ID: 1162106743

View in Genome Browser
Species Human (GRCh38)
Location 19:8374289-8374311
Sequence GGTCCCCTGGGGACACAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162106738_1162106743 5 Left 1162106738 19:8374261-8374283 CCTCATGGTGCTGGTGCTGTTGT 0: 1
1: 0
2: 3
3: 39
4: 317
Right 1162106743 19:8374289-8374311 GGTCCCCTGGGGACACAAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 182
1162106737_1162106743 6 Left 1162106737 19:8374260-8374282 CCCTCATGGTGCTGGTGCTGTTG 0: 1
1: 0
2: 5
3: 44
4: 338
Right 1162106743 19:8374289-8374311 GGTCCCCTGGGGACACAAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162106743 Original CRISPR GGTCCCCTGGGGACACAAGC AGG Exonic
900130220 1:1084218-1084240 GGTCTCCTGGGGACCCGGGCAGG + Intronic
900371861 1:2335789-2335811 GGTCCCCAGGGCACATCAGCGGG + Intronic
900419680 1:2550477-2550499 GGTCCCCTGGGGCCCCATGCTGG + Intergenic
900425543 1:2576794-2576816 GGTCCCCTGGGGCCCCATGCTGG - Intergenic
900577257 1:3389486-3389508 GGTCCCCTGGGGCCAGGAGGGGG - Intronic
900614950 1:3561289-3561311 AGCCCCCTGGGGACCCAAGCTGG + Intronic
902985461 1:20151837-20151859 GCTTCCCTGGGGACATCAGCCGG + Intergenic
903032831 1:20476102-20476124 GGTTCCCAGAGGACCCAAGCAGG + Intergenic
903685919 1:25131923-25131945 GGGCTCCTGGGGAAGCAAGCAGG + Intergenic
906089833 1:43169535-43169557 AGTACCCTGGGGTCTCAAGCTGG - Intronic
906961634 1:50422695-50422717 GGTCCCCTGGGACCCCAAGACGG - Intronic
907238961 1:53070113-53070135 GGTCCCCCGGGAACTCACGCAGG - Exonic
912230152 1:107783671-107783693 GGTCCTATGGGGACACAAAGGGG - Intronic
912864791 1:113247505-113247527 GGTGCCCTGGGGACAGGAGCTGG + Intergenic
913253337 1:116930810-116930832 GGGCCACGGGGGACACAGGCAGG - Intronic
915021760 1:152786313-152786335 TGTCCTCTGGGAACAGAAGCAGG + Intronic
915972285 1:160363243-160363265 GGAGCCCTGGGGACCCAACCAGG - Intergenic
919572429 1:199265580-199265602 GGCCCCACGGGTACACAAGCAGG + Intergenic
919737094 1:200959504-200959526 GGCCCCCTGGAGCCACAGGCAGG - Intergenic
919920051 1:202162127-202162149 GGGGCCCTGGGGACACAGGAGGG + Intergenic
920047515 1:203142969-203142991 GGTCCCCTGGGGCCATAACTGGG + Intronic
924941896 1:248817906-248817928 GGTACCCTGGGCAGACAAGTTGG + Intronic
1067535473 10:47106633-47106655 TAACCCCTGGGGACAGAAGCAGG - Intergenic
1071355003 10:84784966-84784988 GGTGCTCTGGGGTCCCAAGCTGG + Intergenic
1072016169 10:91348960-91348982 GGTCCCCTGAGGGCAAAATCAGG - Intergenic
1073791986 10:106949746-106949768 GATCCACATGGGACACAAGCAGG - Intronic
1075451103 10:122552571-122552593 AGGCCCCTGGGCACAGAAGCTGG - Intergenic
1075655934 10:124161406-124161428 AGTCCTCTGTGGCCACAAGCAGG - Intergenic
1075725400 10:124608284-124608306 CTTCCCCTGGGCACACAGGCTGG - Intronic
1076728384 10:132424382-132424404 GATGCCCTGGGGACACAAACAGG - Intergenic
1076758579 10:132588614-132588636 GGCCTCCTGGGGACACAGGGTGG - Intronic
1077541353 11:3147951-3147973 GGACCTCTGGGGCCACTAGCTGG + Intronic
