ID: 1162116717

View in Genome Browser
Species Human (GRCh38)
Location 19:8434485-8434507
Sequence TGGCTGCCTCGTTGTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162116717_1162116723 4 Left 1162116717 19:8434485-8434507 CCACACACACAACGAGGCAGCCA 0: 1
1: 0
2: 0
3: 16
4: 217
Right 1162116723 19:8434512-8434534 GCAGACATTCATTGTATGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 93
1162116717_1162116722 1 Left 1162116717 19:8434485-8434507 CCACACACACAACGAGGCAGCCA 0: 1
1: 0
2: 0
3: 16
4: 217
Right 1162116722 19:8434509-8434531 CCAGCAGACATTCATTGTATGGG 0: 1
1: 0
2: 0
3: 18
4: 151
1162116717_1162116720 0 Left 1162116717 19:8434485-8434507 CCACACACACAACGAGGCAGCCA 0: 1
1: 0
2: 0
3: 16
4: 217
Right 1162116720 19:8434508-8434530 CCCAGCAGACATTCATTGTATGG 0: 1
1: 0
2: 1
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162116717 Original CRISPR TGGCTGCCTCGTTGTGTGTG TGG (reversed) Intronic
900267222 1:1763985-1764007 TCGTTGCCTCGTTGTCAGTGGGG - Intronic
901530229 1:9848451-9848473 TGGATACCTGGTTGAGTGTGTGG - Exonic
903293891 1:22331701-22331723 TGGGTGCCTGAGTGTGTGTGGGG - Intergenic
903852280 1:26315310-26315332 TGGCTGCCTCTTTGTAAGAGGGG + Intronic
905999800 1:42414596-42414618 TGGCTCCTTTGTGGTGTGTGAGG + Exonic
907400948 1:54224445-54224467 TGGCTGCCTCATAGGCTGTGAGG - Intronic
909069230 1:70974358-70974380 TGGATGCATAGTTGTTTGTGTGG + Intronic
909938106 1:81577798-81577820 TTCCTGCCTCACTGTGTGTGTGG + Intronic
910123038 1:83811279-83811301 TGTCTGGTTCGCTGTGTGTGGGG - Intergenic
911258013 1:95654476-95654498 TGTCTGCATCGTAGTGTGGGAGG - Intergenic
911411435 1:97513306-97513328 TGGCTCCCTCGTTGTTTTTCTGG - Intronic
915143845 1:153783090-153783112 TCTCAGCCTCGTTGTGTCTGCGG + Intergenic
916076117 1:161200850-161200872 TGGCTGCAGCAGTGTGTGTGGGG + Intronic
920432082 1:205925299-205925321 TGGGGGCCTGGTTTTGTGTGTGG + Intronic
922801773 1:228367803-228367825 TGGCTGCCTCACTGTGAGTGTGG + Intronic
1062847714 10:720455-720477 TGCCTTCCTCGTTGCTTGTGTGG + Intergenic
1065956258 10:30696390-30696412 TGGCTGCCTCGTGGGGCATGGGG - Intergenic
1067469496 10:46525992-46526014 TGGTTGTGTGGTTGTGTGTGTGG - Intergenic
1070823372 10:79376015-79376037 TGGCTGCCTGGCTGTCTGGGAGG + Intergenic
1071359355 10:84830402-84830424 TGGCTACCTTGTTGGGTCTGTGG + Intergenic
1072453411 10:95557061-95557083 TGGCTCCCCCTTTTTGTGTGCGG - Intronic
1076438603 10:130463536-130463558 TGACTGCCCAGTTGTGTGGGAGG - Intergenic
1076756581 10:132575755-132575777 GGGCTCCCGCGTGGTGTGTGCGG + Intronic
1076821298 10:132941254-132941276 CTGCTGCCTCGCTGTGTCTGCGG - Intronic
1077052203 11:571981-572003 TGTCTGCCTGCTGGTGTGTGAGG + Intergenic
1077118490 11:896171-896193 AGACAGCCTCGTTGTGTCTGGGG - Intronic
1077118521 11:896288-896310 AGACAGCCTCGTTGTGTCTGGGG - Intronic
1077120103 11:903388-903410 TGGCTCCCTCCTTGCATGTGAGG + Intronic
1077376829 11:2209184-2209206 TGTCTGCCTCTGTGTGTGTCTGG - Intergenic
