6:107124081-107124103 GAGATAACAGCCGGGCGCAGTGG - Intergenic
1013161418 6:107548978-107549000 GATAAACCGGCCGGGCGCAGTGG + Intronic
1013857944 6:114597305-114597327 AAGAGTCGCGCAGAGCGCAGTGG - Intergenic
1015016480 6:128419323-128419345 GAGAATGCGGCCGGGCGCGGTGG + Intronic
1015361166 6:132340931-132340953 ATGAGTCTTGCCGGGCGCAGTGG - Intronic
1015621949 6:135140887-135140909 GAGAGGTGTGCCGGGCGCAGTGG + Intergenic
1016028492 6:139313357-139313379 GAAAGACAGGCCGGGCGCAGCGG - Intergenic
1017150890 6:151278952-151278974 GATACTACCGCCGGGCGCGGTGG - Intronic
1017256310 6:152337574-152337596 TAGAGTTTCGCTGGGCGCAGTGG - Intronic
1017304986 6:152906875-152906897 AAGAGGCCGGGCGGGCGCAGTGG - Intergenic
1017802216 6:157907569-157907591 GTGAGGCAGGCCGGGCGCAGTGG - Intronic
1017883532 6:158579432-158579454 GGAAGTTCGGCCGGGCGCAGTGG + Intronic
1018206115 6:161438501-161438523 CAGAATTCAGCCGGGCGCAGTGG - Intronic
1018239352 6:161757548-161757570 GATAGTCAGGCCAGGCGCAGTGG + Intronic
1018381004 6:163258468-163258490 AATATTCTCGCCGGGCGCAGTGG + Intronic
1018661622 6:166092412-166092434 GACAGTCTGGCCGGGCGCGGTGG - Intergenic
1019108928 6:169694020-169694042 AACAGTCATGCCGGGCGCAGTGG + Intronic
1019533671 7:1516478-1516500 GAAAGTTCGGCCGGGCGCGGTGG - Intergenic
1019634630 7:2069002-2069024 GAGAGTCCCACAGGGAGCACCGG + Intronic
1019665723 7:2251433-2251455 TAGAGACCGGCCGGGTGCAGTGG - Intergenic
1019828229 7:3301297-3301319 GAGGGGTCCGCCGGGCGCGGAGG - Intergenic
1020174589 7:5872037-5872059 GCAAGTCCTGCCGGGCGCAGTGG - Intergenic
1020423693 7:8039707-8039729 CAGACTTCAGCCGGGCGCAGTGG + Intronic
1021283194 7:18745831-18745853 GAGAGTCGGGCCGGGCACGGTGG - Intronic
1021443557 7:20708089-20708111 GAGGTTACCGCCGGGCGCGGTGG - Intronic
1021559782 7:21958363-21958385 TTGATTCCGGCCGGGCGCAGTGG + Intergenic
1021710716 7:23413191-23413213 GACATTCCTGCCGGGCGCAGTGG + Intronic
1022238861 7:28489586-28489608 AAGGGTCCGGCCGGGCGCGGTGG - Intronic
1022613307 7:31899427-31899449 GACTGTCCGGCCGGGCGCAGTGG - Intronic
1022661336 7:32370160-32370182 ATGAGTTCTGCCGGGCGCAGTGG + Intergenic
1022671563 7:32460891-32460913 GAGAGTCAGGCCGGGCGCAGTGG + Intergenic
1023953352 7:44865755-44865777 TAGAGTGCAGCTGGGCGCAGTGG - Intergenic
1024322880 7:48087995-48088017 GAAAGTACGGCCAGGCGCAGTGG - Intergenic
1024447775 7:49501506-49501528 GAGAGTGGGGCCAGGCGCAGTGG - Intergenic
1024941430 7:54767359-54767381 GAGAGTTCTACCGGGCACAGGGG - Intergenic
1024982504 7:55169383-55169405 GATATTCCTGCTGGGCGCAGTGG - Intronic
1025020567 7:55476476-55476498 AAGAGTCCGGCAGGCCGCAGAGG + Intronic
1025777946 7:64575280-64575302 GGGAGTCGGGCCGGGCGCGGTGG + Intergenic
1026360408 7:69597962-69597984 GAGGATCCCGCCTGTCGCAGCGG - Intergenic
1026918894 7:74140565-74140587 GAGGAACCGGCCGGGCGCAGTGG + Intergenic