1081329353 11:41785244-41785266 AATTCTCTGGGGACACAAGCTGG - Intergenic
1083378231 11:62243603-62243625 GGTCACCTGGGGCCACAGGGTGG + Intronic
1083572302 11:63767235-63767257 GGTCTCCTGGGCACACAGGCAGG + Intronic
1083757948 11:64801553-64801575 AGTACCCTGGGGACACCATCAGG - Intronic
1084032715 11:66490520-66490542 AGTCCCATGGGGAGACAAGAGGG - Intronic
1084509968 11:69597301-69597323 CGTCCCCTGGGGACAGAGGATGG - Intergenic
1085465830 11:76722590-76722612 TGTACTCTGGGGACACAGGCAGG - Intergenic
1085783106 11:79427080-79427102 GGTACCCTGGTGACACAAAATGG + Intronic
1087095484 11:94313684-94313706 TGTCCCCTGGGGATGCAAGAAGG - Intergenic
1089073100 11:115716392-115716414 GGTCCTCTGGGGACAGACCCTGG + Intergenic
1089672734 11:120067680-120067702 GCTCCCCTGGGGTGACAAGATGG + Intergenic
1089711376 11:120317241-120317263 GTTCCCCTGGGAACAACAGCAGG + Exonic
1090226379 11:125074553-125074575 GAACACCTGGGGCCACAAGCAGG + Intronic
1092957233 12:13562065-13562087 GGTGCCTTGGGGACAAGAGCAGG - Exonic
1095243024 12:39883336-39883358 GGGCACCTGGGAACACAAACTGG - Intronic
1096519666 12:52177517-52177539 TCTCCCCTGGGGGCACAGGCTGG - Intronic
1102588518 12:113940206-113940228 GGTCCCCAGCTGACACCAGCAGG + Intronic
1103261463 12:119593028-119593050 GGACCCCTGGGGAGAAATGCAGG - Intergenic
1104214279 12:126720793-126720815 TGTCCCCTGGGAACACCGGCTGG - Intergenic
1104569387 12:129911616-129911638 GGTCCACTGATGCCACAAGCAGG - Intergenic
1104731326 12:131107081-131107103 AGTCCCCTAGGGCCACCAGCTGG - Intronic
1105224497 13:18417601-18417623 AGCCCCCTGGGGACACTATCAGG - Intronic
1105706618 13:22971347-22971369 GATCCCCCAGGGACTCAAGCAGG + Intergenic
1106077676 13:26475378-26475400 GGCCCCCTGGGGAAGCAAGGGGG + Intergenic
1106176008 13:27332366-27332388 GGCCCACTGGAGACACCAGCAGG + Intergenic
1108855311 13:54786249-54786271 GGTTCCCTGGGAGCCCAAGCAGG - Intergenic
1113772299 13:112917902-112917924 GTTCACCTGGGGACGCAAGCCGG - Intronic
1114008597 14:18342116-18342138 AGCCCCCTGGGGACACTATCAGG - Intergenic
1116856010 14:49952988-49953010 GGTCCACTTGGGAAACATGCTGG - Intergenic
1117789370 14:59323147-59323169 GGTTCCCGGGGGCCACAAGAAGG + Exonic
1122414143 14:101540777-101540799 GGGCCTCTGGGGCCACAGGCTGG + Intergenic
1122571181 14:102703210-102703232 GGTACCCTAGGGACACAATCGGG + Intronic
1123036170 14:105472862-105472884 GGTGCCCTGGAGACACACGGAGG - Intergenic
1123391805 15:19882688-19882710 AGCCCCCTGGGGACACTATCAGG - Intergenic
1123436332 15:20257223-20257245 GGTCCCCTGGTGCCACCAGGCGG + Intergenic
1126494728 15:49277858-49277880 GGGCCGCTGGGGAAACCAGCTGG + Intronic
1128995268 15:72290250-72290272 GGTCCTCTGGGGACAAAGCCAGG + Exonic
1130350148 15:83084319-83084341 GCTCCCCTGGGGCCACATTCTGG - Intergenic
1133232368 16:4372703-4372725 GGTCCCCTGTGGTCACTGGCAGG + Intronic
1133941949 16:10316760-10316782 GGTCCCATGGGAAGCCAAGCTGG + Intergenic