1079078767 11:17399388-17399410 TGGCTGCAGCATAGTGTGTGGGG - Intronic
1079309733 11:19354670-19354692 TGGCTGCATAGGTGTGTATGAGG - Intronic
1084911031 11:72389410-72389432 TGGCTGCCATGTTGTAGGTGTGG + Intronic
1085811115 11:79681807-79681829 TGGATTCCACCTTGTGTGTGTGG + Intergenic
1086100119 11:83090754-83090776 TGGCTGTTTCCTTTTGTGTGTGG - Intergenic
1089648635 11:119897080-119897102 TTGCTGTCTCTATGTGTGTGTGG - Intergenic
1090085373 11:123645724-123645746 TGTCTGCTTCCCTGTGTGTGTGG - Exonic
1092636088 12:10451094-10451116 TTGCTGCCTCTTTGGGTTTGGGG + Exonic
1092708352 12:11308594-11308616 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1092712442 12:11353294-11353316 TTGCTGCCTCCTTGTGCGGGTGG + Exonic
1092712482 12:11353417-11353439 TGGTTGCCTCCTTGTGGGGGTGG + Intronic
1092716180 12:11393014-11393036 TTGCTGCCTCCTTGTGGGGGTGG + Exonic
1092716218 12:11393137-11393159 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716232 12:11393200-11393222 TTGCTGCCTCCTTGTGGGGGTGG + Exonic
1092716272 12:11393323-11393345 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716327 12:11393509-11393531 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716376 12:11393695-11393717 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1092716430 12:11393878-11393900 TGGTTGCCTCCTTGTGGGGGTGG + Exonic
1093493123 12:19726582-19726604 TGTCTGCCTCATGGTGTGGGAGG + Intergenic
1094817873 12:34204865-34204887 TGTCTGTATCTTTGTGTGTGTGG + Intergenic
1095976397 12:47943312-47943334 TGGCTCCCTCCTGCTGTGTGGGG - Intergenic
1098977332 12:76916749-76916771 TGGTTGCTTTTTTGTGTGTGGGG + Intergenic
1100247981 12:92783295-92783317 TGTCTGCTTCTTGGTGTGTGTGG + Intronic
1101657208 12:106733175-106733197 TGTCTGGCTTTTTGTGTGTGTGG - Intronic
1102600568 12:114026580-114026602 TGGCTGCCTGGTTAAGTGTCAGG + Intergenic
1103126198 12:118424509-118424531 TTGCTGCCTCTCTGGGTGTGTGG + Intergenic
1104884858 12:132100781-132100803 AGGCTGCCTCCTTGTGTGCTTGG + Intronic
1105212866 13:18267495-18267517 TTGCAGCCCTGTTGTGTGTGGGG - Intergenic
1106849871 13:33778651-33778673 TGGATGCCTCGTTGTCAGAGAGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1119849404 14:77856386-77856408 TGCCTGTCTCTCTGTGTGTGGGG + Intronic
1121565071 14:94903349-94903371 TTGCTGCCACGGTGTGTGTGCGG - Intergenic
1122075926 14:99234471-99234493 TGGCTTCCTCTGTGCGTGTGTGG - Intronic
1122916914 14:104863722-104863744 TGGCTGCCCAATTGTGTGGGTGG - Intergenic
1123883397 15:24697014-24697036 TGGCTGCGCAGCTGTGTGTGGGG - Intergenic
1123943179 15:25226378-25226400 TGGCTGTCTCTGTGTGTGGGAGG + Intergenic
1124244494 15:28057947-28057969 AGGCTGCCTCCCGGTGTGTGAGG - Intronic
1124367437 15:29082356-29082378 TAGCTACCTTTTTGTGTGTGTGG + Intronic
1125605254 15:40936576-40936598 TGGCCGTCTCGCTGGGTGTGGGG + Exonic
1130585460 15:85177453-85177475 TGGCTGCGTAGCTGTGTGTGGGG + Intergenic
1131962592 15:97805177-97805199 TGGCTGCCTGGTTGTAAGGGAGG + Intergenic
