ID: 1162106696

View in Genome Browser
Species Human (GRCh38)
Location 19:8374063-8374085
Sequence TGCGTTGCCTCCTGAGATCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162106686_1162106696 20 Left 1162106686 19:8374020-8374042 CCACGACTGGAGAAGCCCCCTTT 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1162106696 19:8374063-8374085 TGCGTTGCCTCCTGAGATCGAGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162106691_1162106696 5 Left 1162106691 19:8374035-8374057 CCCCCTTTCTGAGTGCAGGGGGG 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1162106696 19:8374063-8374085 TGCGTTGCCTCCTGAGATCGAGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162106695_1162106696 2 Left 1162106695 19:8374038-8374060 CCTTTCTGAGTGCAGGGGGGCTG 0: 1
1: 0
2: 2
3: 13
4: 189
Right 1162106696 19:8374063-8374085 TGCGTTGCCTCCTGAGATCGAGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162106693_1162106696 4 Left 1162106693 19:8374036-8374058 CCCCTTTCTGAGTGCAGGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 1162106696 19:8374063-8374085 TGCGTTGCCTCCTGAGATCGAGG 0: 1
1: 0
2: 0
3: 1
4: 56
1162106694_1162106696 3 Left 1162106694 19:8374037-8374059 CCCTTTCTGAGTGCAGGGGGGCT 0: 1
1: 0
2: 0
3: 10
4: 142
Right 1162106696 19:8374063-8374085 TGCGTTGCCTCCTGAGATCGAGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162106696 Original CRISPR TGCGTTGCCTCCTGAGATCG AGG Exonic
900626778 1:3611938-3611960 AGGGCTGTCTCCTGAGATCGAGG - Intergenic
902811527 1:18890631-18890653 TGAGTTGCCTCCTGTGAACGTGG + Intronic
903382843 1:22908911-22908933 TGAGGTGCCTCATGAGATTGGGG + Intronic
904013845 1:27405688-27405710 TGCGAAGCCTCCTCAGCTCGGGG - Exonic
913527981 1:119712269-119712291 TCCGGGGCCTCCTGAGATTGGGG + Intronic
920710901 1:208294014-208294036 TGCTTTGCCTCTTGGGATGGAGG - Intergenic
924853976 1:247857609-247857631 TGCGGTGCGTCCTGTGCTCGGGG - Exonic
1066633796 10:37481323-37481345 AGCTTTGACTCCTGAGATCAAGG - Intergenic
1070626962 10:78058093-78058115 TGCCTTGCCTCCTGAGTTGCTGG + Intergenic
1092477180 12:8829233-8829255 TGCTCTGCCTCCTGAGCTCCAGG + Intronic
1092884985 12:12917041-12917063 TGTGTTGACTGCTGAGATCCAGG + Exonic
1096918350 12:55057578-55057600 TGCCTGACCTCCTGAGATGGTGG - Intergenic
1098481578 12:70968019-70968041 TGTGTTGCCACCTGACATGGTGG + Intergenic
1107420846 13:40244962-40244984 TGCCCTGACTCCTGTGATCGGGG - Intergenic
1108848075 13:54699112-54699134 TGTGTTGACTCCTGACATGGTGG + Intergenic
1113878646 13:113609822-113609844 TGCGTGGCCTCCTGGGACCCTGG + Intronic
1120906835 14:89628135-89628157 GGCTTTGCCTCCAGAGATTGGGG - Intergenic
1127913404 15:63436671-63436693 TGCAATGCCTCCTGGGATGGTGG - Intergenic
1130046043 15:80445682-80445704 TGCACTCCCTCCTGAGATCCGGG + Intronic
1142919084 17:3168735-3168757 TGCTTTGTCTCCAGAGATGGGGG - Intergenic
1143094746 17:4472532-4472554 TGCATTCCCTTCTGAGATGGGGG + Intronic
1155218099 18:23661268-23661290 AGACTTGCCTCCTGGGATCGAGG + Intronic
1158450211 18:57557466-57557488 TGCCTTGCCTCCTCTGACCGTGG - Intronic
1162106696 19:8374063-8374085 TGCGTTGCCTCCTGAGATCGAGG + Exonic
1167130307 19:47581155-47581177 TTGGTGGCCTCCTGAGAGCGGGG + Intergenic
927651110 2:24914216-24914238 TGTGTTGCCTCTTGGGATGGGGG + Intronic
929310344 2:40417002-40417024 TACTTTGCCTCCTGAGAGAGAGG - Intronic
929682727 2:44007645-44007667 ACCTTTGCCTCCTGAGTTCGAGG - Intergenic
931827980 2:66021051-66021073 TGTGTTTCCTCCTGGGATTGTGG + Intergenic
931881913 2:66577347-66577369 CGCGCTGCCTCCTGACATCCCGG + Intergenic
937046016 2:118852324-118852346 TCCGTTGACTCCTGAAATTGGGG + Intergenic
941313661 2:163965756-163965778 TGAGTTGCTTCCTGTTATCGAGG - Intergenic
948244680 2:236470069-236470091 TGTGATGCCTCCTGAGTTTGCGG + Intronic
1169652848 20:7888845-7888867 TGCAAGGCCTCCTGAGATCTAGG - Intronic
1171010733 20:21508052-21508074 TGAGTTGCCTCCTGAGCCCCAGG + Intergenic
1178098191 21:29237728-29237750 TGTGTGGACTCCTGAGATGGAGG + Intronic
1180702755 22:17790639-17790661 TGCCAGGCCTCCTCAGATCGCGG + Exonic
968967595 4:3776964-3776986 TGCGGTGCCTCCAGAGATGTGGG + Intergenic
970625491 4:17873988-17874010 TGTTTTGCCACCTGAGATCAGGG - Intronic
970634153 4:17988868-17988890 TGCCTTGCCTCCTGAGAAGCTGG - Intronic
980526901 4:134000943-134000965 AGTGTTGCCTCCTGAGATTATGG - Intergenic
990829604 5:59941790-59941812 TGCCTGGCCTCCTGAGGTGGGGG - Intronic
997476051 5:134143164-134143186 TGCGTTCCTTACTGAGATTGTGG - Intronic
1006885117 6:37375245-37375267 AGAGTTGCCTCCTGGGATGGGGG - Intronic
1007164844 6:39821952-39821974 TGCGTTGTCTCCTTGGATTGAGG + Intronic
1007474188 6:42107876-42107898 TCCCTTGCCCCCTGAGATGGGGG + Intronic
1008583988 6:52932596-52932618 TGGGTTGCCTCCACAGACCGTGG + Intergenic
1014689481 6:124545115-124545137 TGAATTGCCTCCAGAGATCTGGG + Intronic
1028965419 7:96796519-96796541 TGCGTGGCCTGGTGGGATCGAGG - Intergenic
1033038807 7:137899635-137899657 TCCCTTGCCTCATGAGATCAAGG + Intronic
1040551576 8:48441993-48442015 TGCCTTGCCTCCTGGAATGGGGG + Intergenic
1047377928 8:124321424-124321446 TGAGTTGCTTCCTGAGCTTGGGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1059387534 9:113976431-113976453 TGGGTTGCCTTCTCAGATCAAGG - Intronic
1185720340 X:2376123-2376145 TGCGTTTCCTCCTGAGTCAGAGG - Intronic
1190137085 X:47807255-47807277 TGCGAAGCCTCCTCAGCTCGGGG + Intergenic
1196883539 X:120222328-120222350 TTCCATGCCTCCTGAGATAGTGG - Intergenic
1199226233 X:145377945-145377967 TGCCTTGCCTCCTCATATCATGG - Intergenic