ID: 1162123639

View in Genome Browser
Species Human (GRCh38)
Location 19:8487460-8487482
Sequence CACAGCCCAGCAGGTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 6, 3: 20, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162123634_1162123639 11 Left 1162123634 19:8487426-8487448 CCTCAGCACAGCTGGTGTGGGGC 0: 1
1: 0
2: 3
3: 28
4: 254
Right 1162123639 19:8487460-8487482 CACAGCCCAGCAGGTGCCATGGG 0: 1
1: 0
2: 6
3: 20
4: 266
1162123627_1162123639 30 Left 1162123627 19:8487407-8487429 CCAGACGAGGTCGCTTTCCCCTC 0: 1
1: 0
2: 0
3: 2
4: 83
Right 1162123639 19:8487460-8487482 CACAGCCCAGCAGGTGCCATGGG 0: 1
1: 0
2: 6
3: 20
4: 266
1162123632_1162123639 12 Left 1162123632 19:8487425-8487447 CCCTCAGCACAGCTGGTGTGGGG 0: 1
1: 0
2: 0
3: 28
4: 244
Right 1162123639 19:8487460-8487482 CACAGCCCAGCAGGTGCCATGGG 0: 1
1: 0
2: 6
3: 20
4: 266
1162123630_1162123639 13 Left 1162123630 19:8487424-8487446 CCCCTCAGCACAGCTGGTGTGGG 0: 1
1: 0
2: 4
3: 22
4: 238
Right 1162123639 19:8487460-8487482 CACAGCCCAGCAGGTGCCATGGG 0: 1
1: 0
2: 6
3: 20
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162123639 Original CRISPR CACAGCCCAGCAGGTGCCAT GGG Intronic
900095434 1:938241-938263 CACAGCCCAGCAGGTGGCAGAGG - Intronic
900095451 1:938298-938320 CACAGCCCAGCAGGTGGCAGAGG - Intronic
900390677 1:2432566-2432588 CACACCCCAGCCTGTGCCATGGG - Intronic
900470865 1:2854305-2854327 GGCAGCCCAGCGGGTGCCAGGGG + Intergenic
900485355 1:2920278-2920300 CTCAGCCCAGCAGCTGCGGTGGG + Intergenic
900603278 1:3512286-3512308 CACAGCCCTGCAGGTCCCCTGGG + Intronic
900606119 1:3524305-3524327 CACAGCCCCCCAGGTGCCGGGGG + Intronic
900616637 1:3568470-3568492 CTCAGCCCAGCAGGCTCCTTAGG + Intronic
900941234 1:5799974-5799996 CCCAGCCCAGCAGGTGAGGTGGG + Intergenic
901082537 1:6591707-6591729 CACAGACCAGGAGGGGCCAAGGG + Exonic
901271288 1:7953982-7954004 CTGGGCCCAGCAGGTGCCAAGGG + Intergenic
905017151 1:34785609-34785631 CACCGCCCTGCATGTCCCATTGG - Exonic
905272147 1:36794103-36794125 CACAGCCCAGGAGGAGACTTTGG - Intergenic
905510825 1:38518343-38518365 CACAGACCAGCAGTTGGCTTAGG - Intergenic
907461766 1:54609449-54609471 CACAGCACAGCTGGAGCCATAGG - Exonic
912449548 1:109760708-109760730 CACAGGGCAGCAGGTCCCACAGG - Intronic
912517142 1:110223556-110223578 CACAGCCCACCAGAAGCCAATGG - Exonic
913036346 1:114969782-114969804 CACAGACCAGGAGATTCCATTGG - Intronic
913050833 1:115115300-115115322 CCCAGCCCAGCAGCTGTCACAGG - Intergenic
913403411 1:118461733-118461755 CACAGCCCAGCAGATGGTAGTGG + Intergenic
914080671 1:144408794-144408816 TACAGCCCACAAGGTGCCCTTGG - Intergenic
914175582 1:145277328-145277350 TACAGCCCACAAGGTGCCCTTGG - Intergenic
914899931 1:151706451-151706473 CTCAGCCCTGCAGGTGCCACTGG - Intronic