1026966513 7:74443600-74443622 GAGAGTCAGGCTGGGAGCAGCGG + Intergenic
1026968168 7:74453540-74453562 GGGAGAGCAGCCGGGCGCAGGGG - Intergenic
1026980081 7:74521217-74521239 GAGAGGCCCACCAGGCCCAGTGG - Exonic
1027154226 7:75755135-75755157 AAAAGTCTGGCCGGGCGCAGTGG - Intergenic
1027166253 7:75836364-75836386 GAAATACCGGCCGGGCGCAGTGG + Intergenic
1027238559 7:76312611-76312633 GTCACTCCCGCCGGGTGCAGTGG + Intergenic
1027638098 7:80701252-80701274 GACACTACAGCCGGGCGCAGTGG + Intergenic
1027982605 7:85244996-85245018 TAGATTCTGGCCGGGCGCAGTGG - Intergenic
1028744018 7:94307307-94307329 GAGTATCGGGCCGGGCGCAGTGG - Intergenic
1029084168 7:97998316-97998338 GCAAGTCCTGCCGGGCGCGGTGG + Intergenic
1029154055 7:98502565-98502587 CAGAGTCCAGCCAGGTGCAGTGG - Intergenic
1029158322 7:98533130-98533152 GTCAGTCCAGCCGGGTGCAGTGG + Intergenic
1029258775 7:99287243-99287265 GAGAGTCCGGCCGGGCACGGTGG + Intergenic
1030071606 7:105702829-105702851 AAAATTGCCGCCGGGCGCAGTGG + Intronic
1030810797 7:113970137-113970159 GAAAGACAGGCCGGGCGCAGTGG + Intronic
1031919530 7:127590618-127590640 GAGAATGCGGCCGGGCGCAGTGG - Intronic
1033603673 7:142909168-142909190 GAGAGTCACGCCGGGAGATGAGG + Intronic
1033662810 7:143414246-143414268 GGAAGTACGGCCGGGCGCAGTGG - Intergenic
1033755177 7:144392753-144392775 AAGAGTTGGGCCGGGCGCAGTGG + Intergenic
1034356267 7:150452873-150452895 GAGAGGGAGGCCGGGCGCAGTGG - Intronic
1034916920 7:155047767-155047789 GGTAGTCTAGCCGGGCGCAGTGG - Intergenic
1036384240 8:8264500-8264522 GAGAGAGGGGCCGGGCGCAGTGG - Intergenic
1036768510 8:11563817-11563839 GAGCGTCCCGCGGGGCACAGTGG - Intronic
1037127520 8:15369010-15369032 GAAAATCCGGCCGGGCGCGGTGG + Intergenic
1037578682 8:20231643-20231665 AAGAGTCAGGCCGGGCGCGGTGG - Intergenic
1038633470 8:29266910-29266932 GAGAGCCCAGCCAGGCGCGGTGG + Intergenic
1038700323 8:29843562-29843584 TGGAGTCACGCCGGGCACAGTGG - Intergenic
1038858580 8:31360384-31360406 GAGAGTCTGGCCGGGCACAGTGG - Intergenic
1038948243 8:32385310-32385332 GAGAGGCCAGCCAGGCGCGGTGG - Intronic
1039495763 8:37978887-37978909 AAGAGTACTGCTGGGCGCAGTGG + Intergenic
1039582464 8:38678133-38678155 GGGAGTCCGGCCAGGTGCAGTGG + Intergenic
1040573163 8:48627241-48627263 TAAAGTCTGGCCGGGCGCAGTGG - Intergenic
1040941955 8:52843393-52843415 CTGAGTCCGGCCGGGCGCCGTGG - Intergenic
1042271141 8:66956915-66956937 GAGAATCGGGCCGGGGGCAGTGG + Intronic
1042870105 8:73390504-73390526 GAGACCCCGGCCGGGCGCGGTGG + Intergenic
1042958067 8:74272889-74272911 AAGGGTCCGGCCGGGCGCGGTGG - Intronic
1043681079 8:83024856-83024878 GAGATTAAGGCCGGGCGCAGTGG - Intergenic
1044676968 8:94738797-94738819 GATATTACAGCCGGGCGCAGTGG - Intronic
1044682186 8:94792533-94792555 AAGACTTGCGCCGGGCGCAGTGG - Exonic
1045444129 8:102242488-102242510 CATATTCCAGCCGGGCGCAGTGG - Intergenic
1046216639 8:111156335-111156357 AAGATTCCGGCCGGGCGCGGTGG - Intergenic