1132605521 16:792248-792270 TGGCCGCCTCGATGCGTGTGCGG - Exonic
1133808883 16:9146133-9146155 TGGGGGCTTTGTTGTGTGTGGGG + Intergenic
1134298196 16:12965671-12965693 TGGCTGCCACGATGTGGGAGGGG - Intronic
1135035567 16:19074173-19074195 TGACTGCCTTTTTTTGTGTGTGG + Intronic
1135196452 16:20399034-20399056 GGCCTGCCTCCTTGTGTGTGGGG - Intronic
1137313049 16:47285638-47285660 TGTCTGCTGCTTTGTGTGTGGGG + Intronic
1138281917 16:55778732-55778754 TGTGTGTCTCTTTGTGTGTGTGG - Intergenic
1138641773 16:58393274-58393296 TGGCAGCATGGTTGGGTGTGGGG + Intronic
1141004710 16:80341350-80341372 TGCCTGCATGGTTGTGAGTGTGG + Intergenic
1141051768 16:80772047-80772069 TGGCTGCCATGGTGTTTGTGGGG - Intronic
1141412306 16:83843880-83843902 TGGCTGCGTCTTTGCATGTGCGG - Intergenic
1142007200 16:87695139-87695161 CAGCTGCTTCGTTGTGGGTGGGG + Intronic
1142205023 16:88778821-88778843 TGGATGCCTGGGTGTGTGGGTGG - Intronic
1142410639 16:89914571-89914593 TGGGTGCCTGTGTGTGTGTGGGG + Intronic
1142423356 16:89987136-89987158 AGGATGCCTGGTTGTATGTGGGG + Intergenic
1143924768 17:10359802-10359824 TGGCAGACACGTTCTGTGTGAGG + Intronic
1144669043 17:17121456-17121478 TGCCTGCCTCATAGTGTGTTCGG + Intronic
1147248583 17:39139048-39139070 TGGAAGCCTCGGTGTGTCTGGGG - Intronic
1148124939 17:45231645-45231667 TCCCTGCCTCTTTGTGTGAGTGG + Intronic
1148497005 17:48059044-48059066 TGGGTGCCATGTTGTATGTGTGG - Exonic
1148752543 17:49953701-49953723 TGACTGTGTGGTTGTGTGTGTGG - Intergenic
1149503909 17:57177150-57177172 TGGTTGCCTCTGTGTGGGTGGGG - Intergenic
1155093707 18:22535839-22535861 TCTCTGCCTGGTTGTGTGTGTGG - Intergenic
1155154925 18:23150111-23150133 TCCCTGCCTCCTTGTGTCTGGGG + Intronic
1155497805 18:26459793-26459815 TGAGTGCCTCGTCGTGCGTGTGG - Exonic
1157549333 18:48570525-48570547 TGGCAGCCTCAGTGTGTGCGTGG - Intronic
1157552225 18:48589748-48589770 TGGATGCTTCTTTGTGTGGGGGG + Intronic
1160745713 19:709893-709915 TGGCTGCGCCTGTGTGTGTGGGG + Intronic
1161602542 19:5193349-5193371 AGGCAGCCTCGCTGTGTTTGGGG - Intronic
1162116717 19:8434485-8434507 TGGCTGCCTCGTTGTGTGTGTGG - Intronic
1162460376 19:10810984-10811006 GGGCTGCCTGGTGGTGGGTGAGG - Intronic
1163691124 19:18739049-18739071 TGGCTGCCTGGCTGTGAGAGTGG - Intronic
1165069375 19:33246986-33247008 TGGCTGCATCTTTCTGGGTGGGG + Intergenic
1165248534 19:34512528-34512550 GGCCTGTCACGTTGTGTGTGGGG + Intergenic
1165432199 19:35779185-35779207 AAGCAGCCTCGGTGTGTGTGTGG + Intronic
1167423099 19:49415233-49415255 TGGCTGCAGCCCTGTGTGTGTGG - Intronic
1167563751 19:50242977-50242999 TGGCAGCCTTCTTGTGTTTGGGG - Intronic
1167685303 19:50952396-50952418 TGACTGCCACGGTGTGTGTCGGG - Intronic
1168188261 19:54716093-54716115 TGGCTCACTCCCTGTGTGTGTGG + Intergenic
925087020 2:1116487-1116509 TGGGTGCCCTGGTGTGTGTGTGG + Intronic
925408533 2:3625375-3625397 TGGCTGCCTTGTGGTGGGTGGGG + Intronic
925503886 2:4539078-4539100 CACCTGCCACGTTGTGTGTGTGG + Intergenic