915276356 1:154791406-154791428 GACAGCTCAGCAGGTGGGATGGG + Intronic
915365819 1:155315149-155315171 CAGAGCCCAGCATGGGCCGTGGG - Intronic
915562175 1:156693734-156693756 CAAAGCCCAGCAGGAGCCCAGGG - Intergenic
915902404 1:159856116-159856138 CACAGCCTGGCAGGTGCCTGAGG + Intronic
916359495 1:163952538-163952560 CACAGACCAGGAGGTTCCCTCGG + Intergenic
916642628 1:166747328-166747350 CTCAGCCCAGCTGCTGCCACAGG - Intergenic
919830962 1:201539793-201539815 CCCATCCCAGCAGGAGCCAGAGG + Intergenic
919941342 1:202288670-202288692 CACAGCCCAGGAGCTGGCACAGG + Intronic
920277192 1:204815187-204815209 CACAGCCCAGGTGGTGAGATAGG + Intergenic
920919250 1:210284598-210284620 CACCACCCAGCAGCTGCCACTGG - Intergenic
923567687 1:235088880-235088902 CAGACCCCAGCAGGTCCCAGTGG - Intergenic
1064013868 10:11758115-11758137 CACAGCCAAGCAGGTCCCTGCGG - Intronic
1067431128 10:46246840-46246862 CACAGCCCTGCAGTTGCAGTTGG + Intergenic
1068423388 10:56823750-56823772 TTCAGCCCAGCAGGTGTCCTTGG - Intergenic
1072394738 10:95026918-95026940 CACAGACCAGAAGATTCCATTGG - Intergenic
1072551290 10:96479566-96479588 TGCAGCCCACCAGGTGCCCTTGG - Intronic
1072785069 10:98273724-98273746 CACAGCCCCGGAGGTCCCTTCGG + Intergenic
1072805034 10:98418764-98418786 CACAGCCCAGCCGGTGCCGTGGG - Intronic
1073484864 10:103810355-103810377 CACAGCCCAGCAGGGGCAGTGGG + Intronic
1075515091 10:123102275-123102297 TCCAGGCCAGCAGGTGACATTGG + Intergenic
1075579829 10:123608970-123608992 AACAGCTCAGCAGTTGCCAGGGG - Intergenic
1076916509 10:133425066-133425088 GCCAGCCCAGGAGGAGCCATGGG - Intergenic
1076936614 10:133569861-133569883 GCCAGCCCAGAAGGAGCCATGGG - Intergenic
1077233464 11:1468888-1468910 CACTGTGCAGCAGGCGCCATCGG + Intergenic
1078134338 11:8639922-8639944 CACAGCTCAGAAGGTACCATCGG + Intronic
1081666289 11:44918851-44918873 CAGAGCCAAGCAGATGCCCTGGG - Intronic
1082095704 11:48127557-48127579 AATAACCCTGCAGGTGCCATTGG + Intronic
1083500453 11:63102436-63102458 CCCATCTCAGCAGGAGCCATAGG + Intronic
1083643513 11:64158572-64158594 AACCTCCAAGCAGGTGCCATTGG + Intronic
1083940395 11:65892376-65892398 CACAGCTCAGGAGGCGCCCTTGG - Exonic
1084004529 11:66315958-66315980 TGCAGCCCTGCAGGGGCCATGGG - Exonic
1084148571 11:67277699-67277721 CACAGCTCGGCAGGCGCCACAGG - Intronic
1086127009 11:83359231-83359253 CACAGCTCAGCATGTGCAGTAGG - Intergenic
1088797746 11:113278106-113278128 CACAGCCCTGCAGGGTCCAGTGG - Exonic
1089630614 11:119781925-119781947 CACAGTCCAGCAGGGGAGATGGG - Intergenic
1091066832 11:132522002-132522024 AACAGGCCAGCAGTTGCCAGTGG - Intronic
1091170402 11:133515372-133515394 CACAGCTCAAAAGGTGCCACTGG + Intronic
1091789846 12:3265656-3265678 CACAGCCCAGGTGGTGGCGTGGG - Intronic