1046938039 8:119904404-119904426 GAGGTTTACGCCGGGCGCAGTGG - Intronic
1049191938 8:141293165-141293187 GAAAATGCGGCCGGGCGCAGTGG + Intronic
1049512585 8:143037029-143037051 GAGTCTTCAGCCGGGCGCAGTGG + Intergenic
1049626386 8:143624160-143624182 GAGAACTCGGCCGGGCGCAGTGG - Intergenic
1049729468 8:144168513-144168535 GACAGTCCAGCCAGGAGCAGTGG + Intronic
1049974740 9:850739-850761 GTGAGGCCAGCCAGGCGCAGTGG + Intronic
1052593758 9:30532159-30532181 GAGAGTCAGGCCGGGTGCGGTGG + Intergenic
1052709578 9:32037127-32037149 AAGAGACAGGCCGGGCGCAGTGG + Intergenic
1053035320 9:34822907-34822929 GATTGTCCGGCCGGGCGCGGTGG + Intergenic
1053133017 9:35629162-35629184 GAGATGCCTGCCGGGCGCAGTGG - Intronic
1053513925 9:38713189-38713211 TAGATTTCGGCCGGGCGCAGTGG + Intergenic
1053928316 9:43089658-43089680 GAGACTCCCGCCAGCCGCTGGGG - Intergenic
1054285391 9:63163633-63163655 GAGACTCCCACCGGCCGCTGGGG + Intergenic
1054389429 9:64601390-64601412 GAGACTCCCGCCGGCCGCTGGGG - Intergenic
1054835794 9:69673109-69673131 CCGAGTCCCGCCGGGGACAGCGG + Intergenic
1055135181 9:72821204-72821226 GAGATCCCGGCTGGGCGCAGTGG + Intronic
1056420715 9:86423818-86423840 GAGGATCTCGCCGGGCACAGTGG - Intergenic
1056571989 9:87824674-87824696 GAGAGTCCTGCTGGGCCCGGCGG + Intergenic
1057041473 9:91851063-91851085 TAGATTCCGGCCGGGCGCGGTGG + Intronic
1057237307 9:93372076-93372098 GAGAGTTGGGCTGGGCGCAGTGG + Intergenic
1057356018 9:94332280-94332302 GAGAGTCTGACCGGGCGCGGTGG - Intergenic
1057373184 9:94492762-94492784 GCGATTCAGGCCGGGCGCAGTGG + Intergenic
1057436508 9:95045341-95045363 CGGAGGCCCGCCGGGTGCAGGGG - Intronic
1057622088 9:96645194-96645216 AAGAATCCAGCCGGGCGCGGTGG - Intronic
1057651735 9:96925348-96925370 GAGAGTCTGACCGGGCGCGGTGG + Intronic
1058705431 9:107634202-107634224 AAGAATCTGGCCGGGCGCAGTGG + Intergenic
1058878617 9:109266678-109266700 GAAATTCAGGCCGGGCGCAGTGG + Intronic
1059137859 9:111824246-111824268 AAAAGACCGGCCGGGCGCAGGGG + Intergenic
1059256055 9:112931912-112931934 CAGAGGCCAGCCGGGCGCAGTGG - Intergenic
1059353109 9:113679564-113679586 AATAGTCTGGCCGGGCGCAGTGG + Intergenic
1060182473 9:121543953-121543975 GAGAGACTGGCCGGGCACAGTGG - Intergenic
1060345706 9:122813970-122813992 AATAGTTCCGCCAGGCGCAGTGG + Intronic
1060359739 9:122943354-122943376 GAAAGTGTGGCCGGGCGCAGTGG - Intronic
1060363602 9:122985325-122985347 GACAGTTAGGCCGGGCGCAGTGG + Intronic
1061009602 9:127947118-127947140 GAGTGCCCAGCCGGGCGCGGTGG + Intronic
1061242760 9:129383899-129383921 GGGCGTCCCGCCGGGCGTCGCGG + Intergenic
1061534811 9:131240924-131240946 GTGAGGCCTGCCGGGCACAGTGG + Intergenic
1061660986 9:132130159-132130181 GAGAGTGGGGCCGGGCACAGTGG + Intergenic
1061986664 9:134134288-134134310 GAAAATCCGGCCGGGCGCGGCGG - Intergenic