1135991053 16:27219043-27219065 GGTTCCCTGGGGACCAAACCAGG - Exonic
1139965775 16:70744574-70744596 GATCACCTGGGGAGAGAAGCGGG + Exonic
1141675919 16:85517262-85517284 GGTTACCTGAGGACACACGCAGG + Intergenic
1142376499 16:89709475-89709497 CTTGCCCTGGGGACAGAAGCAGG + Intronic
1143094930 17:4473745-4473767 GCTCCCCTGTGGACACCAGATGG - Intronic
1143183763 17:4998781-4998803 GGTCCACTGGGGCCACAGGAGGG + Intronic
1143447648 17:7018628-7018650 GGGCCCCTGAGGACCCGAGCCGG + Intergenic
1143925008 17:10361845-10361867 GGTTCCCTGGGGACAAAGGTAGG + Intronic
1145939892 17:28737812-28737834 GGTCCCCGGGGGATACCTGCAGG - Exonic
1145944314 17:28761488-28761510 GGCCACCTGAGGCCACAAGCTGG - Intronic
1147741824 17:42674404-42674426 GGGACCCTGGGGAGACAGGCGGG + Exonic
1148063230 17:44850772-44850794 GCTTCCCTGGGGACCCAGGCAGG + Exonic
1150268640 17:63848183-63848205 GGTACCATGGGGAAACAAGGAGG + Intergenic
1150666895 17:67148232-67148254 GTTCCGCAGGGGACACCAGCTGG - Intronic
1151485025 17:74393695-74393717 GGTTCCCTTGGGACACAGTCAGG + Intergenic
1152028914 17:77829920-77829942 GCACAGCTGGGGACACAAGCAGG + Intergenic
1155691174 18:28624931-28624953 GGTCGCCTCGGGACAGGAGCAGG + Intergenic
1160497583 18:79384232-79384254 GGCACCCTGGGGACCCCAGCGGG + Intergenic
1161107783 19:2453224-2453246 AGTCCCCTGGGGGCAGAAGCTGG + Intronic
1161293689 19:3508762-3508784 TGTCCCCTGGGGACAGAATTGGG - Intronic
1161698017 19:5781063-5781085 TGACCCGTGGGGACACAGGCTGG - Intergenic
1162106743 19:8374289-8374311 GGTCCCCTGGGGACACAAGCAGG + Exonic
1163103476 19:15110504-15110526 GGCACCCTGAGGACACAAGGGGG - Exonic
1163637790 19:18445463-18445485 GGTCCCCTGGAGGCAATAGCAGG + Intronic
1165411513 19:35665333-35665355 CGGCCCCTGGGGACACGCGCTGG + Intergenic
1166661076 19:44647684-44647706 GATCCCCTGGGGACAAAAGGAGG + Intronic
1167037037 19:47000763-47000785 AGTCCACTGGGGACAGAGGCAGG + Exonic
1167419421 19:49394459-49394481 GGTACACTGGGGAGACAAGAGGG - Exonic
1168129352 19:54307609-54307631 GGTGCCCTGGGGAGACATCCAGG - Intronic
927256618 2:21045086-21045108 GGTGCCTTGGGGACACAGCCAGG - Intergenic
927331182 2:21866193-21866215 GGGCCACTGGGCACTCAAGCAGG - Intergenic
928470109 2:31567593-31567615 GGTTTCCTGAGGACACAAGAGGG - Intronic
930770784 2:55128510-55128532 TGTCCCCAGGGGACAGAATCTGG - Intergenic
934979492 2:98828188-98828210 GCTCCCCTGCAGACACAAGTTGG + Intronic
938147477 2:128848821-128848843 GGTCTTCAGTGGACACAAGCTGG - Intergenic
941494923 2:166188064-166188086 GGTCCCAAGGAGACAGAAGCAGG + Intergenic
941867972 2:170354493-170354515 GGTCCCCTGGGGAAACAGAATGG + Intronic
946225421 2:218261771-218261793 GCTCCCCTGTTGACAGAAGCAGG + Intronic
947374718 2:229483928-229483950 GGTGCCCTGGGGATACAACAGGG - Intronic
947734605 2:232448164-232448186 TGTGCTCTGGGGACAGAAGCAGG + Intergenic
947746672 2:232511536-232511558 AGGCCCCTGGGGACTCAGGCTGG - Intergenic
948711995 2:239830998-239831020 GGTCCCCTGCCTTCACAAGCAGG + Intergenic
