ID: 1162112109

View in Genome Browser
Species Human (GRCh38)
Location 19:8404863-8404885
Sequence CACCGGAGGAGGGCCCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162112097_1162112109 21 Left 1162112097 19:8404819-8404841 CCCAGTGGATGTTGGTGATGCCA 0: 1
1: 0
2: 1
3: 23
4: 166
Right 1162112109 19:8404863-8404885 CACCGGAGGAGGGCCCAGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 204
1162112099_1162112109 1 Left 1162112099 19:8404839-8404861 CCAGATGTCTCCACCCTAAACTG 0: 1
1: 0
2: 0
3: 12
4: 132
Right 1162112109 19:8404863-8404885 CACCGGAGGAGGGCCCAGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 204
1162112098_1162112109 20 Left 1162112098 19:8404820-8404842 CCAGTGGATGTTGGTGATGCCAG 0: 1
1: 0
2: 3
3: 14
4: 150
Right 1162112109 19:8404863-8404885 CACCGGAGGAGGGCCCAGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 204
1162112101_1162112109 -9 Left 1162112101 19:8404849-8404871 CCACCCTAAACTGACACCGGAGG 0: 1
1: 0
2: 1
3: 5
4: 38
Right 1162112109 19:8404863-8404885 CACCGGAGGAGGGCCCAGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162112109 Original CRISPR CACCGGAGGAGGGCCCAGTG GGG Intronic
900637694 1:3674057-3674079 CACCCCACGACGGCCCAGTGAGG - Intronic
901158246 1:7155026-7155048 GGCTGGAGAAGGGCCCAGTGTGG - Intronic
901530937 1:9852081-9852103 CACCCGAGGGTGGGCCAGTGTGG + Intronic
901751509 1:11412781-11412803 TCCCTGAGGAGGGTCCAGTGCGG + Intergenic
902231392 1:15029878-15029900 CGGAGCAGGAGGGCCCAGTGAGG + Intronic
902736305 1:18403599-18403621 CAGAGGAGGAGCCCCCAGTGTGG + Intergenic
903049575 1:20590595-20590617 CACGGCAGGAGGGGTCAGTGTGG - Intronic
903133173 1:21292267-21292289 CACAAGATGAGGGCCCAGAGTGG - Intronic
903350802 1:22715446-22715468 CCCCAGAGGTGGGCCCAGTAGGG - Intronic
903650549 1:24919185-24919207 CGGGGGAGGAGGGTCCAGTGCGG - Intronic
903664102 1:24996178-24996200 CACAGGAGGAGGGCCAAGAAGGG - Intergenic
904858594 1:33518289-33518311 CATCGAAGGAGGACACAGTGAGG + Intronic
905231077 1:36515301-36515323 CTCTGGGGGAGGGCCAAGTGGGG + Intergenic
905740180 1:40363382-40363404 CAGAGGAGTAGGGACCAGTGTGG + Intronic
906146502 1:43563833-43563855 CACTGAAGGAGAGTCCAGTGTGG + Intronic
906935180 1:50208495-50208517 CACCAGAGGAGGGACCAATAGGG - Intergenic
907053284 1:51344163-51344185 CACCGGAGGAGGAACAAGTTTGG + Intronic
907306017 1:53513583-53513605 GCCCAGAGGAGAGCCCAGTGGGG - Intronic
912551532 1:110488360-110488382 CAGCGGAGGAGGAGCCAGAGGGG + Intergenic
914723495 1:150308466-150308488 GACTGGAGGAGGGGGCAGTGAGG + Exonic
915148436 1:153809574-153809596 AACCGGAGGAGGGCGCAGGGTGG - Exonic
922252694 1:223864351-223864373 CCCCGTAGAAGGGCACAGTGTGG + Intergenic
923439908 1:234007413-234007435 CTGCGGAGAAGGGCCTAGTGTGG + Intronic
