ID: 1162119422

View in Genome Browser
Species Human (GRCh38)
Location 19:8453680-8453702
Sequence CTGGGGAAGCAGAAGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 812
Summary {0: 1, 1: 0, 2: 6, 3: 77, 4: 728}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162119411_1162119422 24 Left 1162119411 19:8453633-8453655 CCCGTGGTCTGGGAGTCACTGGA 0: 1
1: 1
2: 3
3: 24
4: 191
Right 1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG 0: 1
1: 0
2: 6
3: 77
4: 728
1162119412_1162119422 23 Left 1162119412 19:8453634-8453656 CCGTGGTCTGGGAGTCACTGGAT 0: 1
1: 0
2: 0
3: 21
4: 245
Right 1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG 0: 1
1: 0
2: 6
3: 77
4: 728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162119422 Original CRISPR CTGGGGAAGCAGAAGGTGCA AGG Intronic
900125585 1:1067690-1067712 CTTGGGCAGCCGAAGATGCACGG - Intergenic
900175698 1:1290524-1290546 CTGGGGCAGCGGGAGGTACAGGG - Exonic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
900812727 1:4820206-4820228 CTTGGGAAGCAGCAAATGCAGGG + Intergenic
900893714 1:5468289-5468311 CTCAGGCAGCAGTAGGTGCAAGG + Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901195715 1:7438757-7438779 CTGGTGGAGCAGAAAGAGCATGG + Intronic
901555869 1:10031164-10031186 CCCGGGAGGCAGAAGTTGCAAGG - Intergenic
902061777 1:13650073-13650095 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902300982 1:15502581-15502603 CTGGGGAAGGTGAAGTGGCAGGG + Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902696520 1:18144200-18144222 CTGGGGAAGGAGAAGATGGGAGG - Intronic
902839376 1:19065556-19065578 CTGGGGAAGCAGCTTGTCCAAGG + Intergenic
903618735 1:24682188-24682210 CTCCGGAAGCAGAGGTTGCAGGG - Intergenic
904369486 1:30039554-30039576 CTGAGGCAGCAGTAGGTACAAGG - Intergenic
904384550 1:30132781-30132803 CCGGGGAAGCAGCAGGTCCTTGG - Intergenic
904779622 1:32935820-32935842 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
904821895 1:33250893-33250915 AAGGAGAAGAAGAAGGTGCATGG + Intergenic
905132326 1:35770148-35770170 CTGGGGGAGCTGGAGGTGCACGG + Intergenic
905274596 1:36809029-36809051 CTGGGAAAGCAGAAGAGACAAGG - Intronic
905294670 1:36946693-36946715 CTGTGAAATGAGAAGGTGCATGG - Intronic
905473494 1:38209814-38209836 CTGGGGATGCAGAAGCTGGCGGG + Intergenic
905573309 1:39023748-39023770 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
906252493 1:44321452-44321474 CTTGGGGAACAGAAGGTCCAGGG - Intronic
906258900 1:44371268-44371290 CTGGGGTAGTAGCAGGTGAATGG + Intergenic
906433119 1:45772228-45772250 CTTGGGAAGCCCAAGGTGGATGG - Intergenic
906542288 1:46596527-46596549 CTGGGGAAGTAGAAAGCACAGGG + Intronic
906710359 1:47924829-47924851 CTGGGGATGGGAAAGGTGCAGGG + Intronic
907236799 1:53056824-53056846 TTGGGGAGGCAGAAGGTGGGAGG - Intergenic
907931040 1:59000469-59000491 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
908466711 1:64403099-64403121 CTGCGGAGGCAGAAGATGGAGGG + Intergenic
909584453 1:77273968-77273990 GTGGGGAAGTAGAAGTAGCAAGG + Intergenic
910682928 1:89885835-89885857 CTGTGGAGGCAGAATGGGCAAGG + Intronic
911235505 1:95407636-95407658 CCGGGCAAGCAGACGCTGCAGGG - Intergenic
912846066 1:113075769-113075791 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
914726031 1:150328506-150328528 TTGAAGAAGCAAAAGGTGCATGG + Intronic
914847900 1:151292919-151292941 CTGGTGGAGCAGATGGTGGATGG - Exonic
914887010 1:151593826-151593848 CTGGGGAAGCAGAAGCGGTTTGG + Intergenic
915508417 1:156371976-156371998 TTGGGGAGGCGGGAGGTGCAAGG + Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915814615 1:158952937-158952959 CTTGGGAAGCACAAGGGTCAGGG + Intronic
915858500 1:159417558-159417580 CTGAGGAGGCAGAAAGTGAAAGG - Intergenic
916237235 1:162602672-162602694 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
918127996 1:181601126-181601148 ATGGGCTAGCTGAAGGTGCAGGG + Intronic
918912340 1:190590858-190590880 CTGGGGAAGCCAAAGATGAAGGG - Intergenic
919469169 1:197957586-197957608 CAGGGGAAGCTGATGATGCAGGG + Intergenic
919816446 1:201443829-201443851 CTGGGGAAGCAGGGTTTGCAGGG - Intergenic
919909119 1:202099581-202099603 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
920044531 1:203124822-203124844 GTGGGGAGGCTGCAGGTGCAAGG + Intronic
920442398 1:205989675-205989697 CAGGGGAGGCAGAAGGGCCAGGG - Intronic
920555127 1:206899039-206899061 ATGGAGAAGGAGGAGGTGCAGGG + Intronic
921374597 1:214460795-214460817 CTGGGAAAGCTGAATGTGCTAGG - Intronic
921429741 1:215051666-215051688 CTTGGGAAGCAGCAGATGCAAGG + Intronic
921977885 1:221222221-221222243 GTGGGGAAGCAGAATGTGTAGGG + Intergenic
922207342 1:223459979-223460001 CTGGGGAAGAGGAAACTGCAAGG - Intergenic
922228009 1:223662371-223662393 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
922251866 1:223856582-223856604 CTGGGGCAGCTGGAGGAGCACGG + Intergenic
922321929 1:224496162-224496184 CTGAGGAAGCAGAAGTTCTAGGG - Intronic
922656710 1:227391086-227391108 CCCGGGAAGCAGAGGTTGCAGGG + Intergenic
923128355 1:231053063-231053085 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
923521630 1:234739428-234739450 AAGGGGCAGCAGAAGGGGCATGG - Intergenic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
923716855 1:236432311-236432333 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
924023587 1:239810241-239810263 CTGGGGAATCCGAAGCAGCAAGG - Intronic
924120259 1:240790154-240790176 CTGGGGAGGTGGAAGTTGCAGGG + Intronic
924886954 1:248229213-248229235 CTAGGGAACCAGCAGGAGCAGGG + Intergenic
1063556088 10:7081137-7081159 CTGGGTAGGCAAAAGCTGCAGGG - Intergenic
1064322904 10:14322230-14322252 CTGAGGCAGCAGAAGCAGCATGG + Intronic
1065052539 10:21810599-21810621 ATGGGGAAGCAGTACGTCCATGG - Intronic
1065127268 10:22585674-22585696 CTCAGGAGGCAGAAGTTGCAGGG - Intronic
1065212556 10:23418154-23418176 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1065742061 10:28805926-28805948 CCCGGGAGGCAGAAGTTGCAGGG - Intergenic
1065899513 10:30192602-30192624 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1066350271 10:34630920-34630942 CTTGGGAAGCTGAAGTGGCAGGG - Intronic
1066622679 10:37374772-37374794 CTGGGGGAGCAGACAGTGAATGG - Intronic
1067479292 10:46584867-46584889 CTCGGGAAACAGGAGGGGCAGGG - Intronic
1067615447 10:47756934-47756956 CTCGGGAAACAGGAGGGGCAGGG + Intergenic
1068660053 10:59614436-59614458 GTGGGGATGCAGGAGATGCAGGG - Intergenic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1070089248 10:73268767-73268789 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1070311359 10:75276122-75276144 GTGGGGACGCAGGAGGGGCAGGG + Intergenic
1070342335 10:75509378-75509400 CTGTGGAAGCAGAAAGTAAAAGG - Intronic