925581930 2:5419638-5419660 TTGCTGACTCATTGAGTGTGAGG + Intergenic
925632538 2:5909485-5909507 TGGCTGCGTGGTGCTGTGTGGGG - Intergenic
925786457 2:7435709-7435731 TGGCTCCCTCGTAATGTCTGAGG + Intergenic
926419190 2:12680668-12680690 TGGCTGCTTCATTGACTGTGTGG - Intergenic
929690997 2:44073374-44073396 TGGCTCCCTGTGTGTGTGTGAGG - Intergenic
932534216 2:72574755-72574777 TGGATGTCTCTTTGTGAGTGTGG - Intronic
935950101 2:108320838-108320860 TGGCTCCCTGGTAGTGTGGGAGG - Intergenic
940367490 2:152864299-152864321 TGTGTGTCTCTTTGTGTGTGGGG - Intergenic
940902146 2:159135490-159135512 CGGCTGCATCATTGTATGTGAGG + Intronic
942452380 2:176116367-176116389 GTTCTGCCTGGTTGTGTGTGGGG + Intronic
947714767 2:232333973-232333995 TGGCTGCCGCGTTAGGTGAGGGG + Exonic
948182135 2:235990387-235990409 TGTCTGCCTCGTGATGTTTGGGG + Intronic
948907053 2:240984621-240984643 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907066 2:240984703-240984725 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907082 2:240984799-240984821 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907102 2:240984922-240984944 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907110 2:240984974-240984996 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907118 2:240985026-240985048 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907130 2:240985105-240985127 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907142 2:240985178-240985200 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907151 2:240985233-240985255 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907163 2:240985306-240985328 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907184 2:240985434-240985456 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907193 2:240985489-240985511 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
948907230 2:240985732-240985754 TGAGTGCCTGGGTGTGTGTGTGG - Intronic
1171024047 20:21612605-21612627 TTGCTGCCTCGTTGAGTCGGTGG + Intergenic
1172842806 20:37912238-37912260 TGGCTGCCAAGCTGTGTGTGTGG + Intronic
1176363825 21:6020568-6020590 TGTCTGCGTCTCTGTGTGTGGGG + Intergenic
1179012577 21:37567328-37567350 TGGCTGCGCAGCTGTGTGTGTGG + Intergenic
1179759693 21:43517977-43517999 TGTCTGCGTCTCTGTGTGTGGGG - Intergenic
1180554389 22:16563401-16563423 TGGCTGCCTGGCTGCCTGTGTGG - Intergenic
1180743315 22:18068850-18068872 TGGCTGCCTGATTGTTTGTTGGG + Intergenic
1180815683 22:18787816-18787838 TTGCAGCCCTGTTGTGTGTGGGG - Intergenic
1181010491 22:20037413-20037435 TCTCTGCCTCGTTCTCTGTGTGG - Intronic
1181201871 22:21222151-21222173 TTGCAGCCCTGTTGTGTGTGGGG - Exonic
1181699879 22:24614817-24614839 TTGCAGCCCTGTTGTGTGTGGGG + Exonic
1183006542 22:34907555-34907577 TGGCTGCCTTGCTGTGTGCTGGG - Intergenic
1183486972 22:38093459-38093481 TGACTGCCTCCTCGTGGGTGAGG - Intronic
1185150291 22:49160400-49160422 TGGCTGCCTTGATGGGTGTCAGG - Intergenic