1094273840 12:28646242-28646264 CGGACCCCAGCAGCTGCCATGGG + Intergenic
1096109994 12:49022940-49022962 CACATCCCAGGAGGTGGCAGAGG - Intronic
1096586799 12:52628158-52628180 CATAGCCCAGCAGGTCACACTGG + Intergenic
1096747777 12:53739543-53739565 CACACCCCTGCAGGTGCCTGGGG - Intergenic
1098110964 12:67121380-67121402 CACAGCCTAGCAGGTGCAATGGG + Intergenic
1099827255 12:87792576-87792598 CACAGCACAGCAGGCAGCATTGG + Intergenic
1101516417 12:105439588-105439610 CACAGAGCAGCAGGGGCCCTGGG + Intergenic
1103097591 12:118144533-118144555 CACAGCCCAGCACTTGAGATGGG - Intronic
1103897043 12:124279761-124279783 CAGCTCCCCGCAGGTGCCATGGG - Intronic
1103907250 12:124334161-124334183 CACAGCCCCCCAGGAGACATAGG - Intronic
1105587320 13:21757122-21757144 CACAGAGCAGCCGGTGCCATGGG - Intergenic
1108378982 13:49839000-49839022 CACTGCCCGGCTGCTGCCATTGG - Intergenic
1110968662 13:81733212-81733234 CACAGACCAGGAGGTTCCTTAGG - Intergenic
1112746726 13:102535430-102535452 CACAACCCTGCAGATGCCTTAGG - Intergenic
1113109128 13:106803064-106803086 CGAAGCCCACCAGGTGCAATCGG - Intergenic
1113801159 13:113087061-113087083 GACAGGTCAGCAGGTGCCAGGGG - Intronic
1113928000 13:113951846-113951868 CACAGAGCAGCAGGTGCCGCCGG - Intergenic
1114615726 14:24067338-24067360 CTCAGTCCAGCAGTTGCCAAAGG + Intronic
1114679937 14:24475770-24475792 CACATCCCAGCAGTGGCCAATGG - Intergenic
1116901611 14:50367154-50367176 GACAGCAGAGCAGGCGCCATGGG + Intronic
1117995776 14:61476827-61476849 CACAGCCCAGAAGATGTCAGAGG - Intronic
1118357592 14:65027478-65027500 CAGAGCCCAGAAGGTGGCTTTGG + Exonic
1118385999 14:65256044-65256066 CACAGCCCTGCAGGTGGCACTGG + Intergenic
1119194685 14:72708754-72708776 CACAGGCCAAGAGGTGCGATGGG - Intronic
1122965278 14:105121011-105121033 CAGAGCCCAGCATGCCCCATGGG - Intergenic
1123450436 15:20356606-20356628 CCCAGCCCTGGAGGTGCCCTCGG - Intergenic
1127731026 15:61802050-61802072 CACAGCCCATCAGTTGACACGGG + Intergenic
1129220961 15:74131369-74131391 CGCACCCCATCAGGTGCCCTAGG - Intronic
1130664688 15:85859857-85859879 CACTGCCCCGCAGGTCCCTTAGG - Intergenic
1130980209 15:88807275-88807297 GACAGGCCAGCAGCTGCCCTGGG + Intronic
1132383879 15:101386291-101386313 GACATCCCAGCAGGTGCCACTGG - Intronic
1134125768 16:11615015-11615037 CCCAGCCCAGCAGCTGGCACGGG + Intronic
1135490424 16:22904712-22904734 CAGAGCCCAGGAGGGGCCATGGG + Intronic
1137070355 16:35899477-35899499 CAAAGCCCAGCAGGAAACATGGG - Intergenic
1138563594 16:57816598-57816620 CACAGCTCAGCAGATGCCTCAGG - Intronic
1139262387 16:65607166-65607188 AGCAGCCAAGCAGGTGCTATGGG + Intergenic
1139956730 16:70696849-70696871 CCCAGCCCGGCAGGTGCCAGCGG - Intronic
1141328643 16:83087047-83087069 CACAAGTCAGCAGTTGCCATTGG + Intronic