1070430997 10:76337500-76337522 CTGAGGAAGGAGCAAGTGCAAGG + Intronic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1070673350 10:78393687-78393709 CTGAGGATGAAGAATGTGCAAGG + Intergenic
1070740412 10:78899531-78899553 TTGTGGAAGCCAAAGGTGCAAGG - Intergenic
1072132539 10:92509515-92509537 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072453951 10:95560648-95560670 CTCGGGGAGAAGAAGGGGCACGG + Intronic
1072540411 10:96394202-96394224 CTGGGCAAGCACAAGTTGTAGGG + Intronic
1072741546 10:97912927-97912949 CTGCTGATGCAGAGGGTGCAGGG - Intronic
1073298035 10:102452918-102452940 CTGGAGAAGGAAGAGGTGCAGGG - Intergenic
1073562926 10:104512213-104512235 CTGGGGCCGCAGAAGGTTTAAGG - Intergenic
1073779099 10:106817412-106817434 GTGGGGAAGCAGGAGGGGCCTGG - Intronic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1074686840 10:115969664-115969686 TTGGGGAGGCAGAAGTTGCTAGG + Intergenic
1074904260 10:117847186-117847208 CTTGGGAAGAAGAATGTGGATGG + Intergenic
1075260328 10:120958033-120958055 CTGGGGGAGCAGTTGGTACAGGG + Intergenic
1075489486 10:122854411-122854433 CTTGGGAAGCAGGAGATGGAGGG - Intronic
1075734332 10:124654757-124654779 CTGGGGGAGCAGAAGGTCCCAGG - Intronic
1075778187 10:125001295-125001317 CTGGAGAAGCAAGAGGTGCGGGG + Intronic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1075984291 10:126770275-126770297 CTGGGGAAGAGGAAGGAGCCAGG - Intergenic
1076003939 10:126933053-126933075 CTGGACAAGCAGAAGGCCCAGGG + Intronic
1076065461 10:127444494-127444516 CTGGAGGGGCAGAAAGTGCAGGG + Intronic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1076704511 10:132293856-132293878 CCGGGGACGCAGAAGGAGCCAGG + Intronic
1076783876 10:132739450-132739472 CTGGGGGTGTAGCAGGTGCAGGG - Intronic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077020242 11:414066-414088 GTGGGGAGGGAGAGGGTGCAGGG - Intronic
1077147567 11:1052860-1052882 CCGGGGAAGCAGAAGGGAAAGGG - Intergenic
1078508323 11:11967984-11968006 CAGGGGAAGCAACAGGTGTAGGG + Intronic
1078620275 11:12900882-12900904 CTGGGGATGCAGAGGCTCCATGG - Intronic
1078664552 11:13313872-13313894 GTGGGGGAGCAAAAGCTGCAGGG - Intronic
1079709669 11:23666053-23666075 CTTGGGAAGTAGATGGGGCAGGG + Intergenic
1079832108 11:25281253-25281275 CTGGGGAAGCATAAGGGGTCAGG - Intergenic
1080365038 11:31564520-31564542 CTGGGGTAGCAGGAGGGGAAGGG - Intronic
1080391193 11:31848316-31848338 CTTGGGAAGCAGAAGAGCCAAGG + Intronic
1080540302 11:33258029-33258051 CTGGGGATGCGGATGGGGCACGG - Intronic
1080628633 11:34052622-34052644 CTGGAGAAGAAAAAGGTGCCAGG + Exonic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1080974858 11:37326581-37326603 CTGAGGGAACAGCAGGTGCAAGG - Intergenic
1081161461 11:39755237-39755259 CTCGGGAAGCACAAGGGGCCAGG + Intergenic
1081507606 11:43734542-43734564 CTGGGGCAGCTGGAGGGGCACGG - Intronic
1081527150 11:43934994-43935016 CTGGGGAAGCAGATGGGGTGGGG - Intronic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1082986729 11:59175481-59175503 CTGGGGAAGGAGAAGGGCCCAGG - Intronic
1083270421 11:61569500-61569522 CTGGGGCAGCAGAGGGAGCCAGG + Intronic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083746964 11:64742222-64742244 CTGGGCAAGCAGGAGGTGGGCGG - Intronic
1083795918 11:65016606-65016628 CTGGGGGAGGAGCAGGTTCAGGG + Intronic
1083942350 11:65903190-65903212 CTGGGGCAGCTGAGGGAGCAGGG + Intergenic
1084545242 11:69812120-69812142 AGGTGGAAGCAGCAGGTGCAAGG + Intronic
1084587604 11:70072141-70072163 CTGGGGAATCAGAACCTTCAAGG - Intergenic
1084659168 11:70537069-70537091 CTGAGGGAGCAAAAGGAGCATGG - Intronic
1085857166 11:80188334-80188356 CTGGAGAAGGAAAAGGGGCAGGG - Intergenic
1086162081 11:83733163-83733185 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1086545544 11:87963720-87963742 CCCGGGAGGCAGAAGTTGCAGGG - Intergenic
1086568613 11:88256911-88256933 TTCAGGAAGCAGAAGGTGAATGG + Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088692867 11:112342767-112342789 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1088932872 11:114369783-114369805 CTTGGGAGCCAGAAGTTGCAGGG - Intergenic
1089065619 11:115659811-115659833 CTGCGGAAGCAGAGGCTGCGGGG + Intergenic
1089130249 11:116206633-116206655 CCGTGGAAGCAGAAGGCCCATGG - Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1089217548 11:116843928-116843950 GTGGAGAAGGACAAGGTGCATGG + Intronic
1089786021 11:120907835-120907857 CTGGGCAAGCAAAAGGTAGAAGG + Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090126877 11:124095480-124095502 TTGTGGCAGCAGAAGGTACAGGG + Intergenic
1090224683 11:125063057-125063079 GTGGTGAGGCAGAAAGTGCAGGG + Intronic
1090343893 11:126051721-126051743 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
1091052163 11:132382450-132382472 CTGTGGAAGGAAGAGGTGCATGG + Intergenic
1091937292 12:4443965-4443987 CTGAAGAAGCACAAGCTGCAAGG + Intronic
1092080187 12:5709618-5709640 CTGGGGAAGCCTAAGGGGCGAGG - Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1092534612 12:9376449-9376471 CTGGGGTAGGAGCAGGTGCTGGG + Intergenic
1092701675 12:11238434-11238456 ATGGGGAAGCACAAGATGCCTGG + Intergenic
1093141566 12:15516064-15516086 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1093919925 12:24848497-24848519 CTGGGGACACAGAAATTGCAGGG - Intronic
1095815431 12:46417052-46417074 CCTGGGAAGCAGAAGTTGCAAGG - Intergenic
1096116894 12:49060249-49060271 CGGGGGGAGCAGAAGGTGGGGGG - Intergenic
1096231883 12:49901273-49901295 GAGGGGCAGCAGCAGGTGCATGG - Exonic
1096629744 12:52918527-52918549 TTGGGGCAGCAGAACATGCATGG - Intronic
1096694040 12:53337624-53337646 CTGGGAGAGCAAAAGGAGCAAGG - Intronic
1096975364 12:55696691-55696713 CTGGAGGAGGAGGAGGTGCAAGG - Intronic
1097010956 12:55953203-55953225 CTGGGGCAGCAGAAGGGTCATGG + Intronic
1097287861 12:57891426-57891448 CCCAGGAAGCAGAAGTTGCAGGG + Intergenic
1097391378 12:59019007-59019029 CTGCGCAAGCAGAAGGCACATGG + Intergenic
1097773621 12:63620171-63620193 CTGGGGAAGCAGAGAGTAAATGG - Intronic
1098328364 12:69326024-69326046 CTGGGGAGGCAGAGGTTGCAGGG + Intergenic
1098739537 12:74154951-74154973 CTGGGGAAGCTGAAGTGGGAGGG - Intergenic
1100359252 12:93861152-93861174 CTGAGGGAGCAGAGGCTGCAGGG + Intronic
1100988646 12:100228914-100228936 CTTGGGAAGCAGAAGCTTTAGGG - Intronic
1101347221 12:103897199-103897221 CTGGGGAAGCAGAAGAGGTTGGG + Intergenic
1101986502 12:109451495-109451517 CAAGGGAAGCAGAAGGGGCCCGG + Exonic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102119549 12:110429636-110429658 GTGGGGACGCAGCAGGTGCAGGG + Intergenic
1102208610 12:111107620-111107642 GTGAGGGAGCAGAGGGTGCAGGG + Intronic
1102924222 12:116814583-116814605 CTGGAGCAGAAGAAGGGGCAGGG + Intronic
