ID: 1162125139

View in Genome Browser
Species Human (GRCh38)
Location 19:8495528-8495550
Sequence TGCACAAGGCTGGCCCGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 252}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162125139_1162125152 24 Left 1162125139 19:8495528-8495550 CCACGCCGGGCCAGCCTTGTGCA 0: 1
1: 0
2: 3
3: 26
4: 252
Right 1162125152 19:8495575-8495597 TTACTGCCCTGTGGGGATTTGGG 0: 1
1: 0
2: 1
3: 16
4: 196
1162125139_1162125147 15 Left 1162125139 19:8495528-8495550 CCACGCCGGGCCAGCCTTGTGCA 0: 1
1: 0
2: 3
3: 26
4: 252
Right 1162125147 19:8495566-8495588 TGCATTGCCTTACTGCCCTGTGG 0: 1
1: 0
2: 0
3: 15
4: 150
1162125139_1162125153 29 Left 1162125139 19:8495528-8495550 CCACGCCGGGCCAGCCTTGTGCA 0: 1
1: 0
2: 3
3: 26
4: 252
Right 1162125153 19:8495580-8495602 GCCCTGTGGGGATTTGGGAGTGG 0: 1
1: 0
2: 3
3: 45
4: 358
1162125139_1162125145 -9 Left 1162125139 19:8495528-8495550 CCACGCCGGGCCAGCCTTGTGCA 0: 1
1: 0
2: 3
3: 26
4: 252
Right 1162125145 19:8495542-8495564 CCTTGTGCATCTGTAAAATGGGG 0: 1
1: 1
2: 23
3: 207
4: 1538
1162125139_1162125143 -10 Left 1162125139 19:8495528-8495550 CCACGCCGGGCCAGCCTTGTGCA 0: 1
1: 0
2: 3
3: 26
4: 252
Right 1162125143 19:8495541-8495563 GCCTTGTGCATCTGTAAAATGGG 0: 1
1: 0
2: 9
3: 88
4: 830
1162125139_1162125148 16 Left 1162125139 19:8495528-8495550 CCACGCCGGGCCAGCCTTGTGCA 0: 1
1: 0
2: 3
3: 26
4: 252
Right 1162125148 19:8495567-8495589 GCATTGCCTTACTGCCCTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1162125139_1162125151 23 Left 1162125139 19:8495528-8495550 CCACGCCGGGCCAGCCTTGTGCA 0: 1
1: 0
2: 3
3: 26
4: 252
Right 1162125151 19:8495574-8495596 CTTACTGCCCTGTGGGGATTTGG 0: 1
1: 0
2: 0
3: 14
4: 174
1162125139_1162125149 17 Left 1162125139 19:8495528-8495550 CCACGCCGGGCCAGCCTTGTGCA 0: 1
1: 0
2: 3
3: 26
4: 252
Right 1162125149 19:8495568-8495590 CATTGCCTTACTGCCCTGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 169
1162125139_1162125146 -8 Left 1162125139 19:8495528-8495550 CCACGCCGGGCCAGCCTTGTGCA 0: 1
1: 0
2: 3
3: 26
4: 252
Right 1162125146 19:8495543-8495565 CTTGTGCATCTGTAAAATGGGGG 0: 1
1: 1
2: 12
3: 185
4: 1018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162125139 Original CRISPR TGCACAAGGCTGGCCCGGCG TGG (reversed) Intronic
900429897 1:2596516-2596538 TGTGGAAGGCTGGCCCCGCGTGG + Intronic
901065153 1:6490795-6490817 TGCAAAGGGCTGGCCCCTCGGGG - Intronic
902419084 1:16263473-16263495 AGCACACGGCCGGCCAGGCGTGG + Intronic
903167051 1:21527837-21527859 TGTTAAAGGCTGGCCGGGCGTGG - Intronic
904025307 1:27499111-27499133 TGCACAAGCCTGGCCAGGGCAGG - Intergenic