1141378281 16:83551781-83551803 CATAGGCCAGCAGGTGAGATGGG - Intronic
1141460022 16:84172802-84172824 CACCGCCCAGCAGGTAGCTTAGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143466934 17:7143456-7143478 CTCAGCCCAGGAGGTCACATGGG + Intergenic
1144573473 17:16415258-16415280 CTCAGCCCAGCAGATGCCCCTGG - Intergenic
1147604844 17:41768803-41768825 CACAGCCCAGCAGGGAACACAGG - Intronic
1149784782 17:59425631-59425653 CTCAGCCCAGCAGCTCTCATGGG - Intergenic
1152338006 17:79708733-79708755 CCCAGCCCTGGAGGTGCCCTCGG + Intergenic
1152886712 17:82855811-82855833 AACAGCCTGGCAGGTGCCAGGGG - Intronic
1153392494 18:4578368-4578390 CACAGCCCAGCAAGCATCATTGG + Intergenic
1153675290 18:7451714-7451736 CACAGCACAGCACCTGCCAGAGG - Intergenic
1156222668 18:35068886-35068908 AACAGCCCATCAGCTGCCAAAGG - Intronic
1160879438 19:1312845-1312867 CACGGCCCAGCAGCGGCCACGGG + Intergenic
1160915140 19:1492842-1492864 TGCAGCGCAGCAGGTGGCATGGG + Intronic
1161005985 19:1937068-1937090 CACAGCCCAGCATCTGTGATGGG + Intergenic
1161263384 19:3350448-3350470 CACAGCCAAGCAGGTGCAATGGG + Intergenic
1161649180 19:5473829-5473851 GACAGCCCCGCAGATGCCACTGG - Intergenic
1161767203 19:6214316-6214338 CACAGCCCAGCAAGGCCCATTGG - Intronic
1162121860 19:8475276-8475298 TACAGCCCTGCTGGTGCCCTGGG - Intronic
1162123639 19:8487460-8487482 CACAGCCCAGCAGGTGCCATGGG + Intronic
1162462347 19:10820604-10820626 CACTGCCCAGCTGCTGCCATTGG + Intronic
1163514783 19:17756205-17756227 CACACCCCTGCAGGTGGCAAGGG - Intronic
1163821726 19:19499910-19499932 CACAGCCCGGCTGGTGCCTTTGG + Intronic
1164062870 19:21690623-21690645 CAAAGCCCAGCAGGAAACATGGG - Intergenic
1165098883 19:33426676-33426698 CACTGCGCAGCAGGTGGCCTTGG + Intronic
1166854595 19:45777297-45777319 CGCAGCCGAGCAGGGGCCACAGG + Intronic
1167460419 19:49621610-49621632 CCCAGCCCTGCAGGTGCCTGGGG + Exonic
1167577209 19:50323459-50323481 CACAGCCCACCAGAAGCCAATGG + Exonic
925396711 2:3538582-3538604 CACAGACCAGAAGGTGCTCTGGG - Intronic
926113357 2:10196400-10196422 CAGAGACCAGCAGGAGCCCTGGG + Intronic
926123345 2:10256521-10256543 GCCAGCACAGCAGGTGCCAGGGG + Intergenic
926166420 2:10524154-10524176 CACAGCCCAAAGGGTCCCATTGG - Intergenic
927856103 2:26528907-26528929 CACTGCCCTGCAGATGCCACTGG - Intronic
932335335 2:70927910-70927932 GACAGCCCAGAAGGTGCACTGGG + Intronic
932714433 2:74091017-74091039 CAGAGCACAGAAGGTGACATAGG - Intronic
933720435 2:85394290-85394312 CACAGCCCTGCAGTGGCCCTGGG + Intergenic
933772214 2:85751832-85751854 CACAGGCCAGCAAGAGCAATTGG + Intronic
936164394 2:110107206-110107228 CAGAGCCCAGAAGCTGCCCTTGG - Intronic
937445624 2:121955508-121955530 GCCAGCTCAGCAGGTGCTATGGG + Intergenic