1102997422 12:117361082-117361104 CTGGGGACGGAGAAGGGGCGCGG + Intronic
1103720386 12:122971527-122971549 CCTGGGAAGCAGAGGTTGCATGG - Intronic
1103936725 12:124481087-124481109 CTGAGGAAGCAGGGGGTGAAGGG + Intronic
1104207446 12:126653479-126653501 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1104648476 12:130514004-130514026 CTGGGGAGGCTGAAGGTGTGGGG - Intronic
1104813574 12:131633335-131633357 TGGGGGAGGCAGAAGGTGCCTGG + Intergenic
1104846615 12:131850289-131850311 CTGGGGGAGCAGCAGGGGCGAGG - Intronic
1104910338 12:132237216-132237238 CTGGGGCAGCTGAGGGTACACGG - Intronic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105811429 13:23999648-23999670 CTGGGGAAGCCAAAGGCTCAGGG + Intronic
1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1106230880 13:27820312-27820334 ATGGGGAGGAAGCAGGTGCAGGG + Intergenic
1106453177 13:29903104-29903126 CTAGGGAAGCACAGAGTGCAAGG - Intergenic
1107322647 13:39205820-39205842 ATGGGGAAGGAGAGGATGCAGGG - Intergenic
1107452277 13:40520615-40520637 CGAGGGAAACAGAATGTGCATGG + Intergenic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1108922081 13:55688591-55688613 CTGGGGAAGTTGAGGCTGCAGGG - Intergenic
1109069861 13:57750667-57750689 CTGGGGAAGTAGAGACTGCAGGG + Intergenic
1109781948 13:67122696-67122718 CTCGGGAGGCAGAGGTTGCAGGG + Intronic
1110413959 13:75232295-75232317 CAGAGGGAACAGAAGGTGCATGG - Intergenic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1110630218 13:77698280-77698302 CTAGGCAGGCAGAAGGTGCCCGG - Intronic
1111145303 13:84170800-84170822 CTGGGGCAGCAGAGGTTACACGG + Intergenic
1111551915 13:89824283-89824305 TAAGGGAAGAAGAAGGTGCATGG - Intergenic
1111624672 13:90769381-90769403 CAGGGGAAGCTGAAAGTGAAGGG + Intergenic
1112639222 13:101254295-101254317 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1113660361 13:112103424-112103446 CTTGGGAAGGAGGAGGTACAGGG - Intergenic
1113960140 13:114121647-114121669 CTGGGGAAGCCGAAGGTCAAAGG - Intronic
1114204780 14:20558705-20558727 CTCGGGAAGTAGAAAGGGCAGGG - Intronic
1114424412 14:22610400-22610422 CTGGAGTAGCAGCAGGTGCCTGG - Intronic
1115135831 14:30107138-30107160 CTGGGGAAGCACAAGGGGTTGGG + Intronic
1115488105 14:33932114-33932136 ATAGGGATGCAGTAGGTGCAAGG + Intronic
1116623742 14:47240118-47240140 CCAGGGAGGCAGAAGTTGCAGGG - Intronic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117275909 14:54192973-54192995 ATGGGGAAGCAGTGGGTGCTTGG - Intergenic
1117956290 14:61125995-61126017 CTGGGGAAGCAGATGTCCCAAGG - Intergenic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1118754260 14:68827225-68827247 CCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1118849760 14:69574323-69574345 CTGGGGATGGAGAAGGTGCCTGG + Intronic
1119550997 14:75514132-75514154 CTGGGGACCCAGAAGCTGCGTGG + Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120055720 14:79921672-79921694 CTGGGGAAGCAGAAGCTTAGGGG + Intergenic
1120585927 14:86312422-86312444 CTGGGGAAGCACAAGGGGTCAGG + Intergenic
1120996492 14:90421995-90422017 CCCGGGAGGCAGAAGTTGCAGGG - Intergenic
1121055678 14:90850165-90850187 CTGGGGAAGGAGAAGCTGACGGG - Exonic
1121123766 14:91392982-91393004 CTGGGGAAGGAGAAACTGCAAGG + Intronic
1121430144 14:93880755-93880777 CTGAGGATGCAGAAGGGCCAGGG - Intergenic
1121582553 14:95041738-95041760 CTGGGGTGGCAGAAGTAGCATGG - Intergenic
1121624176 14:95372455-95372477 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1121732379 14:96195448-96195470 CTTGGGAGGGGGAAGGTGCAGGG + Intergenic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1122154549 14:99742378-99742400 CTGGGGATGGAGAAGGTACATGG + Intronic
1122171786 14:99882565-99882587 CTGGGGAAGCCAAAAGTCCAGGG - Intronic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1122666530 14:103334078-103334100 CTCAGGAAGCAGAAGGGGCGCGG + Exonic
1122816734 14:104317674-104317696 CGGGTGAAGCAGAGCGTGCACGG - Intergenic
1123414960 15:20088702-20088724 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1123524302 15:21095816-21095838 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1124100695 15:26690083-26690105 CTGGAGAATGAGAAGGTACACGG + Intronic
1124448842 15:29765814-29765836 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1125194841 15:37034263-37034285 ATGGGGAAACAGAAAGTCCAGGG + Intronic
1125400722 15:39299779-39299801 TTGGGGAAGCAGAGGGTGGGGGG + Intergenic
1126497608 15:49309694-49309716 CCCGGGAAGCAGAGGTTGCAGGG - Intronic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127574701 15:60279594-60279616 CTGAGGAAGCAGAGAGTGCTAGG - Intergenic
1128352630 15:66901240-66901262 CTGGGGAACCAGAAGAGGCAGGG + Intergenic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1128557463 15:68641466-68641488 GGGAGGAAGCAGAAGGAGCAGGG + Intronic
1128564550 15:68692008-68692030 CTGTGGAAGCAGATGATGCAGGG + Intronic
1129114778 15:73359208-73359230 CTGGGGGAGCAGTGGGTGGAGGG + Intronic
1130024119 15:80256447-80256469 CAGAGGCAGCAGGAGGTGCATGG - Intergenic
1130063571 15:80586983-80587005 CTGGGGAGGAAGAGGGTGCATGG - Intronic
1130080797 15:80731532-80731554 CTGGTGAGGTAGAAGGTTCAGGG - Intronic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1131296662 15:91155235-91155257 CAGGGGAGGAAGAAGGTGTAAGG + Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131554585 15:93386105-93386127 CTCGGGAAGCAGAGGTTTCAAGG - Intergenic
1131683406 15:94747380-94747402 TTGGGGAAGCAGATGTTGAACGG - Intergenic
1132097237 15:98996727-98996749 CTGGGCAAGCAGAAGGTAAAGGG - Intronic
1132372587 15:101308753-101308775 CTGGGCCACCAGAATGTGCAAGG - Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1133654836 16:7851112-7851134 CTGGGGAGGCAGAGATTGCAGGG - Intergenic
1133838681 16:9388942-9388964 ATGGGGAAGTAGAAGTTGCTGGG + Intergenic
1133971939 16:10574495-10574517 CTGGAGGAGCAGTGGGTGCATGG - Intronic
1134794077 16:17018646-17018668 CTGGGGAAGAACAGGCTGCAGGG - Intergenic
1134850366 16:17473938-17473960 ATGGGAAAGAAGTAGGTGCAGGG + Intergenic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135416874 16:22275128-22275150 CTGGGGAAGCACATCATGCATGG + Intronic
1135971515 16:27075289-27075311 CTGTGGAAGCAGAAACTGCAAGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136026959 16:27474731-27474753 CTGGGGTGGCAGAGGGCGCACGG + Intronic
1136558492 16:31024003-31024025 CTGGGGAGGCAGAGGCTGTAGGG - Intergenic
1137258402 16:46798430-46798452 CTCGGGAGGCAGAGGTTGCAAGG + Intronic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1137864589 16:51880102-51880124 TTGGGGAAGCAGAAAGTGTCTGG + Intergenic