905057325 1:35107139-35107161 AGAACAAGGCCGGCCAGGCGCGG - Intronic
906734053 1:48107420-48107442 TGCACAGGGGTGGCCAGGCATGG - Intergenic
908835682 1:68227219-68227241 TTCACCAGGTTGGCCAGGCGGGG - Intronic
909508012 1:76416914-76416936 AACACAATGCTGGCCGGGCGTGG - Intronic
913109328 1:115642794-115642816 TGGCGAAGGCTGCCCCGGCGCGG - Intronic
913259686 1:116986960-116986982 TGGACTAGGCTGGCCCGGGAGGG + Exonic
915591997 1:156875971-156875993 TGCACAAGGCTGCCCAGACGAGG - Intronic
915696857 1:157752016-157752038 TGCAGAAGGCTGGCCTGAAGAGG + Intronic
916791820 1:168131972-168131994 TGCACATAACTGGCCAGGCGCGG + Intronic
919429284 1:197472796-197472818 TTCACAAGGATGGCCCTGAGTGG + Intronic
920636985 1:207713540-207713562 AGCACAAGCCTGGCACGGCCTGG - Intronic
922527605 1:226317928-226317950 TGCCCATGGCCGGCCGGGCGCGG - Intergenic
923036858 1:230290522-230290544 TTCACAAAGTTGGCCGGGCGCGG + Intergenic
923189099 1:231603227-231603249 TACAGAAGCCTGGCCGGGCGTGG + Intronic
923611769 1:235502301-235502323 TAAACATGACTGGCCCGGCGCGG - Intronic
1063188876 10:3675080-3675102 TAAAGAAAGCTGGCCCGGCGTGG + Intergenic
1069673898 10:70233483-70233505 CGCACGGGGTTGGCCCGGCGGGG - Intronic
1070293829 10:75141829-75141851 AGCAAAAGGCAGGCCAGGCGTGG - Intronic
1071794331 10:88989483-88989505 TGCACAAGGCTGGCACGCCCAGG + Intronic
1072794200 10:98341926-98341948 TGCAGGTGGCTGGCCAGGCGCGG - Intergenic
1074541961 10:114372389-114372411 TGCACAGGGCTGGGCCGGGTAGG + Intronic
1074882416 10:117669271-117669293 TGCAAATGTCTGGCCCGGCCTGG + Intergenic
1075375574 10:121975356-121975378 TGCACAAGAGGGGCCTGGCGGGG + Intergenic
1076745444 10:132510467-132510489 AGCACAAGGCAGGCCAGGCCTGG + Intergenic
1077758719 11:5066478-5066500 TGTCCAAGGTTGGCCCCGCGTGG - Intergenic
1078460843 11:11514276-11514298 TGCCCCAGGCTGGCCCTGCAGGG + Intronic
1078932243 11:15921504-15921526 TCCAAAAGGCTGGCCAGGTGGGG + Intergenic
1078938712 11:15976635-15976657 TTCACAAGCCTGGCCAGGAGAGG + Intronic
1079251702 11:18791885-18791907 TGCGCAGGGCTGGCGGGGCGGGG + Intronic
1081913466 11:46715995-46716017 GGGACAAGGCAGGCCGGGCGCGG - Intergenic
1082022518 11:47546519-47546541 TGAAGAAAGTTGGCCCGGCGTGG - Intronic
1082107937 11:48241006-48241028 TGCACAGATCTGGCCGGGCGCGG - Intergenic
1083505955 11:63157384-63157406 TGCACAAGGCTGGCATTGCCTGG + Intronic
1084118750 11:67056825-67056847 TGCGCGGGGCAGGCCCGGCGGGG - Exonic
1084297381 11:68221777-68221799 TGCACAGGGCTTCCCAGGCGGGG + Intergenic
1087244164 11:95814648-95814670 TACACAAGGCTGGCCGGGCGTGG - Intronic
1088904128 11:114141123-114141145 TCCTGAAGGCTTGCCCGGCGGGG + Intronic