937893244 2:126956589-126956611 CACAGACCAGTAGATTCCATTGG + Intergenic
939197524 2:138991029-138991051 CACAGCCCAAGAGGTTGCATGGG - Intergenic
946500290 2:220240023-220240045 CAGAGCCCAGCAGAGGCCAGAGG - Intergenic
947105747 2:226666177-226666199 CACAGCCAATCAGGTGGCACAGG + Intergenic
947592253 2:231392613-231392635 CGGAGCCCAGCAGGGGCCACGGG - Intergenic
947808062 2:232982121-232982143 TTCAGCCCAGCAGGAGGCATGGG + Intronic
948084130 2:235232368-235232390 CACAGCCCAGCAGGTTCTACAGG + Intergenic
948264496 2:236627093-236627115 CCCAGCACAGGAGCTGCCATGGG + Intergenic
1168819472 20:763411-763433 TACAGCCCAGTAGGTGCGTTTGG + Intronic
1169357223 20:4917421-4917443 CACAGCACAGCAGGGGGCACGGG + Intronic
1172098695 20:32473228-32473250 CAGAGCCCAGCTGGGGCCACAGG - Intronic
1172798125 20:37557312-37557334 CACAGACCACCTGGTGCCACAGG - Intergenic
1173190120 20:40869718-40869740 CACAGGCCGGCAGGAGCCCTAGG + Intergenic
1174502755 20:50997582-50997604 CACAGCCCAGCAGCTTGGATGGG + Intergenic
1175798156 20:61785299-61785321 CACAGCCCAGCAGGAGGAAGCGG - Intronic
1176074478 20:63242206-63242228 CACTTCCCAGCAGGCGGCATGGG - Intronic
1177694529 21:24554893-24554915 CACAGACCAGGAGATTCCATCGG + Intergenic
1178880991 21:36449985-36450007 CTCAGCCCAGAAGCTGCCTTTGG - Intergenic
1179028603 21:37700898-37700920 CACAGCCCAGCTATTCCCATGGG - Intronic
1179546507 21:42115694-42115716 CACAGCCCATCAGATTCCAGAGG - Intronic
1179584221 21:42364837-42364859 CGCTGCCCAGCAGCTTCCATGGG + Intronic
1179725407 21:43338953-43338975 CAAACCCCAGCAGGGGCCACAGG + Intergenic
1179802206 21:43816402-43816424 TACCGCCCAGCAGGTGCTAGGGG + Intergenic
1179999911 21:44990926-44990948 CACAGCACTGCCGGTGCCAGAGG + Intergenic
1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG + Intronic
1180197644 21:46207237-46207259 CACAGCCCAGCAAGGCCCCTAGG + Intronic
1181282846 22:21731998-21732020 CAAGGCCCTGCAGGTGCCAGAGG + Intronic
1182549303 22:31092402-31092424 AGCAGCCTAGCAGGTGCCTTGGG + Intronic
1183619547 22:38964631-38964653 CACAGCCCAGCACCTGCCCAGGG + Intronic
1183640347 22:39088922-39088944 CACAGCCCAGCACCTGCCCAGGG + Intergenic
1183674080 22:39290153-39290175 CACAGCCCAGCCAGTGCCTGTGG - Intergenic
1184433897 22:44458504-44458526 CAGAGCCCTGCAGCTGCCCTGGG - Intergenic
1184661516 22:45967628-45967650 CACACCCAAGCAGGGGCCCTGGG + Intronic
1184729316 22:46364295-46364317 CACGGCCCAGCAGCTGCCCCCGG - Intronic
1185082704 22:48718611-48718633 CACAGCCAAGCCGGGGCCTTGGG + Intronic
1185401507 22:50620603-50620625 CACAGCCAAGGAGGGGCCACAGG + Intergenic
949928030 3:9057548-9057570 CCCCTCCCAGCAGGTGCCACGGG + Intronic
950233436 3:11296641-11296663 CAGAGCTGAGCAGGTGACATGGG - Intronic
950462830 3:13135479-13135501 CAGGGCCCAGGAGGTGACATGGG + Intergenic