1137966119 16:52935612-52935634 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1138008861 16:53359945-53359967 CTGAGGAGGGAGGAGGTGCAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138399982 16:56737836-56737858 CTTGGGAGGCAGAAGGTGTGCGG - Intronic
1138436600 16:57004124-57004146 GTAGGGAAGCAGGATGTGCAAGG + Intronic
1139219138 16:65161133-65161155 CCCGGGAGGCAGAAGTTGCAGGG + Intergenic
1139446540 16:67001719-67001741 GTGGAGAGGCAGAAGGTGCTGGG - Intronic
1139620655 16:68138568-68138590 ATGGGAAAGAAGAAGGTGTATGG + Intronic
1139924730 16:70479819-70479841 CTGGGCAAGCAGAGAGTGCCTGG + Exonic
1141150311 16:81560070-81560092 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
1142724893 17:1805734-1805756 CTCAGGAAGCAGAGGTTGCAGGG + Intronic
1142850284 17:2701450-2701472 CCGGGGAACCGGAAGATGCACGG - Exonic
1142863113 17:2775527-2775549 CAGGGGGAGCAGCAAGTGCAAGG + Intergenic
1143129125 17:4665033-4665055 CTAGGGAAGCAGAAGCAACAAGG + Intergenic
1143593699 17:7901328-7901350 CTGCGAAAGCTGAAGGAGCAAGG + Exonic
1144121604 17:12159817-12159839 CTCAGGAGGCGGAAGGTGCAGGG - Intergenic
1144730148 17:17521352-17521374 CTGGGGATGCAGGCTGTGCAGGG - Intronic
1144959536 17:19037329-19037351 CTGGGTATGCAGAAGTTGCCTGG + Intronic
1144975623 17:19137195-19137217 CTGGGTATGCAGAAGTTGCCTGG - Intronic
1145014539 17:19387671-19387693 CTGGGGGAGCAGAAGGCTGAGGG + Intergenic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145111036 17:20161868-20161890 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1145823640 17:27859895-27859917 CTTAGATAGCAGAAGGTGCATGG - Intronic
1146116812 17:30147885-30147907 CCCGGGAAGCAGAGGTTGCAGGG - Intronic
1146354864 17:32125464-32125486 CTGGAGAAGCAGCAGGGGCCTGG - Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146802965 17:35842010-35842032 CTGGGGAAGGAGATGGTGTCAGG - Intronic
1147258435 17:39195561-39195583 CTGGGGAGGGAGTAGGGGCATGG + Intronic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147542199 17:41369725-41369747 CTGGGCAGGCAGAAGTTGTAGGG + Exonic
1147545412 17:41397514-41397536 CTGGGCAGGCAGAAGTTGTAGGG + Exonic
1148045084 17:44738535-44738557 CTCAGGAAGATGAAGGTGCAGGG - Intronic
1148334842 17:46834308-46834330 CTGGAGAAGCAGGTGGTGCCTGG + Intronic
1148376229 17:47149001-47149023 CTCGGGAAGCAGAGGTTGCAGGG + Intronic
1148570753 17:48666916-48666938 CTGGAGAAGCAAGAGCTGCATGG - Intergenic
1148587691 17:48792431-48792453 GTGTGGAAGGAGGAGGTGCAGGG + Intronic
1148640500 17:49183836-49183858 CTGGGGCACCCGAGGGTGCAGGG + Intergenic
1148670281 17:49404995-49405017 CTGGGGCAGCTGGAGGAGCACGG + Exonic
1148677199 17:49452313-49452335 CAGGGGAAGCAGGAAGGGCAGGG - Intronic
1149939019 17:60843290-60843312 CACGGGAAGCAGAGGTTGCAGGG - Intronic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1151199235 17:72455646-72455668 CTTGGGAGGCAGATGCTGCAAGG - Intergenic
1151268251 17:72973257-72973279 CTGGGTCAGCAGAAGGACCAGGG + Intronic
1151475629 17:74343001-74343023 CTGGGGCAGAACAAGGTGGAGGG - Intronic
1151635710 17:75346418-75346440 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1151670264 17:75568400-75568422 CTGTGGAATCAGAAGCTCCAGGG - Intronic
1152143054 17:78549841-78549863 CAGGGGCCGCAGCAGGTGCAGGG - Intronic
1152175407 17:78783543-78783565 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
1152318136 17:79592875-79592897 CTGGGCAGGGAGAAGGGGCAGGG - Intergenic
1152447267 17:80353081-80353103 CTGGGGGAGCAGGTGGTGGAAGG + Intronic
1152579819 17:81160898-81160920 CGGGGGAGGCAGAGGGTCCACGG - Intronic
1152688902 17:81708526-81708548 CTGGGGGAGCGGGAGGGGCAGGG + Intergenic
1153528067 18:6016212-6016234 CCGGGGGAGCAGCAGGGGCACGG + Intronic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1154161814 18:11986177-11986199 CTCGGGAAGCATAACCTGCAAGG - Intronic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1156479124 18:37425178-37425200 CTGGGCAACCTGAAGGTGCTCGG + Intronic
1157190706 18:45579079-45579101 CAGAGAAAGCAGAAGCTGCAAGG + Intronic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157452607 18:47799777-47799799 CTAGGGGAGAAGAAGGTGCAGGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158272102 18:55727671-55727693 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1158790748 18:60777590-60777612 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1159438698 18:68449823-68449845 CTGGGGAAGGTGAAGTTTCATGG + Intergenic
1159706991 18:71702855-71702877 CTGGGGAAGCAGAAGACACATGG + Intergenic
1159796512 18:72850942-72850964 CTGGGGAATCTGAATGTGCATGG + Intronic
1160764274 19:800401-800423 CTGGAGAAGAAGAAGGTCCTGGG + Intronic
1160839837 19:1141288-1141310 CTCGGGAAGCAGAGGTTGCAGGG - Intronic
1160877910 19:1305945-1305967 CTGGGGAAGAAGCAGGTGTCAGG - Intergenic
1161124085 19:2546299-2546321 CTGGAGAGGCTGCAGGTGCAGGG - Intronic
1161335048 19:3708516-3708538 CTGGGCAGGCAGCAGGTGCCAGG - Intronic
1161379850 19:3959123-3959145 CTGGAGCAGGAGAAGCTGCAGGG - Exonic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG + Intronic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1162933856 19:13970906-13970928 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1163168540 19:15514593-15514615 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163297709 19:16422880-16422902 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163432010 19:17273881-17273903 CTGGGGAGGCAGAGAGTACAGGG - Intronic
1163518896 19:17780485-17780507 CTGGGGGGGCAGAATTTGCAGGG - Intronic
1163710436 19:18843351-18843373 CTGAGGGAACAGCAGGTGCAAGG + Intronic
1163793114 19:19319987-19320009 CTGGGGAAGCAGAAAGGCCAAGG + Intronic
1164854326 19:31509451-31509473 CTGGAGAACTAGAAGGTGCGTGG + Intergenic
1165076315 19:33281668-33281690 CTGGGGAGGCAGCAGGAGCCCGG + Intergenic
1165450364 19:35878867-35878889 CTGGGGGAGCAGGAGGTGTCAGG - Intronic
1165504212 19:36214614-36214636 CAGGGGAGGCAGAAGGTGAGGGG - Exonic
1165731272 19:38147135-38147157 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1165742159 19:38210885-38210907 CAGGGGAAGAAGGAGGTGGATGG + Intergenic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166357604 19:42236362-42236384 CTGGGGTTGCAGAAGCTGCCAGG - Intronic
1166384990 19:42375874-42375896 CTGGGGATCCAGGAGGAGCAGGG + Exonic
1166388880 19:42397765-42397787 TTGGAGGAGCAGAAGGTGCCAGG + Intergenic
1166534640 19:43564932-43564954 CTCGAGAAGCCGAAGATGCAAGG - Intronic
1166983856 19:46648593-46648615 CTGGGGGTGGAGCAGGTGCAGGG - Exonic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167294149 19:48639668-48639690 CTGGGGGAGGAGAAGGTTGAGGG - Intronic
1167412480 19:49353172-49353194 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1167550327 19:50155834-50155856 CGTGGGAACCAGATGGTGCAGGG - Intronic