1062136976 9:134934311-134934333 GCGAATTCCGCCAGGCGCAGCGG + Intergenic
1062374778 9:136257085-136257107 CAGAGGCCGGCTGGGCGCAGTGG + Intergenic
1062657188 9:137610098-137610120 GAAAACCCGGCCGGGCGCAGTGG - Intronic
1185445380 X:255113-255135 GAGAGTCCCTCCTGGGGCCGCGG + Intergenic
1185453020 X:292898-292920 GAAATTCTGGCCGGGCGCAGTGG - Intronic
1185539137 X:888235-888257 CTGATTCCGGCCGGGCGCAGTGG - Intergenic
1185568363 X:1113992-1114014 GAAGGACCAGCCGGGCGCAGTGG + Intergenic
1185569357 X:1121394-1121416 GAGACTCTCGCTGGGCGCACTGG - Intergenic
1185719031 X:2367150-2367172 GAGATGCTAGCCGGGCGCAGTGG + Intronic
1185725728 X:2420119-2420141 GAGAATGAGGCCGGGCGCAGTGG + Intronic
1185730313 X:2456324-2456346 AAGGGTGCGGCCGGGCGCAGTGG + Intronic
1185810148 X:3100880-3100902 GAGAGTCAGGCCGGGCGCGGTGG - Intronic
1186403139 X:9278032-9278054 CAAAGTCCCGCCAGGCCCAGTGG + Intergenic
1187913021 X:24128134-24128156 CAGAGTCTCGCCGGGCGGGGTGG + Intergenic
1188492265 X:30750043-30750065 GAGTCTCCCGCCGGGTGCAGTGG + Intergenic
1188609780 X:32081565-32081587 TAGAGTCTGGCCGGGCGTAGTGG + Intronic
1188829500 X:34878916-34878938 GAAAGTCAGGCTGGGCGCAGTGG - Intergenic
1188912244 X:35864408-35864430 GAGTTTCCAGCCGGGCGCGGTGG + Intergenic
1189398728 X:40646231-40646253 GAAAGGACGGCCGGGCGCAGTGG - Intronic
1189803954 X:44717132-44717154 GAAAGAACCGCCGGGCGCGGTGG - Intergenic
1189807072 X:44746053-44746075 GAGGTAACCGCCGGGCGCAGTGG - Intergenic
1190019196 X:46857272-46857294 CAGATTCCAGCCGGGCGCAGTGG + Intronic
1190827789 X:54033425-54033447 GAAAGTGTCGCCGGGCACAGTGG + Intronic
1192093187 X:68182621-68182643 GAGGGTCTGGCCGGGCGCAGTGG + Intronic
1192125455 X:68497600-68497622 GACAGGCCGGCCGGGCGCGGTGG - Intergenic
1193133985 X:77949175-77949197 GAGAATAAGGCCGGGCGCAGTGG - Intronic
1194167661 X:90540021-90540043 TAGAGCCTGGCCGGGCGCAGTGG + Intergenic
1194655632 X:96569993-96570015 TAAAGTGCGGCCGGGCGCAGTGG + Intergenic
1194683548 X:96883665-96883687 GAGCATCAGGCCGGGCGCAGTGG - Intronic
1195257756 X:103105674-103105696 GGGATCCCAGCCGGGCGCAGTGG + Intergenic
1195467477 X:105195992-105196014 GTGACTCGGGCCGGGCGCAGTGG + Intronic
1196204189 X:112920225-112920247 AAAAATCCGGCCGGGCGCAGTGG - Intergenic
1196758454 X:119178306-119178328 GAGATTCAGGCCGGGCGCGGTGG - Intergenic
1197212660 X:123841049-123841071 GAGTTTCAGGCCGGGCGCAGTGG + Intergenic
1198973969 X:142314389-142314411 CAGAATCCAGTCGGGCGCAGTGG + Intergenic
1199943638 X:152648646-152648668 AAGAATCCGGCCGGGCGCGGTGG - Intronic
1200168334 X:154052745-154052767 GAGTGGCTGGCCGGGCGCAGTGG - Intronic
1200418188 Y:2935199-2935221 GAGAGGCCCACCGGGCGGAGGGG + Intronic
1201147159 Y:11071435-11071457 AAGAGTTCAGCCAGGCGCAGTGG + Intergenic
1201769864 Y:17609584-17609606 GGGAGTCCAGCCAGGTGCAGAGG - Intergenic
1201831690 Y:18296403-18296425 GGGAGTCCAGCCAGGTGCAGAGG + Intergenic