952328645 3:32343429-32343451 GACACCCCAGCTGGTGACATGGG - Intronic
952882519 3:37993833-37993855 CCCACCCCAGCGGGTGTCATGGG + Intronic
953226704 3:41028104-41028126 CAACGTCCAGCAGGTGCCACAGG + Intergenic
953540402 3:43812984-43813006 CACACTCCAGCAGCTGGCATGGG + Intergenic
953855897 3:46498885-46498907 CCCAGGCCAGGAGCTGCCATAGG + Intronic
953896570 3:46807781-46807803 CACAGCCCAGCAGAGTCCACAGG + Intronic
954712552 3:52512336-52512358 CACTGCCCGGCAGGTGGCCTGGG - Exonic
954935542 3:54323395-54323417 CACTGCCCAGTGGGTGGCATGGG - Intronic
955995756 3:64678871-64678893 CACAGCCCAGCAGCAACCTTTGG + Intronic
956207650 3:66771253-66771275 CACCGCCCAGCAGGGGTCAACGG - Intergenic
959825782 3:110794307-110794329 TACAGCCCTCCAGGTGGCATGGG - Intergenic
962576885 3:136763207-136763229 CACAGGCCTGGAGGTGTCATGGG + Intergenic
963466160 3:145685317-145685339 GTCAGCCCAGCAGATGCCCTGGG - Intergenic
965505062 3:169506339-169506361 CACATCCCCGCTGGTGCCGTGGG + Intronic
968432896 4:569130-569152 CACAGCCCTCCAGGTGCCATTGG + Intergenic
977133095 4:93267470-93267492 CACAGCCTAGCAAGTGATATTGG + Intronic
977969898 4:103200990-103201012 CACAGCCCACAAGGCCCCATGGG - Intergenic
978761630 4:112359646-112359668 CAGAGGCCAGCAGGGGCCTTGGG + Intronic
979178286 4:117692309-117692331 CACAGTCCACCAGGTGCCAGTGG - Intergenic
981429958 4:144646603-144646625 CACTGCCCAGCAGGGGCACTAGG - Exonic
983001182 4:162416792-162416814 CACACCCCAGCAGGTGTAATAGG + Intergenic
985150988 4:186946821-186946843 CTCAGGCCAGCAGGTGGCCTGGG - Intergenic
985236467 4:187880723-187880745 TGCTGCCCAGCAGCTGCCATTGG + Intergenic
985529360 5:424732-424754 AAAAGCTCAGCAGATGCCATGGG - Intronic
985540058 5:483649-483671 CACAGCCCTGCGGGGGCCACAGG + Intronic
985645228 5:1081813-1081835 CACTCCCCGGCAGGTGCCACTGG + Intronic
985649429 5:1100460-1100482 CACAGCACAGCAGGCCCCAAAGG + Intronic
985675501 5:1229523-1229545 TCCAGGCCAGCAGGTGCCCTGGG - Intronic
985819539 5:2150221-2150243 CACAGCCCTCCAGGTGACAGAGG - Intergenic
986787472 5:11127575-11127597 CCCAGCCCAGCCAATGCCATTGG - Intronic
987784766 5:22485913-22485935 CACAGCCCAAGAGGGGCAATAGG + Intronic
988928890 5:36016131-36016153 CACAGCCCTGCAGTTGCCCAAGG + Intergenic
989999701 5:50878725-50878747 CACAGCCCTGCATGTGTCTTCGG + Intergenic
994851209 5:105057253-105057275 CACTGGCCTGCAGGTGCCCTTGG + Intergenic
997541557 5:134667160-134667182 CACAGCCCAGCGGATGGCAATGG - Intronic
997585689 5:135041660-135041682 CTCAGGCCATCAGGTGCCAGAGG - Intronic
997822956 5:137082441-137082463 CACAGAGAAGCAGGTGGCATGGG + Intronic
997827079 5:137116091-137116113 CCCAGCCCAGCTGGTGCCAAGGG + Intronic
998200593 5:140114837-140114859 CACAGTCAAGGAGGTGCCCTCGG - Exonic