1167769899 19:51508582-51508604 TGGGGGTAGCAGAAGGAGCAGGG - Intergenic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
1167874631 19:52401480-52401502 CTGGGGAAGCAGATCAGGCAGGG - Intronic
1168077630 19:53990148-53990170 CTGGGGGAGCTGAAACTGCATGG + Exonic
1168242909 19:55096182-55096204 TTGGGGAAGGAGAGGGTGCTGGG + Intronic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
925038319 2:709287-709309 CCGGGGAAGAAGAAGGTGGAAGG - Intergenic
925615506 2:5741074-5741096 CTGCGGAAGCAGAGGATGGAAGG - Intergenic
926361704 2:12094152-12094174 ATGGTTTAGCAGAAGGTGCAGGG + Intergenic
927045180 2:19271175-19271197 CCTGGGAAGCAGAGGTTGCAGGG - Intergenic
927069030 2:19506160-19506182 CTGGGAAAGCTGAACGTGTATGG + Intergenic
927173608 2:20390378-20390400 CTGGAGAGGCAGAGGTTGCAAGG - Intergenic
927179293 2:20433174-20433196 CTGGGCAAGGAGAATGTTCAGGG - Intergenic
927704443 2:25288324-25288346 CTGGGGAGGCAGCAGGAGAATGG + Intronic
927939927 2:27097126-27097148 CTGGGGAAGCAGGAAGGACAGGG + Intronic
928229115 2:29480873-29480895 CTGGTGAATCAGAATCTGCAAGG - Intronic
929532756 2:42762948-42762970 ATAGGGAAGCTGAAAGTGCAGGG - Exonic
929666572 2:43838502-43838524 CTGGGGGAGCAGCAGCAGCAAGG + Intronic
929724716 2:44412998-44413020 CCCGGGAAGCAGAGGTTGCAGGG + Intronic
929934136 2:46282065-46282087 ATGGGGAAGGAGAAGGAACAAGG + Intergenic
930196123 2:48512205-48512227 CTGGGCAAGCAGAAGGATTATGG - Intronic
930209319 2:48617961-48617983 AGGGGGAAACAAAAGGTGCAGGG - Intronic
930866509 2:56127116-56127138 CAGGGGAAGCAAAAGATCCAAGG + Intergenic
931745096 2:65285062-65285084 CCAGGGAGGCAGAAGTTGCAGGG - Intergenic
931778028 2:65556677-65556699 TTGCGGAAGCAGGAGGTGGATGG + Intergenic
932112876 2:69017423-69017445 CAGGGGAAGAAGGAGTTGCAGGG - Intronic
932366072 2:71154364-71154386 CTGAGGAGGGAGGAGGTGCAGGG - Intergenic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932759250 2:74428738-74428760 CTGGGGGAGGAGGAAGTGCAGGG + Intronic
932890489 2:75592109-75592131 CTGGTCAAGGAGAAGTTGCAAGG + Intergenic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934731614 2:96662054-96662076 GTGTGGAAGAAGAAGGGGCATGG + Intergenic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935618202 2:105107121-105107143 GTGGGGAGGCAGAAGGAGCGAGG - Intergenic
935837928 2:107075643-107075665 CTGGTGAGGCAGGTGGTGCAGGG + Intergenic
935924674 2:108054248-108054270 CTGGGAAAGCACAGTGTGCAAGG + Intergenic
936090375 2:109498291-109498313 CTGGGGAAGCAGAACAGGCCAGG - Intronic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936674528 2:114699787-114699809 CAGAGGAACCAGAAGGGGCAAGG + Intronic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
937100782 2:119266326-119266348 CTCGTGAAGCACAAAGTGCAAGG - Intergenic
937344322 2:121114979-121115001 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
937402147 2:121593541-121593563 CCGGGGAGGCGGAAGTTGCAGGG + Intronic
937638062 2:124179233-124179255 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
937673619 2:124564999-124565021 TTGGGGATGCAGAAAGAGCATGG + Intronic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
939941922 2:148361868-148361890 CTGGGGAAGCACAAGGGGTTGGG + Intronic
940227420 2:151414208-151414230 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
940485022 2:154287400-154287422 CTGGGGCAGCTGGAGGAGCATGG - Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940713238 2:157187538-157187560 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
941167873 2:162103013-162103035 CTGAGGAAGCTGATGCTGCATGG - Intergenic
941666395 2:168247391-168247413 CTGGGGAAGCTGGACGTGCACGG + Exonic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
944155613 2:196604270-196604292 CTGGGGCAGTGGAAGGGGCATGG - Intergenic
944686886 2:202125540-202125562 CTGGGGAAGGATAATTTGCAGGG + Intronic
944695853 2:202200004-202200026 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
945293462 2:208147597-208147619 CTGGGGTAGAGGAATGTGCAGGG - Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
947267379 2:228298681-228298703 CTGGGGATACAGAAGTTGAAAGG - Intergenic
947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
947784559 2:232804565-232804587 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948130807 2:235599381-235599403 CTGGGGAAGTGGATGCTGCAGGG + Intronic
948214926 2:236221571-236221593 CTGGGGAGGTGGAAGGTGAAAGG - Intronic
948272276 2:236683756-236683778 CTGGGCAAGCATCAGGAGCAGGG - Intergenic
948449724 2:238061402-238061424 CTGGGGAAGCAGAGCCTGCCAGG + Intronic
948705902 2:239792355-239792377 CTGGGAAGGCAGAAGGGGCTGGG - Intronic
948771343 2:240252713-240252735 CTGGGGATGGAGACGGTGCCGGG + Intergenic
948948285 2:241232974-241232996 CTGGGGAGGAAGAAGGGGAAGGG + Intronic
1168812872 20:717660-717682 CTGAGGAAACAGCACGTGCAAGG - Intergenic
1168828561 20:831179-831201 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1169318230 20:4610597-4610619 CTGGAGGAGCAGTGGGTGCAGGG - Intergenic
1169418545 20:5439657-5439679 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1170786126 20:19469185-19469207 CTGGGGATGAAGGATGTGCATGG + Intronic
1172232854 20:33348608-33348630 CTGAGGAGCCAGAAGGAGCAGGG + Intergenic
1172659311 20:36556752-36556774 CTGGGAAAGCAGACGGGGCCAGG - Intergenic
1172807684 20:37624342-37624364 CTGGGGAGCCAGAAGATTCATGG + Intergenic
1173010341 20:39176355-39176377 AGGGGGAACCAGCAGGTGCAAGG - Intergenic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173632665 20:44528339-44528361 CTGGGGAGGCAGAGGCTGCAGGG + Intergenic
1173646211 20:44634687-44634709 CTGGGGCAGAAGAAGGTCCCTGG + Intronic
1174130806 20:48342153-48342175 CTGGAGGAGCAGACAGTGCAGGG - Intergenic
1174445898 20:50590888-50590910 CATGGGAAGCAGAGGCTGCAGGG - Intronic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175382806 20:58575372-58575394 CTAGGGAGGCAGAGGTTGCAGGG + Intergenic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1177946407 21:27475305-27475327 GTGGGGAGGCAGAAAGAGCAGGG - Intergenic
1178405862 21:32322827-32322849 CTGGGGAGGCGGAGGGTGCGAGG - Intronic
1178618246 21:34152788-34152810 CAGGGGAAGCAGAGGCTTCAAGG - Intergenic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179953653 21:44725720-44725742 CCCGGGAAGCAGAGGCTGCAGGG + Intergenic
1180035318 21:45245404-45245426 CTGGGGATGGAGATGGTGTACGG - Intergenic
1180043779 21:45293577-45293599 CTGGGGAACCGCAACGTGCAGGG - Intergenic
1180047032 21:45311682-45311704 GTGGTGGAGCAGAGGGTGCATGG - Intergenic
1180197897 21:46208393-46208415 CTGGAGAGGCAGAACGTGCCTGG + Intronic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181355519 22:22294048-22294070 CTAGGGCAGCAGCAGGGGCAGGG + Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182342730 22:29637064-29637086 CTGGGCAAGCAGAAGTTACCAGG + Intronic