1062957678 10:1551153-1551175 CACAGAAGGAGGACCCTGTGAGG + Intronic
1063981331 10:11454361-11454383 TGCAGCAGGAGGGCCCAGTGAGG - Intronic
1064227565 10:13500857-13500879 CATGGGAGGAGGGCACGGTGGGG - Intronic
1066256478 10:33684341-33684363 CACAGGAGGAGGGGCCAGTTGGG - Intergenic
1066695059 10:38069888-38069910 GACTGGAGGAGGCGCCAGTGGGG + Intergenic
1066997451 10:42577291-42577313 GACTGGAGGAGGCACCAGTGGGG - Intronic
1067251146 10:44587945-44587967 ATCCTGAGGAGGGCCCAGGGAGG - Intergenic
1071274744 10:84043185-84043207 CACCAGAGGAGGGTGCTGTGTGG - Intergenic
1073432286 10:103494269-103494291 CACCGGGGGAGGGCCCTGCTGGG - Exonic
1073435471 10:103513415-103513437 CCCTGGGGCAGGGCCCAGTGGGG - Intronic
1076675020 10:132143113-132143135 GACAGGAGGAGGGCACAGAGGGG - Intronic
1076692067 10:132228897-132228919 CCCCGGAGGGGGTCCCACTGTGG - Intronic
1076942350 10:133618245-133618267 CACCTGAGCTGGCCCCAGTGAGG - Intergenic
1077285924 11:1765937-1765959 TAAGGGAGGAGGGCCCAGGGTGG - Intergenic
1077379244 11:2221076-2221098 CACAGGGGGAGGACCCTGTGAGG + Intergenic
1079539857 11:21560274-21560296 CAGAGCAGGAGGGCCCAGAGGGG - Exonic
1083937469 11:65877552-65877574 CAGAGGTGGAGGTCCCAGTGTGG - Intergenic
1084190754 11:67497641-67497663 CTCCGGAGTTTGGCCCAGTGCGG - Exonic
1084267336 11:68011807-68011829 TACCAGAGGAGGGCTCAGGGAGG - Intronic
1085453829 11:76654864-76654886 CACGGCAGCAGGGGCCAGTGGGG - Intergenic
1088783068 11:113155080-113155102 CACCCGAGGAGATCCCAGGGAGG + Intronic
1091699475 12:2650593-2650615 GGCAGGAGGAGGGCCAAGTGGGG + Intronic
1091979517 12:4853899-4853921 CTCCTGAGGAGGGGCCAGGGTGG + Intergenic
1094016844 12:25874061-25874083 CACTTCAGGAGGGACCAGTGTGG - Intergenic
1095951144 12:47782605-47782627 TGCCGGAGGAGGGACCAGGGTGG - Exonic
1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG + Intronic
1095968401 12:47884514-47884536 CCATGGAGCAGGGCCCAGTGCGG - Intronic
1096259616 12:50082420-50082442 CTCCGGGAGAGGGACCAGTGAGG - Exonic
1096606488 12:52769975-52769997 CACCCCAGGAGGGCCCATTGTGG - Intronic
1097178307 12:57156357-57156379 CCCCACAGGAGGGCCCAGAGAGG - Intronic
1097188740 12:57209541-57209563 CACAGGAGGAGGAACCGGTGTGG + Intronic
1097514969 12:60593849-60593871 CACAGGAGGAATGCCAAGTGAGG + Intergenic
1098455913 12:70672741-70672763 CACCTGGGGAGGTCCCAGTCAGG - Intronic
1098458166 12:70700433-70700455 CACAGGAGGAAGACCAAGTGTGG - Intronic
1101593205 12:106140310-106140332 CTGCAGAGGAGGCCCCAGTGAGG - Intergenic
1102944491 12:116974114-116974136 GACTTGAGGAGGCCCCAGTGAGG + Intronic
1103825841 12:123737255-123737277 CACTGGAGGAGGGCTCGGTAAGG + Exonic
1104751922 12:131245371-131245393 CCCAGGAGGAGGCCCAAGTGTGG + Intergenic
1104779970 12:131413704-131413726 CCCAGGAGGAGGCCCAAGTGTGG - Intergenic