999273157 5:150309793-150309815 CAGAGCACAGTAGTTGCCATGGG - Intronic
999322383 5:150623688-150623710 CACAGACCTGCAGGTGGCCTGGG - Intronic
999347787 5:150839780-150839802 CACAGCAAGGCAGGTGCCAAAGG - Intergenic
999397712 5:151240693-151240715 GACAGCCCAGCATGCGCCCTGGG - Intronic
999401490 5:151267670-151267692 GTCAGCCCAGCAGATGCCCTGGG - Exonic
1001267352 5:170283543-170283565 GACAGCCCAGCTGGGGACATGGG - Intronic
1002002985 5:176208590-176208612 CACAGGACAGCAGGAGCCCTAGG + Intergenic
1002223526 5:177702665-177702687 CACAGGACAGCAGGAGCCCTAGG - Intergenic
1002461530 5:179376111-179376133 TACAGCCCAGGAGGGGGCATTGG - Intergenic
1002475291 5:179461759-179461781 CACATCCCAGCACCTGGCATGGG + Intergenic
1003119774 6:3309842-3309864 CACTGCACAGCAGGTGACCTAGG + Intronic
1005362279 6:25042149-25042171 CCCAGCACAGCAGCTGCCTTCGG - Intronic
1007122679 6:39396413-39396435 CCGAGCCCAGCAGGTGCACTGGG + Intronic
1007293151 6:40802062-40802084 CACAGCCCAGCTGGCCCCAGGGG - Intergenic
1008621639 6:53277001-53277023 CACAGCCCAGCAGTTATCACGGG + Intronic
1009794993 6:68455737-68455759 CACTTCCCAGCAGGGGCCAACGG - Intergenic
1010981369 6:82374034-82374056 CACATTCCAGCAGATGCCAAGGG + Intergenic
1011777219 6:90745064-90745086 TACACCTCAGCAGATGCCATAGG - Intergenic
1013479688 6:110543180-110543202 CACAGCCCACCAGAAGCCAGAGG + Intergenic
1018172653 6:161154099-161154121 CACAGTCCTGCAGGAGCCCTTGG + Intronic
1018926076 6:168207887-168207909 CACAGCTCAGGACGTGCCAGAGG - Intergenic
1018952174 6:168386362-168386384 AACAGCCCAGCAGCCTCCATGGG - Intergenic
1019352540 7:561778-561800 CACGGCCCAGCAGCTTCCGTGGG + Intronic
1019497115 7:1345878-1345900 CACAGCCCAGAGGGTGTCACTGG + Intergenic
1019593496 7:1847548-1847570 CACTGTCCAGCAGCTGCCTTCGG + Exonic
1019836080 7:3385544-3385566 GAGAGACCAGCAGGTGCGATGGG - Intronic
1019969969 7:4532853-4532875 CAGAGCCTAGCAGGTGACAGAGG - Intergenic
1023875086 7:44282488-44282510 CCCAGCCCACGAGGGGCCATGGG - Intronic
1024272174 7:47650851-47650873 CACTGGCCAGCTGGTGCCCTTGG + Intergenic
1024295365 7:47837446-47837468 CAAAGCTCAGGAGGTGCCAGAGG - Intronic
1027249519 7:76390238-76390260 CACAGCCCAGCTGGCGGCACAGG + Exonic
1028994363 7:97084203-97084225 TACAGCCCACTAGGTGTCATTGG - Intergenic
1029723862 7:102389104-102389126 AACAGATCAGCAGTTGCCATGGG - Intronic
1031956045 7:127943673-127943695 GACAGAACAGGAGGTGCCATTGG + Intronic
1032517547 7:132518420-132518442 AGCAGTCCAGCAGGGGCCATGGG + Intronic
1035277982 7:157759288-157759310 CTCAGCCCAGCAGGCTCCCTTGG - Intronic
1035460130 7:159033403-159033425 CCCAGCCCAGAAGGTGCCTCGGG - Intronic
1037812018 8:22092277-22092299 CACTGCTCAGAAGGTGCCAATGG + Intronic
1039790513 8:40872317-40872339 CCCAGCCCTCCAGGTGCCAGCGG + Intronic