1183038961 22:35161866-35161888 CTGTGGGAGTAGAAGGTGTAGGG - Intergenic
1183598575 22:38826841-38826863 CTGGGCATGCAGCAGGTGCCTGG - Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183786883 22:40034480-40034502 CTGGGAGAGCAGAAGCTGCAAGG - Exonic
1184435039 22:44467701-44467723 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
1184616184 22:45640150-45640172 GTGGGGAGGCAGAGGGTGCCAGG + Intergenic
1184871027 22:47238618-47238640 CAGGGGAAGCAGAAAGTCCCTGG - Intergenic
1184974478 22:48051383-48051405 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
949778232 3:7655740-7655762 CTGGGGAAGCAGAAGATCATAGG - Intronic
950483057 3:13256651-13256673 CTGGGGATGCAGAAGGGACCAGG + Intergenic
950741972 3:15059226-15059248 ATGGGGAAGCCAAAGGTGCCAGG + Intronic
950876187 3:16276680-16276702 CGGGGCCAGCAAAAGGTGCAAGG + Intronic
951963215 3:28352057-28352079 CGGGGGAAGGAGAAAGTACAGGG - Intronic
952292881 3:32035484-32035506 CTTGGGAGGCAGAGGATGCAGGG + Intronic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952782939 3:37121692-37121714 CTGGGAAAGGAGAAAGTACATGG + Intronic
953317062 3:41938604-41938626 CTCAGGAGGCAGAAGTTGCAGGG + Intronic
953411530 3:42693039-42693061 GTGGGGATACAGAAGGTGCCAGG - Intronic
954212130 3:49103828-49103850 CTGGGGAGGCAGACGATGCCTGG + Intronic
954463284 3:50639814-50639836 GTGTAGAAGCAGAAGGTGCTGGG - Intronic
954477637 3:50763355-50763377 CCCGGGAAGCAGAAGTTGCAGGG - Intronic
955046300 3:55363548-55363570 GTGGGGAAGCATAAGGTGCTAGG - Intergenic
955690005 3:61581683-61581705 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
955732449 3:62000863-62000885 CTGGGAAAGCAGATGATCCAGGG - Intronic
955882527 3:63563160-63563182 CTTGGGGATAAGAAGGTGCATGG - Intronic
956056396 3:65303166-65303188 CTGGTGAAGCAGAATGGACAGGG + Intergenic
957739230 3:84241932-84241954 CTCGGGAGGCAGAGGTTGCAGGG + Intergenic
958188406 3:90153119-90153141 CTAGGGAAGCAGAAGCTGAAAGG + Intergenic
958410931 3:93814922-93814944 CTAGGGAAGCAGAGGCTGAAAGG + Intergenic
958788396 3:98623729-98623751 CTGGGGAGGCAGCAGCTCCAGGG - Intergenic
958828893 3:99064602-99064624 CTGGGGAAGCACAAGGGGTCAGG - Intergenic
959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG + Intronic
960417704 3:117405486-117405508 CTGAGGAGGCAGCAGGGGCATGG + Intergenic
960636798 3:119792528-119792550 CTGGGGCAGCTGGAGGAGCACGG - Intronic
961534292 3:127560197-127560219 CTGGGGACACAGGAAGTGCAGGG - Intergenic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
962655689 3:137542238-137542260 CTGTGGCAGCACAGGGTGCAGGG + Intergenic
963124677 3:141804173-141804195 GTGTGCAAGCTGAAGGTGCAAGG - Intronic
964548930 3:157865479-157865501 CTGGAGAAGCAGCAGGGCCAGGG - Intergenic
965695273 3:171401494-171401516 CTGAGGAAGGAGAGGGTTCAGGG + Intronic
967037008 3:185655508-185655530 CTGGGGAAGTAGAAGGTTGCTGG + Intronic
967138685 3:186534249-186534271 GTTGAGAAGCAGAAGTTGCACGG + Intergenic
967808184 3:193733343-193733365 CTGGGTAGGGAGCAGGTGCAGGG + Intergenic
967820404 3:193834396-193834418 CTGGGGGTGCAGGAGATGCAAGG - Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968387075 4:151176-151198 CCCGGGAGGCAGAAGTTGCAGGG - Intronic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968516638 4:1018309-1018331 CTAGGGAAGGAGGAGGAGCAGGG - Intronic
968567614 4:1322489-1322511 CTCCGGAAGATGAAGGTGCACGG + Exonic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969352266 4:6604546-6604568 AGCGGGGAGCAGAAGGTGCAGGG + Intronic
969393556 4:6906794-6906816 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
969457458 4:7308299-7308321 CTGGAGCAGCAGAAGGGGCAGGG - Intronic
969462089 4:7334281-7334303 CTGGGGAAGGAGGAGGTCCAAGG - Intronic
969696326 4:8737193-8737215 CTGGGGACGCAGAGGCTGTAAGG + Intergenic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970501014 4:16677182-16677204 CTGGGGAGGAAGAAGATGAATGG + Intronic
970708945 4:18839238-18839260 CCGGGGAGGCAGAGGATGCAGGG + Intergenic
970882979 4:20953604-20953626 CCCGGGAGGCAGAAGTTGCAGGG + Intronic
971265279 4:25091444-25091466 CAGGGGAGGAAGAAGGGGCAGGG - Intergenic
972495408 4:39629697-39629719 CTGGGGAGGCTGAGGCTGCAGGG - Intronic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
973010429 4:45065957-45065979 CAGGTGAAGCAGAAAATGCAAGG + Intergenic
974508920 4:62811558-62811580 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
975329648 4:73099447-73099469 GTGGGGATGCAGCATGTGCAGGG - Intronic
975367964 4:73550827-73550849 CTCGGGAAGCACAAGGTGTCAGG + Intergenic
975758925 4:77598881-77598903 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
975940504 4:79638921-79638943 CAGAGGGAGCAGCAGGTGCAAGG - Intergenic
976048147 4:80977680-80977702 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
976753830 4:88477481-88477503 GAGGGGAAGGAGAAGGTGAAGGG + Intronic
979237317 4:118415906-118415928 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
979996304 4:127435548-127435570 CTGGGGAAGCAGAGGTTGGGAGG + Intergenic
981656428 4:147117069-147117091 CTGGTGTAGCAGAAGGATCATGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982811035 4:159826172-159826194 CAGGGGAAGCAGAACATGAAGGG + Intergenic
984236539 4:177165544-177165566 CTGGGGAAGCTGCAGGAGTATGG + Intergenic
985008713 4:185560531-185560553 CTGGGAGACCTGAAGGTGCAGGG - Intergenic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
985566512 5:621015-621037 ATGGGGAAGAAGAGGGTGCAGGG + Intronic
985746693 5:1652168-1652190 CTGGGGAAGAAGGGGGTGCCTGG + Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985790890 5:1926387-1926409 CAGGGGAAGGGGAAGGCGCAGGG - Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
986927675 5:12777779-12777801 CCGGGGAGGCTGAAGTTGCAAGG - Intergenic
987062812 5:14258660-14258682 CTGGGGAGGTAGAAGGTGAGAGG - Intronic
988006328 5:25416546-25416568 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
988592294 5:32559068-32559090 CTCGGGAGGCAGAGGTTGCAGGG + Intronic
990415789 5:55585271-55585293 CTGTGCAAGAAGCAGGTGCAGGG + Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991603659 5:68378868-68378890 CTGGGGAAGCAGACAGGGAAAGG + Intergenic
991698633 5:69297139-69297161 CTTGGGAGGCAGAAGTTGCAGGG - Intronic
993001720 5:82387831-82387853 CTGGGGGAGCTGACGGTGCATGG - Intergenic
993052703 5:82944241-82944263 CTGGGGAAGCACAAGGGGTCAGG + Intergenic
994000314 5:94772063-94772085 CTGGGAAAGTACAGGGTGCACGG - Intronic
994002528 5:94796977-94796999 CTGGGGAAGAAAAATGTCCATGG + Intronic
994236784 5:97371703-97371725 CCGGGGAGGCAGAAATTGCAGGG + Intergenic
995591061 5:113699941-113699963 CTGTGGGAGAAGCAGGTGCAGGG - Intergenic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