1105893611 13:24699686-24699708 AACAGGAGGAGGACCCAATGGGG + Intronic
1110119464 13:71865329-71865351 CACCCGAGGAGGGCACTTTGAGG - Intronic
1112585630 13:100716285-100716307 CACTGGAGAAGGGCCAGGTGAGG - Intergenic
1118839484 14:69500233-69500255 CAGCAGGGGAGGGCCCAGTGCGG + Intronic
1121492679 14:94371413-94371435 CACCGCAGGAGGGCCCACCCCGG - Intergenic
1122122200 14:99560626-99560648 CACTGGAGGAGGGTGCAGAGTGG + Intronic
1128870616 15:71152774-71152796 CGCAGCAGGAGAGCCCAGTGAGG - Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132223005 15:100118806-100118828 CACCGGAGAAGGAACGAGTGAGG + Intronic
1136449114 16:30342775-30342797 GGGCGGAGGAGGGCCCTGTGGGG - Intergenic
1137673671 16:50293290-50293312 GACCGGCGGAGGGACCAGCGGGG - Intronic
1139812232 16:69630459-69630481 ATGAGGAGGAGGGCCCAGTGTGG - Intronic
1141300976 16:82815243-82815265 CCCCGAATGAGGGCCGAGTGTGG + Intronic
1141626011 16:85261463-85261485 CAGAGGAGGAGGGCGCAGAGTGG + Intergenic
1142575211 17:902489-902511 CAGGGCAGGACGGCCCAGTGAGG - Intronic
1143140504 17:4739598-4739620 CGACGGAGCCGGGCCCAGTGCGG - Exonic
1143520206 17:7440361-7440383 CACAGGAGGAGGGCGCATAGAGG - Intronic
1145796337 17:27657501-27657523 CACCCGAGGTGAGCCCAGGGAGG - Intergenic
1149316748 17:55445531-55445553 CACAAGAGAAGGGCCCAGAGAGG + Intergenic
1150223959 17:63512800-63512822 CTCTGGGGGAGGGACCAGTGGGG - Intronic
1150478529 17:65491875-65491897 CAACGGAAAAGGCCCCAGTGGGG + Intergenic
1153236205 18:2990917-2990939 CCCAGGAGGAGGGCCCCGTGTGG - Intronic
1157598166 18:48876319-48876341 CGCCACAGGAGGGGCCAGTGAGG - Intergenic
1157719150 18:49910217-49910239 AACTGGAGGAGAGCCCAGTGTGG + Intronic
1160438344 18:78868298-78868320 CTCCGGAAGAGGTCACAGTGCGG - Intergenic
1160860660 19:1236107-1236129 CTGGGGAGGAGGGCCCTGTGGGG + Exonic
1161961841 19:7527641-7527663 CACTCGAGGGGGGCCCAGGGTGG + Intronic
1162031247 19:7918104-7918126 CAGCCCAGGAGGTCCCAGTGAGG + Exonic
1162112109 19:8404863-8404885 CACCGGAGGAGGGCCCAGTGGGG + Intronic
1162954313 19:14090016-14090038 CGCCGGAGGGGGGCGCGGTGCGG - Exonic
1163232395 19:16013603-16013625 CACCGAAGGACTCCCCAGTGGGG + Intergenic
1163667323 19:18609438-18609460 CCCCAGTGGTGGGCCCAGTGAGG + Intronic
1163746932 19:19054292-19054314 CACCAGATGAGGGACCAGAGCGG + Exonic
1164415780 19:28045555-28045577 CATCTGAGGTGGGCCTAGTGAGG - Intergenic
1164416163 19:28048066-28048088 CACCTGGGGTAGGCCCAGTGAGG + Intergenic
1164418030 19:28062462-28062484 CACCTGGGCTGGGCCCAGTGAGG + Intergenic
1165079927 19:33301298-33301320 CGCCGGAGGCTGGCCCAGGGCGG + Exonic
1166668741 19:44697466-44697488 CACCAGAGGAGGGGCCAGGGAGG + Intergenic
1167286467 19:48601288-48601310 CACTGGAGGAGGCCCCTGGGGGG - Exonic
1167320892 19:48796644-48796666 CCCTGGAGGAGGGCCGCGTGCGG - Exonic