948889065 2:240898010-240898032 GGTCCCTTGGGGCAACCAGCTGG - Intergenic
1169080705 20:2796438-2796460 GCTCCCCTGGGGACACATGGGGG + Exonic
1169211876 20:3770338-3770360 GGCCCCCTGGAGACAGAGGCAGG + Intergenic
1169346149 20:4829456-4829478 GGTCCCCTGGACACACAGGAGGG + Intergenic
1172129185 20:32644563-32644585 AGTCCCCTGGGGGCACCTGCAGG + Intergenic
1174292050 20:49516188-49516210 GGTTACCTTGGGACAGAAGCTGG + Intronic
1176020097 20:62958463-62958485 GGTCCCCTGGAGAAACAGCCAGG + Intronic
1176768540 21:13046658-13046680 AGCCCCCTGGGGACACTATCAGG - Intergenic
1180022439 21:45136776-45136798 TGGCCCCTGTGGACACCAGCTGG - Intronic
1180433102 22:15272933-15272955 AGCCCCCTGGGGACACTATCAGG - Intergenic
1180515673 22:16140839-16140861 AGCCCCCTGGGGACACTATCAGG - Intergenic
1180785844 22:18547240-18547262 GGTTACCTGGGGGAACAAGCTGG + Intergenic
1181131128 22:20732965-20732987 GGTTACCTGGGGGAACAAGCTGG + Exonic
1181242769 22:21486794-21486816 GGTTACCTGGGGGAACAAGCTGG + Intergenic
1181460964 22:23085744-23085766 TGCCTCCTGGGGACACAAGTGGG - Intronic
1181568277 22:23752546-23752568 GGCCCCCTGGGGGCTCAAACTGG - Intergenic
1181931853 22:26408268-26408290 GGTCCCCTGGGGTCCCCAGAGGG - Intergenic
1182074958 22:27489064-27489086 GGTCGCCTGGGGATAGGAGCAGG + Intergenic
1182476414 22:30578993-30579015 GGGCTTCTGGGGACACAAGGAGG + Exonic
1182779083 22:32853003-32853025 GGTCCCATGGGGAGACCCGCTGG + Intronic
1183608253 22:38879660-38879682 GGACCCCTGGGGATCCGAGCAGG + Intergenic
1183667101 22:39252449-39252471 GGTCCCCTGGTGCCCCAAGGGGG - Intergenic
1185000585 22:48243065-48243087 GGTCCCCTGGGGTCTCTGGCTGG - Intergenic
951168110 3:19506809-19506831 GCTGCACTGGGGACCCAAGCTGG + Intronic
954453099 3:50582260-50582282 GGGCAGCTGGGGCCACAAGCAGG + Exonic
954794813 3:53156087-53156109 TGTCCCTTGAGGACACAATCGGG - Intronic
954940668 3:54369479-54369501 GGTCCAGTGGGGACAGCAGCTGG - Intronic
955637071 3:61041970-61041992 AGTCACCTGGCCACACAAGCGGG - Intronic
962909793 3:139837449-139837471 CATCCCCTGAGGAGACAAGCAGG - Intergenic
965533342 3:169798835-169798857 GGTGCCATGGGGACATAAGGAGG - Intronic
966938358 3:184729405-184729427 GGTCCACTGGGGACACTGACTGG + Intergenic
969326095 4:6444814-6444836 TGTCCACTGGACACACAAGCAGG + Intronic
969454256 4:7292120-7292142 GATCTCCTGGGGAGAAAAGCTGG + Intronic
970569387 4:17364889-17364911 GGTCCCCTCAGGGCAGAAGCAGG + Intergenic
985550531 5:531314-531336 TGTCTGCTGGGGACACACGCCGG - Intergenic
986357519 5:6943252-6943274 GGTCCTCTGGGAACAGAGGCAGG - Intergenic
986758531 5:10859233-10859255 GGTCCTCTGGGGACACCTGGTGG + Intergenic
987304506 5:16624976-16624998 GGTCCCCTGGGGAGAGGAGAGGG - Intergenic
988855960 5:35228687-35228709 GGTCCCCTGGAGTCAGAGGCTGG + Intronic
989172293 5:38484194-38484216 GGTACCCTGAGGAGACCAGCAGG - Intronic
992204873 5:74421514-74421536 GGTCCCCTGGAGCCCTAAGCTGG + Intergenic
992911787 5:81402169-81402191 AGTGCCCTGGGGACACAAGGTGG + Intergenic