1089586323 11:119512113-119512135 TGCACAAGGCTGGGTGGGAGAGG + Intergenic
1089608085 11:119653426-119653448 TGCAGGAGGGTGGCCCGGCGCGG + Intronic
1090822394 11:130355428-130355450 TGAAAAAGGTTGGCCAGGCGCGG - Intergenic
1091383488 12:77804-77826 TTCCCCAGGCTGGCCCGGCGAGG - Intronic
1092732856 12:11550654-11550676 GGGACAAGGCTGGCCCAGCTGGG + Intergenic
1093478266 12:19578981-19579003 TACAGAAGGCTGGCCGGGCATGG + Intronic
1096696538 12:53352491-53352513 TACAAAAAGCTGTCCCGGCGCGG - Intergenic
1097285457 12:57873707-57873729 TTCCCAAGACTGGCCGGGCGCGG - Intergenic
1097935526 12:65245427-65245449 TGCAGAGCGCTGGCCAGGCGCGG - Intronic
1102571920 12:113831946-113831968 TGCACATGGCTGGCCATGCAGGG - Intronic
1103494845 12:121353728-121353750 GGCACAAGGCAGGCCGGGCGCGG - Intronic
1103713150 12:122928177-122928199 AAGACAAGGCTGGCCAGGCGCGG + Intronic
1103905433 12:124325195-124325217 TGCACAGGGCCAGCCCGGGGCGG + Exonic
1105252266 13:18709891-18709913 TCCAAAAGCCTGGCCAGGCGCGG - Intergenic
1105514007 13:21075133-21075155 AGTACAGGGCTGGCCCGGCATGG + Intergenic
1106282755 13:28290389-28290411 TGCACAAAACTGGCCAGGCTCGG + Intronic
1106584546 13:31045690-31045712 TGAACAAGGCTGTCCCCGGGAGG - Intergenic
1107956261 13:45514936-45514958 TACACAAGCTTGGCCAGGCGCGG - Intronic
1108647484 13:52445347-52445369 TACATAATGCTGGCCGGGCGCGG + Intronic
1111131632 13:83984185-83984207 TGTCCTAGGCTGGCCGGGCGCGG - Intergenic
1112652188 13:101411636-101411658 AGCATAATGCTGGCCGGGCGCGG - Intronic
1116846206 14:49867259-49867281 AGCAAACGGCTGGCCGGGCGCGG - Intergenic
1116992912 14:51294259-51294281 TACACAAGGCTTGCCAGGCAGGG - Intergenic
1117721388 14:58632025-58632047 TGCACACTGCTGGCCCGGCTCGG - Intergenic
1119230060 14:72972588-72972610 TACGCAAGGCTGGCCAGGCCTGG - Intronic
1119325957 14:73759707-73759729 TGCACGCGGCGGGGCCGGCGAGG - Intronic
1119505865 14:75172596-75172618 TGAACAATGATGGCCAGGCGCGG - Intronic
1122767153 14:104080691-104080713 TGAAGCAGGCTGGCCCGGCCTGG - Intergenic
1122965089 14:105119735-105119757 TGCACAAGGCTGGGCCTGTGAGG + Intergenic
1123691119 15:22838869-22838891 TGCCCAAGGCTGCGCCGGCGAGG + Exonic
1124512556 15:30339573-30339595 AGAACAAGACTGGCCAGGCGCGG - Intergenic
1129373179 15:75110558-75110580 TGCAGAATGCTGGCCTGGCAAGG + Intronic
1129407434 15:75328690-75328712 TCCAGCAGGCTGGCCCAGCGTGG - Intergenic
1129832886 15:78682099-78682121 TGCACAAGGCAGCCCTGGGGTGG - Intronic
1131016327 15:89060379-89060401 TTAAAAAGGCTGGCCGGGCGAGG - Intergenic
1132861694 16:2074923-2074945 TGTAGAAGCCTGGCCAGGCGCGG + Intronic
1133264600 16:4575665-4575687 TCCCCAAGGCTGGCCCAGGGTGG + Exonic
1133967815 16:10544469-10544491 TGCAGAATCCTGGCCAGGCGTGG - Intronic