1167446919 19:49543253-49543275 GACCGGAGGAGGGGCCGCTGTGG + Exonic
1168536423 19:57174101-57174123 CACCTGAGGTGGGCCCGGCGTGG - Intergenic
1168710521 19:58497525-58497547 CACCTGAGAATGGCCCTGTGTGG - Intronic
926629664 2:15124970-15124992 CACCGGAGCACTGCCTAGTGGGG + Intergenic
927135275 2:20092361-20092383 CAGCGGAGGGGGGCCCAGACTGG + Intergenic
927870353 2:26619234-26619256 CCCCCGGGGAGGGCCCTGTGGGG - Intronic
928470309 2:31568791-31568813 CATGGGAGGAGGGGCAAGTGGGG - Intronic
933991856 2:87639676-87639698 CACTGGGTGAGGGGCCAGTGGGG - Intergenic
934663244 2:96154240-96154262 CCCAGGAGCAGGGCCGAGTGAGG + Intergenic
935144862 2:100388770-100388792 CACCGGGAAAGAGCCCAGTGGGG + Intergenic
935331089 2:101978618-101978640 CACTGGAGGAAGGCACGGTGGGG + Intergenic
936301988 2:111311142-111311164 CACTGGGTGAGGGGCCAGTGGGG + Intergenic
937126116 2:119476120-119476142 CCCAGGGGGAGCGCCCAGTGAGG - Intronic
938117155 2:128609753-128609775 GACCTGCAGAGGGCCCAGTGGGG - Intergenic
938143180 2:128812828-128812850 CACTGCAGGATGGCCCTGTGTGG - Intergenic
938581432 2:132649731-132649753 CAGGTGGGGAGGGCCCAGTGAGG + Intronic
938934438 2:136116597-136116619 CACCGGAGGAGCGCCCGCTTGGG - Intronic
940003801 2:148993222-148993244 AGCCAGAGGAGGGCCCAGTGGGG + Intronic
941907906 2:170734807-170734829 CAAGGGAGGAGGGCACAGTGAGG - Intergenic
942890263 2:180980280-180980302 CCCCGGAGGCGGGCCCAGGCCGG + Intronic
944146711 2:196514345-196514367 CACAGGAGGAGACCACAGTGGGG + Intronic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
948764224 2:240211325-240211347 CAGGGGAGGAGGGCACAGTCAGG + Intergenic
1168926662 20:1587368-1587390 CATCACAGCAGGGCCCAGTGGGG + Intronic
1168930363 20:1618644-1618666 CATCACAGCAGGGCCCAGTGGGG + Intronic
1170630106 20:18058161-18058183 CACCGGAGGGGTGCCCTGGGAGG - Intronic
1173226868 20:41167263-41167285 CACAGGAGGTGAGACCAGTGAGG + Intronic
1173315164 20:41936618-41936640 CAGCTGAGCAGAGCCCAGTGGGG + Intergenic
1175341050 20:58229009-58229031 CTCGGGACGGGGGCCCAGTGCGG - Intergenic
1175812760 20:61867640-61867662 CACAGGAGGAGGGGCCTGGGGGG - Intronic
1176107874 20:63398094-63398116 GACTGGGGGAGGGCACAGTGGGG - Intergenic
1178484590 21:33010611-33010633 CACAGGAGGAGCACCCAGTGGGG - Intergenic
1179833324 21:44012117-44012139 CTCCGGCGCAGGGCCCAGCGGGG + Intergenic
1180002795 21:45002690-45002712 CACTGGAGTAGAGCCCTGTGAGG + Intergenic
1183320927 22:37164596-37164618 AACAGGAAGAAGGCCCAGTGGGG - Intronic
1184458877 22:44626081-44626103 CCCGGGAGGAAGGCCCAGCGGGG - Intergenic
949927053 3:9049695-9049717 CACTGGAGGAGGAACCAGTGAGG + Intronic
950566563 3:13772933-13772955 CACCGGAGGAGGAACCAGGCTGG - Intergenic
954317924 3:49811354-49811376 CACTGGATGAGGCCCTAGTGCGG - Exonic