996325181 5:122265038-122265060 GTGGGGGAGGAGAAGGTGTATGG - Intergenic
997632180 5:135377192-135377214 CCTGGGAAGGAGAAGGTGCCTGG + Intronic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997885321 5:137624954-137624976 CTGGGGTAGCACAAAGGGCATGG + Intronic
998174477 5:139893528-139893550 CTGGGGAAGGAGCTGCTGCAGGG - Intronic
998228486 5:140344758-140344780 AAGGGGAGGGAGAAGGTGCAGGG + Intronic
998423108 5:142005411-142005433 CTGGGGAGGCAGAAGCTGTTTGG - Intronic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999379259 5:151108831-151108853 CTGGGGTAGTAAAAGGAGCACGG + Intronic
999480150 5:151940820-151940842 CTGAGGAGGCAGAAAGTCCAGGG - Intergenic
999762873 5:154716193-154716215 CCCGGGAGGCAGAGGGTGCAGGG - Intronic
1000072963 5:157758188-157758210 CCTGGGAGGCAGAAGTTGCAGGG - Exonic
1000507382 5:162138001-162138023 CTTGGGGAGCACAAGGTACATGG - Intronic
1000798455 5:165693673-165693695 CCTGGGAAGCAGAAGGTGTCAGG - Intergenic
1000924862 5:167180866-167180888 CTGGGGTGGCAGAAGCTGAAGGG + Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001943288 5:175755881-175755903 CCTGGGAAGCAGAGGCTGCAGGG + Intergenic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1002142459 5:177151462-177151484 CCCGGGAGGCAGAAGTTGCAGGG - Intronic
1002296418 5:178233513-178233535 CTGGGACTGCAGCAGGTGCAGGG + Intergenic
1002519830 5:179786162-179786184 CCTGGGAAGCAGAGGTTGCAGGG + Intronic
1002673131 5:180886355-180886377 CCTGGGAAGCACAAGGGGCAGGG - Intergenic
1004215458 6:13699784-13699806 CTTGGGAGGCAGAAGTTGCAAGG + Intronic
1004753399 6:18586260-18586282 CTGGGGAAGCAGTAGGCACCTGG + Intergenic
1004962762 6:20810241-20810263 CTGGGGCAAGAGAAGGGGCAAGG - Intronic
1004997798 6:21210943-21210965 ATGAGGAAGCAGATGGGGCATGG - Intronic
1005473401 6:26184088-26184110 CCCGGGAAGCAGCAGGCGCACGG - Exonic
1005856030 6:29863965-29863987 CTGGGGAGGCAGGAGGTAAAGGG + Intergenic
1006474369 6:34245185-34245207 GTGGGGACGCAGCAGGTGCAGGG - Exonic
1006487963 6:34360152-34360174 CTGGGGAGGTTGAAGCTGCAAGG + Intronic
1007115657 6:39341315-39341337 CTGGAGAAGCACAAGCTCCAAGG - Intronic
1007172454 6:39873363-39873385 CGAGGGAAGCAGCAAGTGCAGGG - Intronic
1007773333 6:44208582-44208604 CTGGGGAAGCTGGAGGAGCTTGG - Intergenic
1008785037 6:55158187-55158209 CTGGGGAAGCACAAGGGGATGGG + Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010107561 6:72187567-72187589 CTCAGGAAGCAGAGGTTGCAGGG - Intronic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010806587 6:80244191-80244213 CTGGTGAAGCAGGAGATGGAAGG + Intronic
1011519978 6:88194533-88194555 CAGGGCAAGCTGAAGGTGCTGGG + Intergenic
1011714873 6:90094785-90094807 CAGGGGAACCAGAAGTGGCATGG - Intronic
1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1013068983 6:106711188-106711210 ATGGGAAAGAAGAAGGGGCAGGG - Intergenic
1013233962 6:108180973-108180995 CTGGGGAAGGAGAAGAAACAGGG - Intronic
1014602724 6:123434941-123434963 CTGGGGAAGTTGTAGGTGGATGG - Intronic
1015517553 6:134099101-134099123 GTGTGGAAGAAGAAGGTCCAAGG - Intergenic
1015737129 6:136413084-136413106 CTTGGGAGGCAGAAGATGCAGGG + Intronic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1016829204 6:148416941-148416963 CTGGGCAAGCAGCAGGTGATGGG + Intronic
1016932159 6:149422184-149422206 CTGGGGAAATCGAAGCTGCAGGG - Intergenic
1017008178 6:150043335-150043357 CTGGGGCAGCTGGAGGAGCACGG - Intergenic
1017097869 6:150820787-150820809 CCTGGGAAGCAGAGGTTGCAAGG + Intronic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1017705880 6:157122602-157122624 CTGGGGCAGCAGAACCTGCCAGG + Intronic
1018050836 6:160006272-160006294 CTGGAGACGCGGAAGGCGCATGG - Intronic
1018554038 6:165032647-165032669 CTGGGGAAACATCAGGGGCAAGG - Intergenic
1018606790 6:165606029-165606051 CTGGGCACGCAGCAGGTGCGTGG + Intronic
1019192591 6:170261851-170261873 ATGGAGAATCAGCAGGTGCACGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019301576 7:306835-306857 CTGGGGGAGCTGAGGGTGCCCGG - Intergenic
1019302255 7:311789-311811 CTGGGGGAGCTGAGGGTGCCCGG + Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1019740718 7:2671569-2671591 CGGGGGAGGCAGAGGGTGCGTGG + Intergenic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1020058275 7:5133644-5133666 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1020063464 7:5169649-5169671 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1020550864 7:9602798-9602820 CTGTGGTGGCAGAAGGTGAAAGG - Intergenic
1021302636 7:18990853-18990875 CTTGGGAAGCACAAGGGGCCAGG - Intronic
1022021468 7:26403448-26403470 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1022340411 7:29462599-29462621 TGGGGGAAGCATAAGCTGCATGG - Intronic
1022530007 7:31061157-31061179 CTGAGGTCGCGGAAGGTGCAGGG + Intronic
1022933195 7:35143923-35143945 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1023904890 7:44514935-44514957 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1023985099 7:45089384-45089406 CTGACCAAGCAGAGGGTGCAGGG + Intergenic
1024020341 7:45362640-45362662 CTAGAGAAGCAGATGCTGCAAGG + Intergenic
1024118322 7:46213353-46213375 CTCAGGAAGCAGAAGGAGCAGGG + Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024160150 7:46665817-46665839 TTGGGGAAGCAGATGGTGTTTGG + Intergenic
1024852787 7:53741026-53741048 CTGTGGCATCAGTAGGTGCAGGG - Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1025140530 7:56459786-56459808 TCTGGGAAGCAGAAGTTGCAGGG + Intergenic
1025199856 7:56955474-56955496 CTGGGGAGGCAGAAGGAGAGGGG + Intergenic
1025672090 7:63621458-63621480 CTGGGGAGGCAGAAGGAGAGGGG - Intergenic
1026311775 7:69192054-69192076 CTGGGGAGGGAGGAGCTGCAGGG + Intergenic
1026487000 7:70830247-70830269 CTTGTGAAGCAGATGGTGAAGGG - Intergenic
1027825658 7:83112131-83112153 CCCGGGAAGCAGAGGTTGCAGGG - Intronic
1028741215 7:94278052-94278074 GTATGGAAGCAGAAGTTGCAGGG + Intergenic
1028877292 7:95837777-95837799 CTGGGGAAGCACAAGGGGTCAGG - Intronic
1028989796 7:97036764-97036786 CTGAGGAGGCAGAAGTTGCAGGG - Intergenic
1029416781 7:100448112-100448134 CCCGGGAAGCAGAAGTTGCAGGG + Intergenic
1029531424 7:101127768-101127790 CTGGGGAGGCGGAGGCTGCAGGG + Intronic
1029829117 7:103236689-103236711 CTGGGGAAGCAGAGAGTAAATGG - Intergenic
1029859201 7:103551198-103551220 GAGGGGCAGCAGAAGGTGCCAGG + Exonic
1030564601 7:111137898-111137920 CCTGGGAAGCAGAGGTTGCAGGG - Intronic
1030893719 7:115030896-115030918 CTGGGGAAGCACAAGGGGTCAGG - Intergenic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1031290487 7:119928363-119928385 CTGTGGATTCAGAAGGTGCCAGG + Intergenic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1033652159 7:143351785-143351807 CTGGGGAAGGAGATGGCACAGGG - Exonic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034405607 7:150900702-150900724 CAGAGGAATCAGAAGATGCAAGG - Intergenic