1134640053 16:15822981-15823003 TGCAGACAGCTGGCCCGACGGGG + Intronic
1134882442 16:17757474-17757496 TCCCAAAGGCTGGCCAGGCGAGG - Intergenic
1137457546 16:48629668-48629690 TGCACAGTGCTGGCTGGGCGCGG + Intergenic
1137626631 16:49912908-49912930 TGCACAGGGCTGGCCTGGCCAGG - Intergenic
1137700343 16:50493386-50493408 TACACATGGCTGGCCGGGTGTGG - Intergenic
1139675487 16:68520473-68520495 TGTAAAAGTCTGGCCGGGCGCGG - Intergenic
1139868346 16:70082287-70082309 TGGAGAAGACTGGCCAGGCGCGG + Intergenic
1141169940 16:81684877-81684899 TGGCCAAGGCTGGCCTGGGGTGG - Intronic
1142478767 17:205275-205297 TGCACAAGACAGCCCCGGGGTGG + Intergenic
1142760539 17:2039665-2039687 TCCACAGGGCTGGCCGGGCGCGG - Intronic
1143053484 17:4145074-4145096 AGCACTAGGCTGGCCGGGTGTGG - Intronic
1143315621 17:6030593-6030615 TGAAAATGGCTGGCCGGGCGCGG - Intronic
1143595971 17:7914252-7914274 TGCCAGAGTCTGGCCCGGCGCGG + Intergenic
1144005625 17:11096492-11096514 TTCACAGGTCTGGCCAGGCGCGG - Intergenic
1144867285 17:18344860-18344882 TGCTCTAGCCTGGCCCTGCGTGG + Intronic
1145881649 17:28357063-28357085 TGTACAGGGCTGGCCCTGGGGGG - Intronic
1145937263 17:28721953-28721975 TGCTCGTGGCTGGCCGGGCGCGG + Intronic
1146723365 17:35138732-35138754 TGCAGATTGCTGGCCAGGCGTGG - Intronic
1147936722 17:44015681-44015703 TTCACAACTCTGGCCTGGCGCGG - Intronic
1148500793 17:48089389-48089411 TGCAGATGCCTGGCCAGGCGCGG - Intronic
1148704505 17:49617631-49617653 TACAGAAGGCTGGCTGGGCGTGG + Intronic
1151917445 17:77128742-77128764 TGCCCAAGCGTGGCCAGGCGCGG - Intronic
1153961409 18:10143183-10143205 TTCACATGGCAGGCCCTGCGAGG - Intergenic
1154127098 18:11701298-11701320 TGCATAATGCTGGCCAGGCGCGG + Intronic
1154292516 18:13122131-13122153 TGCAAAAAGCAGGCCAGGCGCGG + Intronic
1156076589 18:33286263-33286285 TACACATTGCTGGCCAGGCGTGG - Intronic
1158134295 18:54189510-54189532 TACAAAAAGCTGGCCGGGCGCGG - Intronic
1160121266 18:76132407-76132429 TGCAATAGGCTGGCTGGGCGTGG - Intergenic
1160332446 18:78006932-78006954 TGCATGAGGCTGGCCCTGCAGGG - Intergenic
1160450031 18:78956617-78956639 AGAACAAGGCTGGCCAGGTGCGG - Intergenic
1160748768 19:723884-723906 TGCAAAAAGCAGGCCGGGCGCGG - Intronic
1161125746 19:2556296-2556318 TGCAGTGGGCTTGCCCGGCGAGG + Intronic
1161167319 19:2795248-2795270 TGCACATGTGTGGCCGGGCGTGG - Intronic
1161190748 19:2953912-2953934 TGCAAAAGCCTGGCCAGGCGCGG + Intergenic
1161559397 19:4963628-4963650 TGCACAATTCTGGCCGGGCGCGG - Intergenic
1162125139 19:8495528-8495550 TGCACAAGGCTGGCCCGGCGTGG - Intronic
1163330399 19:16633164-16633186 TTCACCAAGCTGGCCAGGCGCGG + Intronic