954443821 3:50536003-50536025 CAGCAGAGGAGGGGACAGTGGGG - Intergenic
954453807 3:50586169-50586191 CACCTCAGGAGGGCCCTGGGGGG - Intergenic
954459278 3:50617259-50617281 CCCCGGAGGAGGCCGCAGAGGGG - Intronic
955676336 3:61452827-61452849 GACCGGAGGAAAGGCCAGTGTGG - Intergenic
960094554 3:113676687-113676709 CACTGGAGGAGGTGCAAGTGTGG + Intronic
960525159 3:118701479-118701501 GGCTGGAGCAGGGCCCAGTGAGG - Intergenic
961463690 3:127068781-127068803 CACCCCAGGAAGCCCCAGTGAGG - Intergenic
961565739 3:127762224-127762246 CTCAGGAGCAGAGCCCAGTGGGG - Intronic
966647932 3:182267990-182268012 TGCCTGGGGAGGGCCCAGTGAGG - Intergenic
968056582 3:195696759-195696781 CGGCGGCGGAGGGGCCAGTGGGG + Intergenic
968576528 4:1368882-1368904 CAGCAGAGGAGGGCGCTGTGGGG - Intronic
968633847 4:1667615-1667637 CACCGCAGGGGGTTCCAGTGAGG - Intronic
969460697 4:7327279-7327301 CACCGGAGGTGGGACAGGTGAGG - Intronic
972290391 4:37685955-37685977 CCTCGGAGGAGGCCCCAGGGAGG + Intronic
972394251 4:38644958-38644980 CACAGGAGGAGTGCCCAGGCAGG + Intergenic
972891105 4:43557445-43557467 GACCTGGGGAAGGCCCAGTGAGG + Intergenic
973862600 4:55079944-55079966 AACAGGAGGAGAGCTCAGTGTGG + Exonic
977222492 4:94354490-94354512 CACCTGAGGAGGGGCCCATGAGG + Intergenic
978857334 4:113408234-113408256 CACCGAAGGATTTCCCAGTGGGG - Intergenic
985705776 5:1400615-1400637 CACGGGAGCAGTGCCCTGTGGGG - Intronic
985893700 5:2737012-2737034 CACCGGAGATGGCCGCAGTGGGG - Intergenic
986291278 5:6400967-6400989 CACCAGAAGAGGTCACAGTGGGG - Intergenic
991028024 5:62052000-62052022 CACAGGAGGAGGGGGCTGTGGGG + Intergenic
991690125 5:69217702-69217724 CGGCGGAGGAGAGCCCAGTCCGG + Intergenic
992093164 5:73337748-73337770 CACAGGAGGGAGGCCCAGAGAGG - Intergenic
993641321 5:90409589-90409611 CCCCGGAGCGGGGCCCAGGGAGG - Intronic
996236438 5:121136676-121136698 AACAGGAGGAGGACACAGTGAGG - Intergenic
997382318 5:133446624-133446646 CACCTGCGGAGGGCCCCGGGAGG - Intronic
997422684 5:133781568-133781590 GACTGGAGGAGGGTGCAGTGTGG + Intergenic
997597671 5:135117907-135117929 GACAGGAGGAGGGCACAGAGTGG - Intronic
997950915 5:138241964-138241986 CGCCGGAGCTGGGCCCAGGGCGG - Intergenic
998104123 5:139457495-139457517 CATCCAGGGAGGGCCCAGTGAGG - Intronic
1002000537 5:176194286-176194308 CACAGCCGGAGGTCCCAGTGTGG - Intergenic
1002212250 5:177605936-177605958 CACAGGATGAGGGCCCAGCATGG - Intronic
1002230870 5:177763280-177763302 CACCTGGGCTGGGCCCAGTGTGG + Intronic
1002264467 5:178020468-178020490 CACCTGGGCTGGGCCCAGTGTGG - Intronic
1004349015 6:14874872-14874894 CCACTGAAGAGGGCCCAGTGAGG + Intergenic
1005340113 6:24835792-24835814 CACAGGAGTTGGGACCAGTGTGG - Exonic
1006076006 6:31532936-31532958 AACGGGAGGAGGGCAGAGTGGGG + Intronic
1006986253 6:38177585-38177607 CACTGGAGGAGGGATCAGGGCGG + Intronic