1203225040 22_KI270731v1_random:73277-73299 TTGCAGCCCTGTTGTGTGTGGGG + Intergenic
1203265788 22_KI270734v1_random:13507-13529 TTGCAGCCCTGTTGTGTGTGGGG - Intergenic
950883397 3:16342205-16342227 TGGTTGCCTCGGGGTGGGTGGGG - Intronic
954540903 3:51392350-51392372 TGGCTACCCAGCTGTGTGTGAGG + Exonic
956082342 3:65570847-65570869 AGGCTGCCTGGTTGTTTGGGGGG + Intronic
956771899 3:72533887-72533909 TGGGTGTGTGGTTGTGTGTGGGG + Intergenic
957319387 3:78609484-78609506 AGGCTGTCTCTGTGTGTGTGTGG - Intronic
961436777 3:126924583-126924605 TGGGTTCCTGGTTGTGTGAGTGG + Intronic
961673064 3:128548899-128548921 GAACTGCCACGTTGTGTGTGGGG - Intergenic
962636816 3:137339795-137339817 TGACAGCCACGTGGTGTGTGAGG - Intergenic
965794348 3:172423737-172423759 TGCCTGCATGTTTGTGTGTGTGG + Intergenic
966213307 3:177475410-177475432 TGGCTCCCTCGTTTTATATGAGG - Intergenic
966244876 3:177796285-177796307 TGGCTGCCTCTTTGAGGATGGGG + Intergenic
967884968 3:194327128-194327150 TGGTTGTGTGGTTGTGTGTGTGG - Intergenic
967885035 3:194327836-194327858 TGGTTGTGTGGTTGTGTGTGTGG - Intergenic
967885044 3:194327909-194327931 TGGTTGTGTGGTTGTGTGTGTGG - Intergenic
968437398 4:601035-601057 TTGCTGCCTGGCTGTGGGTGAGG - Intergenic
968890995 4:3368433-3368455 TGGGTGCCTGTGTGTGTGTGGGG + Intronic
968891009 4:3368503-3368525 TGGGTGCCTGTGTGTGTGTGGGG + Intronic
968954208 4:3709989-3710011 TGGCTGCTTCCTTGTGTCTGGGG - Intergenic
968991028 4:3912547-3912569 TGTCTGCATCGCTGTGTGGGTGG - Intergenic
969428802 4:7140982-7141004 GGGCTGCCTCGTCCTGGGTGGGG + Intergenic
969440250 4:7212753-7212775 TGGCTGCAGGGTTGGGTGTGTGG - Intronic
973981440 4:56311381-56311403 TGGCTTCCTCATTGTCTGGGCGG - Intronic
975882526 4:78927548-78927570 TGGCTGACTGGCTGTGTGAGAGG + Intronic
978303659 4:107297981-107298003 TTGCTGCCTCTTTCTGTTTGAGG - Intergenic
978645520 4:110926338-110926360 TGTGTGCCTCTGTGTGTGTGTGG - Intergenic
981129805 4:141145933-141145955 CGGCTGCCTCAGTGTGTGTCTGG + Intronic
981578534 4:146229673-146229695 TGGCTTCCTTGTTCTCTGTGGGG + Intergenic
983289735 4:165786697-165786719 TGGCTGCCTTCTTGTCTCTGTGG + Intergenic
985560705 5:584558-584580 TGGCTGGCTGGTTGGGTGGGTGG + Intergenic
985560737 5:584658-584680 TGGCTGGCTGGTTGGGTGGGTGG + Intergenic
987930166 5:24391560-24391582 TGGCTATCTCGCTGTGTCTGGGG - Intergenic
989474349 5:41857198-41857220 TGGCTGCCATGTTGTGTGGGAGG - Intronic
990521852 5:56588671-56588693 TGGCTGCCTGGGAGGGTGTGAGG - Intronic
994892784 5:105659655-105659677 TGGCTTCCTTTTTGTGAGTGGGG - Intergenic
999449945 5:151670435-151670457 TGGCTGCCTCTTTGTAGCTGGGG + Intronic
1001647841 5:173295428-173295450 TGGCCCCCTCCTTGTGGGTGGGG + Intergenic
1006586827 6:35120521-35120543 TGGCTGCCTCATTGGGAGAGGGG + Exonic
1007916917 6:45569603-45569625 GGGCTGCCTAGCTGTGAGTGGGG - Intronic
1009374293 6:62948097-62948119 TGTCTGCCTCTTGGTGTGTGGGG + Intergenic