1034534200 7:151716854-151716876 CTCTGGAAGCTGAAGGTGCGGGG - Intronic
1034840514 7:154391316-154391338 CTGGGGATGGAGGAGGTACAGGG - Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035141462 7:156766698-156766720 GTGGGCAAGCAGGAGGAGCAGGG + Intronic
1035458914 7:159027379-159027401 GATGGGAGGCAGAAGGTGCAGGG - Intergenic
1035683045 8:1502870-1502892 CTGGGGCAGCAGGAGGTACCTGG + Intronic
1037706784 8:21322083-21322105 TCGGGGAAGCAGAAGCTCCAAGG + Intergenic
1037762497 8:21751160-21751182 CTTAGGAAGCAGCTGGTGCAGGG + Intronic
1038327219 8:26580165-26580187 CTGTGGAGGCAGGAGGTGAAGGG + Intronic
1038426926 8:27469677-27469699 CTGGGGTAGAGGAAGGAGCAGGG + Intronic
1040352964 8:46587029-46587051 CTGGTGAGACAGAAGGTGTAAGG - Intergenic
1041007679 8:53511045-53511067 TAGGGGAAGCAGCAGGTCCATGG + Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041673828 8:60517641-60517663 CTAGGGGAGCAGAAGGTGTTGGG + Intronic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1042087067 8:65120835-65120857 CTTGGGAAGCACAAGGGTCAGGG + Intergenic
1042721196 8:71828377-71828399 CCGGGGAAGCAGATGCTGCCCGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043403091 8:79902922-79902944 CCCGGGAAGCAGAGGTTGCAGGG - Intergenic
1044423411 8:92024664-92024686 CTGGGGATGCAAATGGTTCAAGG - Intronic
1045505016 8:102772140-102772162 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1045941705 8:107746225-107746247 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1047811517 8:128414905-128414927 CAGGGGAAGGAGAAAGTGAAGGG + Intergenic
1047869753 8:129069867-129069889 GTGGGGAAGTAGGAGGTACAAGG - Intergenic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1048982864 8:139712472-139712494 CTGGGGACCCAGAAGGTACGTGG - Intergenic
1049067637 8:140330001-140330023 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1049509829 8:143021922-143021944 CTGGGGCAGGTGGAGGTGCAGGG - Exonic
1049528613 8:143142412-143142434 CTGGGGAAGGAGGAGGGACAGGG - Intergenic
1049565905 8:143338880-143338902 CTGGGGAAGAAGAGGGCACAAGG - Intronic
1049580304 8:143407896-143407918 CCGGAGAAGAAGCAGGTGCACGG + Intergenic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1050847491 9:10240387-10240409 CTAGAGAAACAGAAGGTCCAGGG + Intronic
1050995924 9:12217651-12217673 CCCGGGAGGCAGAGGGTGCAGGG - Intergenic
1051185896 9:14461024-14461046 CTGAGGAACAAGAGGGTGCACGG - Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052433085 9:28392524-28392546 ATGGGAGAGCAGCAGGTGCACGG + Intronic
1052784058 9:32812339-32812361 CCTGGGAAGCAGAGGTTGCAGGG + Intergenic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1054581827 9:66922280-66922302 CCCGGGAAGCAGAAGGGGCCAGG - Intronic
1054866914 9:70012323-70012345 CTGGGGTCACAGAAGTTGCAAGG + Intergenic
1055185291 9:73444556-73444578 CTGGGGATTGAGAAGGTGTATGG + Intergenic
1055634986 9:78268215-78268237 CTGGTGAATAAGAAGGTGAAGGG + Intronic
1055792235 9:79935203-79935225 ATGGGTAAGCAAAAGGAGCAGGG + Intergenic
1056365537 9:85900760-85900782 TTGGGGAAGAAGTAGGTGAATGG - Intergenic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057175119 9:92991152-92991174 CTAGGGAGGCAGAGGTTGCAGGG - Intronic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057558824 9:96111352-96111374 CTGTGGAAGCAGAAAGTGAGGGG + Intronic
1057942464 9:99296809-99296831 CTGGGGAAGAAGACGCTGAAAGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058516654 9:105782863-105782885 CTTGGGAAGCACAAGGGTCAGGG - Intergenic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060176071 9:121498621-121498643 CTGAGGAAGCAGGAGATGTAGGG - Intergenic
1060216771 9:121743135-121743157 ATGAGGAAGCTGAGGGTGCAAGG - Intronic
1061325564 9:129861806-129861828 CTGGGGAAGTTGTACGTGCAAGG + Intronic
1061364294 9:130163388-130163410 CCTGGGAAGCAGAGGCTGCAGGG - Intergenic
1061390487 9:130314953-130314975 CTGGGGGAGCAGCAGGCGCAGGG + Intronic
1061545877 9:131304018-131304040 ATGGGGAAGCACAGGGGGCAGGG + Intronic
1061618463 9:131795206-131795228 CTGAGGAAATAGCAGGTGCAAGG - Intergenic
1061908682 9:133711711-133711733 CTGGGGAGGCAGTAGGTGGGTGG - Intronic
1061938529 9:133871878-133871900 CTGGGGGCTCAGAAGGGGCAGGG - Intronic
1062112483 9:134789772-134789794 CGGGGGCTCCAGAAGGTGCAGGG - Intronic
1062198887 9:135290282-135290304 CTGTGGAAACAGAAGGTCCTTGG - Intergenic
1062403878 9:136384352-136384374 GTGGGGCAGCAGGAGGAGCACGG + Intronic
1062571420 9:137187431-137187453 GCGGGGAACCAGAAGGAGCAAGG + Intronic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1203784675 EBV:120893-120915 CACGGGACGCAGAATGTGCAGGG - Intergenic
1203408044 Un_KI270538v1:66095-66117 CTTGGGAAGCACAAGGTGTCAGG + Intergenic
1187113108 X:16321844-16321866 CTCGGGAAGCACAAGGTGTCAGG + Intergenic
1187256564 X:17648366-17648388 CAGCAGAAGCAGAAGTTGCAAGG + Intronic
1187680550 X:21763294-21763316 CTGGGAAAGAAGAGGGAGCAAGG + Intergenic
1188061863 X:25610973-25610995 CCCGGGAGGCAGAAGTTGCATGG - Intergenic
1188156480 X:26748656-26748678 GTGGGGACGCAGTAGGTGCCGGG - Intergenic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1188878917 X:35468288-35468310 CTGTGGAGGAAGAAGGTGCAAGG + Intergenic
1189196656 X:39159290-39159312 CTGGGGGAGGAGGAGGTTCAGGG + Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192080887 X:68046812-68046834 CTGAGGAAGCAGGAAGTTCAGGG + Exonic
1192185198 X:68941938-68941960 CTGGAGATGCAGTAAGTGCAAGG + Intergenic
1192451681 X:71248768-71248790 CTGCGGCGGCAGAAGCTGCAGGG + Exonic
1192551613 X:72059126-72059148 CTGGAAAACCAGCAGGTGCAGGG - Intergenic
1192770450 X:74183887-74183909 CTGGGGAAGAAAGAGGTGAATGG + Intergenic
1192868704 X:75164257-75164279 GTTGGAAAGCAGAAGGTGAAAGG - Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1194173726 X:90621573-90621595 CACGGGAGGCAGAAGTTGCAGGG + Intergenic
1194515402 X:94845451-94845473 CCAGGGAAGCACAAGGGGCAAGG - Intergenic
1195525450 X:105883945-105883967 CAGGGGAAGCAGAAAGTTTAAGG + Intronic
1196824727 X:119732109-119732131 CAAGGGAAGCAGGAGTTGCAAGG + Intergenic
1196922641 X:120600427-120600449 CCCGGGAAGCAGAGGGTGCAGGG + Intronic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1199947806 X:152681844-152681866 CTGCGGAAACAGCAGGGGCAAGG - Intergenic
1199961873 X:152786610-152786632 CTGCGGAAACAGCAGGGGCAAGG + Intergenic
1200519946 Y:4199247-4199269 CACGGGAGGCAGAAGTTGCAGGG + Intergenic
1202031717 Y:20582284-20582306 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
1202583724 Y:26404879-26404901 CCAGGGCAGCAGAAGGGGCAGGG + Intergenic