1018682339 6:166275051-166275073 CACAAGTGAAGGGCCCAGTGGGG - Intergenic
1019139395 6:169934072-169934094 CAGCAGAGGAGGGTCCACTGAGG - Intergenic
1019155231 6:170034110-170034132 TAGAGGAGGAGGGGCCAGTGGGG - Intergenic
1019448251 7:1082530-1082552 CACAGGAGGAGGGGCCAGCATGG + Intronic
1019578467 7:1748873-1748895 CTCAGGGGGAGGGCCCTGTGAGG + Intergenic
1019589534 7:1823930-1823952 CTCCGGAGCAGGGCTCTGTGTGG + Intronic
1020083777 7:5299704-5299726 CACAGGAGGATGCCCCAGAGGGG + Intronic
1020283699 7:6664284-6664306 CCTCGGAGGAGGGCCCAGGGCGG - Intergenic
1022593215 7:31686287-31686309 CACTGGAGGAGAGCCCACTGGGG - Intergenic
1024387458 7:48769266-48769288 CACCAAAGAAGGGCCAAGTGAGG - Intergenic
1025210503 7:57017481-57017503 CACAGGAGGATGCCCCAGAGGGG - Intergenic
1025218013 7:57076493-57076515 CACCGGATGAGGTCCCACTTAGG - Intergenic
1025653333 7:63493963-63493985 CACCGGATGAGGTCCCACTTAGG + Intergenic
1025661453 7:63559366-63559388 CACAGGAGGATGCCCCAGAGGGG + Intergenic
1029970052 7:104780082-104780104 CACAAGAGGAGGGGCCACTGGGG - Intronic
1032269691 7:130393166-130393188 CACTGGATGAAGGACCAGTGAGG - Intergenic
1034413213 7:150951975-150951997 CACCTGTGCTGGGCCCAGTGTGG - Intronic
1034494803 7:151413278-151413300 AGCCAGAGGAGGGCACAGTGTGG + Intergenic
1034972559 7:155428200-155428222 CACAGGAGCAGGAACCAGTGTGG + Intergenic
1039014210 8:33128060-33128082 TACAGGAGGAGGGTCCAGTCTGG - Intergenic
1039815724 8:41092923-41092945 CACCGGAGGAGGCTCCGGTTCGG + Intergenic
1039845783 8:41324521-41324543 CACTTGAGGACAGCCCAGTGAGG - Intergenic
1040060289 8:43097828-43097850 CCCTGGAGGAGGGGCCTGTGGGG + Intronic
1041100571 8:54392676-54392698 CACCAGAGGTGGGCACAGGGAGG - Intergenic
1043476633 8:80611643-80611665 CACCGGAGGAGGCGCCAGGCGGG - Intergenic
1046686889 8:117237792-117237814 GACAGGAGAAGGGCCCAGTTAGG - Intergenic
1054708100 9:68483481-68483503 CACTGGAGAAGAGACCAGTGTGG + Intronic
1056074566 9:83025211-83025233 CAAAGGGGGAGGGCCAAGTGAGG + Intronic
1056748257 9:89323842-89323864 CAGAGGAGGAAGGACCAGTGAGG + Intronic
1057302625 9:93895623-93895645 CACCTGAGAAGGGCCCTGAGAGG + Intergenic
1059440864 9:114306114-114306136 CACCCTAGGGGAGCCCAGTGGGG + Intronic
1059842182 9:118230068-118230090 GACCTTAGGAGGGCCCAGTGGGG + Intergenic
1060736372 9:126068969-126068991 AGCTGGAGCAGGGCCCAGTGCGG + Intergenic
1060748280 9:126151981-126152003 CCCCGGAGGGCAGCCCAGTGTGG - Intergenic
1061185275 9:129049301-129049323 CAGTGGAGGAGGGCTCAGGGGGG + Intronic
1061651641 9:132055023-132055045 CACAGCAGGAGGGAGCAGTGAGG - Intronic
1190049790 X:47141142-47141164 AAACGTAGGAGGTCCCAGTGAGG + Intergenic
1199972153 X:152869096-152869118 CACCTGCGGAGGGTCAAGTGAGG + Exonic
1200444902 Y:3248632-3248654 AAAGGGAGGAGGGCCCACTGAGG - Intergenic