1163495332 19:17643300-17643322 TGCCCATGGCTGGCCGGGCGCGG - Intronic
1165042523 19:33079421-33079443 AGAACAAGACTGGCCAGGCGTGG + Intergenic
1165080751 19:33304655-33304677 TGCACAGGGCAGGCCCGGGTGGG - Intergenic
1165396607 19:35567716-35567738 TGGACAAGGGTGGCTGGGCGTGG - Intergenic
1167005274 19:46772133-46772155 TGGACTATGCTGGCCGGGCGCGG - Intronic
1167348587 19:48961871-48961893 AGCAGACGGCGGGCCCGGCGTGG - Intergenic
1167814421 19:51867482-51867504 AACACAAAGCTGGCCAGGCGCGG + Intronic
1168705287 19:58467199-58467221 TGCGCAGGGCGGGCCCGACGCGG - Exonic
925982842 2:9191166-9191188 TCCACAGGTCTGGCCCGGCCAGG + Intergenic
926320542 2:11746109-11746131 AGGACAGGGGTGGCCCGGCGTGG + Intronic
926672833 2:15591754-15591776 CGCATAAGGCGGGGCCGGCGCGG + Exonic
927654493 2:24933871-24933893 TGCACATCCCTGGCCAGGCGCGG - Intergenic
929497340 2:42457554-42457576 TTTACAAGGCTGGCCAGGCACGG + Intronic
929601413 2:43206944-43206966 TGCTCAGGGATGGCCAGGCGCGG + Intergenic
931036943 2:58254375-58254397 TAGAAAAGACTGGCCCGGCGTGG - Intergenic
931241999 2:60461893-60461915 TGCATAGGGCTGGGCCGGCCTGG + Exonic
931668112 2:64624649-64624671 TTCTCAAGGCTGGCCCAGAGGGG - Intergenic
932283007 2:70510848-70510870 TGCACAAGAAAGGCCAGGCGTGG + Intronic
932417150 2:71580331-71580353 AGCTCAAGCCTGGGCCGGCGAGG + Intronic
932524503 2:72449459-72449481 TTGACAATGCTGGCCAGGCGCGG - Intronic
933087592 2:78075599-78075621 TACACAGGGCTGGCCAGGAGTGG + Intergenic
934748731 2:96777790-96777812 TACACAAAGTTGGCCAGGCGTGG - Intronic
934776466 2:96940940-96940962 TGCACAAGGCAGGTCAGGTGGGG - Intronic
935193399 2:100796054-100796076 TGCACAAATCCGGCCGGGCGCGG + Intergenic
935565025 2:104597028-104597050 TGCACATGGATGGCCTGGTGCGG - Intergenic
938093104 2:128446129-128446151 AAGACAAGGCTGGCCAGGCGTGG - Intergenic
940671761 2:156678831-156678853 TGTACAAGGTGGGCCGGGCGCGG + Intergenic
942469984 2:176250286-176250308 TGCAAAATGCTGGCCGGGAGTGG - Intergenic
944460332 2:199942355-199942377 TGCAAAAGGCTGGCCGGGCGCGG - Intronic
944624948 2:201561069-201561091 TTCATGAGGCTGGCCGGGCGTGG - Intronic
944814857 2:203365022-203365044 AGCATAACGCTGGCCAGGCGTGG - Intronic
948607320 2:239144311-239144333 TGCACAAGGGTGCCCCAGCTTGG - Intronic
948753750 2:240146791-240146813 GGCACAAGGCTGGGCTGGGGTGG + Intergenic
948863377 2:240763616-240763638 AGTACAAGGCTGGCCTGGGGAGG - Intronic
1169275662 20:4232225-4232247 TTCACAAGGCTGGTCTGGCGAGG + Intronic
1169874624 20:10283425-10283447 TGGACAGGGCTGGCCCAGGGTGG - Intronic
1171499421 20:25581965-25581987 TGCTCAAGTCCGGCCAGGCGTGG + Intronic
1172965572 20:38831925-38831947 TGCACAAGCATGGCCCGAAGAGG - Intronic