1015115879 6:129649066-129649088 TGGTTGCATGGGTGTGTGTGGGG - Intronic
1017931160 6:158956933-158956955 TGGCAGGCTGGTTGTGTGGGAGG + Intergenic
1019235703 6:170610442-170610464 TGGCTGCCTCGCCTTGGGTGTGG + Intergenic
1019419780 7:945649-945671 TGGCAGCCTGGATGTTTGTGGGG - Intronic
1020765918 7:12320889-12320911 TGTCTGCCTGGCTCTGTGTGTGG - Intergenic
1023694661 7:42832414-42832436 TGGCTGCATGTGTGTGTGTGTGG - Intergenic
1024934124 7:54695635-54695657 TGGCTGCCTGTGTGTGTGTGTGG - Intergenic
1026795397 7:73363298-73363320 TGCCTGCCTCGTGGACTGTGGGG + Intergenic
1027231989 7:76278113-76278135 TGGCTGCCTCCTGGAGTGGGGGG + Intronic
1031390244 7:121204454-121204476 TGGCTGCCTGTAGGTGTGTGTGG - Intronic
1032404848 7:131648612-131648634 TGGCAGCCTGGCTGTCTGTGTGG + Intergenic
1034271895 7:149807096-149807118 TGGCTGCTGTGTTGTGTTTGGGG - Intergenic
1035622236 8:1043132-1043154 TGGCTGGCAGGTTGTGGGTGTGG + Intergenic
1037882156 8:22578737-22578759 GGGCTGCCTGGGTGTGTCTGCGG - Exonic
1037991004 8:23321208-23321230 TGGCTGCCTCGTTGCCTCTGGGG + Intronic
1041708767 8:60874364-60874386 GGGCTGCCACTGTGTGTGTGTGG - Intergenic
1044869438 8:96603998-96604020 TGACTGCCTCAGAGTGTGTGTGG + Intronic
1048189687 8:132276522-132276544 GGGCTGCCTTGTTGGGGGTGGGG - Intronic
1048856791 8:138693227-138693249 TGGCTGCATCTGTGTGTTTGGGG + Intronic
1049193028 8:141299236-141299258 TGGCGTCCTCGTTGTGGGTGGGG - Intronic
1049766006 8:144355524-144355546 TGGCTGCCTAGCTGGGTGAGGGG + Exonic
1050243065 9:3658648-3658670 TGGCTGCATTGGTGTGTGGGGGG + Intergenic
1056617526 9:88181092-88181114 TGAGTGCCTTGTTGTTTGTGTGG + Intergenic
1057503091 9:95611265-95611287 GGGCTGCCACGGTGTGTGTGGGG + Intergenic
1061390175 9:130313285-130313307 TGGCTTCCTGGTAGTGTCTGGGG + Intronic
1061715727 9:132517761-132517783 AGGCTGACACTTTGTGTGTGCGG - Intronic
1061866765 9:133495304-133495326 AGGCTGTCTCGTTCTGTCTGTGG + Intergenic
1061919342 9:133774191-133774213 TGGCTGCCTGGTCCTCTGTGAGG + Intronic
1061990344 9:134155266-134155288 TGGCTGCAGAGTTGGGTGTGGGG + Intronic
1062291397 9:135796832-135796854 TGCCTGGATGGTTGTGTGTGCGG + Intergenic
1062334596 9:136059500-136059522 GGGCCGCCTCCTTGGGTGTGTGG + Intronic
1191896944 X:66002691-66002713 TGTCTGCTGCTTTGTGTGTGGGG + Intergenic
1195706430 X:107741149-107741171 GGGCTGCCTAGTTCTGTGAGTGG - Intronic
1196138481 X:112234971-112234993 TGGCTGCTTAGGTGTGTTTGGGG + Intergenic
1198636175 X:138703259-138703281 TGTCTGCCTCGGGGTATGTGTGG - Intronic
1199882331 X:151983901-151983923 TGGATGCCTCTATGTGTGTGTGG - Intergenic
1200706919 Y:6450990-6451012 TGGATGTCTCTGTGTGTGTGTGG - Intergenic
1200709805 Y:6473293-6473315 TGGATGTCTGCTTGTGTGTGTGG - Intergenic
1200918054 Y:8588799-8588821 TGGATGTCTCTGTGTGTGTGTGG + Intergenic
1201024307 Y:9691415-9691437 TGGATGTCTGCTTGTGTGTGTGG + Intergenic
1201027193 Y:9713718-9713740 TGGATGTCTCTGTGTGTGTGTGG + Intergenic
1201958410 Y:19651027-19651049 GGGCTGCCTCGTTGTTGTTGGGG - Intergenic