997606355 5:135178005-135178027 GGCCCCATGGGGACACACACAGG - Intronic
1002530350 5:179840871-179840893 GGTCGCCTGGGGACCCCAGAAGG - Exonic
1003668228 6:8131445-8131467 GGTCCCATAGTGACACCAGCTGG - Intergenic
1003901379 6:10658947-10658969 GGTCTCCTGTGGTCACAAGATGG + Intergenic
1006592792 6:35170434-35170456 GGTCCCCTGGGGCCCCCAGCAGG - Intergenic
1006925894 6:37654964-37654986 GGATCCCTGGAGACTCAAGCAGG - Intronic
1007791433 6:44311156-44311178 GGCACCCTGGGGAGAAAAGCAGG + Exonic
1011697811 6:89929018-89929040 GGTTGCCTGGATACACAAGCAGG + Exonic
1018429114 6:163709641-163709663 GGTGTCCTGGGGAGACCAGCAGG + Intergenic
1019121930 6:169810898-169810920 TGCCCCCTGGGAACAAAAGCAGG + Intergenic
1019329365 7:455122-455144 GGTGCCCTGGGGACCCAGGAGGG + Intergenic
1019492551 7:1322056-1322078 GCTCCCCTCGGGACACAAGTGGG - Intergenic
1019512065 7:1422646-1422668 GGGGCCCTGGGGACACCGGCGGG - Intergenic
1020255058 7:6498259-6498281 GAGACCCTGGGGGCACAAGCGGG - Intronic
1024239682 7:47424686-47424708 GGCACCCTCGGGACACAAGTGGG + Intronic
1028077411 7:86533763-86533785 GCTGCCCTGTGGACCCAAGCTGG + Intergenic
1034748318 7:153544134-153544156 GCACCCCTGAGGACACCAGCAGG - Intergenic
1035039822 7:155919625-155919647 TGGCCACTGGGGACACAGGCAGG - Intergenic
1035609426 8:950027-950049 GGTCCCCTGGAGAAGCAAGACGG - Intergenic
1037734060 8:21552986-21553008 GTCCTCCTGGGGACACAAGGAGG + Intergenic
1039454539 8:37698143-37698165 GGTGCCCGGGGTACACCAGCGGG - Exonic
1039678323 8:39698470-39698492 GGTCTCCAGTGGACACTAGCTGG - Intronic
1040530692 8:48264180-48264202 GTCCCCCTGTGGACACAAACAGG + Intergenic
1046957313 8:120074963-120074985 TGCCCCCTGGGGACAAAATCAGG - Intronic
1047572177 8:126110913-126110935 GTTCACCAGAGGACACAAGCTGG - Intergenic
1047759425 8:127943128-127943150 TGTCCTCTGGGGACAGAAGGAGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1048623369 8:136159039-136159061 GGTACACTGGGGCCAGAAGCCGG - Intergenic
1052876750 9:33573673-33573695 TGACCCCTGGGCACACATGCAGG + Intergenic
1053250984 9:36573726-36573748 GATCACCTGAGGACACGAGCTGG - Intronic
1053426516 9:38013807-38013829 GGTCCCATGGAGCCACAGGCAGG - Intronic
1053499252 9:38570714-38570736 TGACCCCTGGGCACACATGCAGG - Intronic
1060155717 9:121318601-121318623 GCTCCCCTGGGGACCCCTGCTGG + Intronic
1060176281 9:121499603-121499625 GGTCCCCGGAGGCCACGAGCAGG - Intergenic
1061218907 9:129237536-129237558 GGACCCCTGAGGACGCAGGCAGG + Intergenic
1061304162 9:129722953-129722975 TGTCCCCTTGGGACTCAAGATGG - Intergenic
1062034690 9:134377795-134377817 GGCTTCCTGGGGACAGAAGCTGG - Intronic
1186618688 X:11215179-11215201 GGTCCCCTGGGCATCCAGGCGGG + Intronic
1186757766 X:12690842-12690864 TGTTCCCTGGGGAGACAAGCAGG + Intronic
1200922716 Y:8627469-8627491 GGACCCCTGGGAACACAGACAGG - Intergenic
1201770782 Y:17615077-17615099 AGTCCCCTGTGGCCACAAGATGG - Intergenic
1201830773 Y:18290909-18290931 AGTCCCCTGTGGCCACAAGATGG + Intergenic