1040629692 8:49196303-49196325 CATAGCCCAGGAGGTGCACTGGG + Intergenic
1042982141 8:74541231-74541253 CACAGAGCAGCAGGGGCCCTGGG + Intergenic
1043785711 8:84397166-84397188 CAGATCCCAGAAGGTGCCCTTGG - Intronic
1047763385 8:127970639-127970661 CACAGCCTAACAGGTGCCAGGGG + Intergenic
1047880458 8:129186859-129186881 CACAGCCTGGCAGGTTTCATAGG + Intergenic
1048016154 8:130499369-130499391 TGCAGCCCAGCAGCTGCCCTGGG - Intergenic
1048573801 8:135675754-135675776 CTCAGCCCAGGAGGTGTCCTGGG - Intergenic
1049347617 8:142147124-142147146 CCCAGGCCAGCAAGTGCCTTCGG + Intergenic
1049358012 8:142198320-142198342 CCCAGCCCAGCAGCTGCTAGGGG - Intergenic
1049749383 8:144276154-144276176 CACAGCCTAGCAGGTGCTGGGGG - Intronic
1049792516 8:144478438-144478460 CCCAGGGCAGCAGGTGCCAACGG + Intronic
1049809774 8:144561175-144561197 CGCACCCCAGCAGTTTCCATCGG + Intronic
1051880013 9:21830386-21830408 CACAATCCAGCAGGAGGCATAGG - Intronic
1053160477 9:35810391-35810413 CAGAGCCCAGCTGGTGCAAGTGG + Intronic
1053269421 9:36739956-36739978 CGTGGCCCCGCAGGTGCCATGGG - Intergenic
1053598276 9:39585426-39585448 CACTTCCCAGCGGGTGCCCTGGG + Intergenic
1053856307 9:42342435-42342457 CACTTCCCAGCAGGTGCCCCGGG + Intergenic
1055227931 9:74023471-74023493 CACAGCCCTGCAAATCCCATTGG - Intergenic
1059435004 9:114270758-114270780 TTCAGCCCATCAGGTCCCATGGG - Exonic
1060246445 9:121950549-121950571 CTGAGGCCAGCAGGTGCCACAGG + Intronic
1060407339 9:123379407-123379429 CTCAGCCCTGCGGGGGCCATGGG - Intronic
1061379357 9:130244781-130244803 CACAGGGCAGCAGGTGTCCTTGG + Intergenic
1061808609 9:133149661-133149683 CCGAGTCCAGCAGGTGGCATCGG - Intergenic
1062519270 9:136950908-136950930 CTCATCCCAGGAGGTGCCCTGGG - Intronic
1062609294 9:137366798-137366820 CAGAGCCCAGCAGGAGCCTTGGG - Intronic
1062680642 9:137777955-137777977 CCAAGCCCAGCAGGTCCCGTTGG - Exonic
1186349978 X:8731367-8731389 CCCAGCCCCGCAGGTGCCCGCGG - Intronic
1186753597 X:12647100-12647122 CACAGAGAAGCAGGTGCCAGAGG - Intronic
1187877693 X:23817570-23817592 CACAGTCAAGTAGGTACCATGGG + Intergenic
1189230534 X:39449045-39449067 CACAGACCAGCAGTAGCTATTGG + Intergenic
1190329293 X:49225988-49226010 CACAGCCCAGTAGCAGGCATTGG + Exonic
1190387586 X:49898017-49898039 CACAGAGCAGCAGGGGCCCTGGG - Intergenic
1192669803 X:73127839-73127861 CACAGCACAGCCGGTGAAATGGG - Exonic
1192795944 X:74423778-74423800 CAATGCTCAGCAGGTGCCCTTGG - Intronic
1194128215 X:90046218-90046240 CACCAACCAGCAGGTGCCAGAGG + Intergenic
1195793320 X:108614940-108614962 GGCAGCCCAGGAGGTCCCATTGG - Exonic
1195899891 X:109786691-109786713 GAAAGCCCTGGAGGTGCCATGGG - Intergenic
1197799145 X:130330895-130330917 TACAGACCAGCACGTGCCAGAGG + Intergenic