1173991692 20:47308509-47308531 TGCTCATGTCTGGCCAGGCGCGG - Intronic
1174157405 20:48524741-48524763 TGCAAAGGGCTGGCCAGGGGTGG + Intergenic
1174260685 20:49292704-49292726 AGCACAAGCATGGCCAGGCGCGG + Intergenic
1175099995 20:56572428-56572450 AGAACAAGGCTGGCCGGGTGTGG + Intergenic
1176281690 20:64316983-64317005 TTCCCCAGGCTGGCCCGGCGAGG + Intergenic
1178581501 21:33842183-33842205 TGCCCAAGAGTGGCCGGGCGCGG - Intronic
1179119491 21:38529672-38529694 TACACATGGCTGGCCAGGCGCGG + Intronic
1179957253 21:44748607-44748629 TGCAGAAGGCTGGCTTAGCGGGG + Intergenic
1180253607 21:46606578-46606600 TGCAGAGGGCAGGCCCGGCTGGG - Intergenic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
1183215031 22:36473938-36473960 TGCACATGGCTGGCCCTCAGGGG + Intronic
1183317742 22:37146187-37146209 GGCACGAGGCTGGCCTGGTGAGG - Intronic
1183629051 22:39022218-39022240 TGCACAGGGCTGGCCTGGAAAGG + Intronic
1183633694 22:39048209-39048231 TGGACAGGGCTGGCCCGGAAAGG + Intronic
1184587442 22:45457464-45457486 TGAACAAGGCTGGCCTGGGCTGG - Intergenic
1184611610 22:45607486-45607508 TGCAGAGAGCTGGCCGGGCGTGG + Intergenic
1184742198 22:46435240-46435262 TGGACAAGGCTGGCCAGGCAAGG - Intronic
1184818820 22:46893375-46893397 TCCACAAGGCTGGGCAGGTGGGG - Intronic
1185384860 22:50526967-50526989 AGGTCAAGGCTGGCCCGGCCTGG - Intronic
951853776 3:27171544-27171566 AGCTCAAGGGTGGGCCGGCGGGG - Intronic
951901858 3:27664931-27664953 TGAACAAGACTGGCCTGGCGTGG + Intergenic
954296602 3:49677747-49677769 GGCATAAGGCTGGCCCAGCAGGG - Intronic
954381580 3:50221704-50221726 TGCACCAGGCTAGGCCGCCGGGG + Intergenic
955255030 3:57322637-57322659 TGCAGACAGCTGGCCAGGCGTGG + Intronic
955913818 3:63885817-63885839 TGCACCATGTTGGCCCGGCTAGG - Intronic
960803473 3:121561336-121561358 TGCCCAGGGTTGGCCGGGCGTGG + Intergenic
961448556 3:126992259-126992281 GGCACCAGGCTGGCCTGGTGTGG + Intronic
962244007 3:133776311-133776333 TCAACAAGGCTGGCCCTGAGTGG - Intronic
962376782 3:134864849-134864871 TCCACAGGGCTGTCCCGGAGTGG + Intronic
962586921 3:136851202-136851224 TGAACAATGTTGGCCGGGCGCGG + Intronic
963191071 3:142473827-142473849 AGAACAAAGCTGGCCGGGCGTGG - Intronic
964488495 3:157209745-157209767 GGCACAATGCTGGCTGGGCGTGG + Intergenic
966129601 3:176622369-176622391 TGAGCAAGGCTGGCCGGGCATGG + Intergenic
968075358 3:195813162-195813184 TGGACAAGGCTGGCTCTGCTTGG - Intergenic
968442005 4:628921-628943 TGCACAAGGGGGGCCCTGCCGGG + Intronic
968650623 4:1758960-1758982 GGCACAGGGCTGGCCTGGGGTGG - Intergenic
968758946 4:2431870-2431892 TACACAAAGCTGGCCAGGTGTGG - Intronic
968974817 4:3816533-3816555 TGCCCCAGGCTGGCCCAGCAGGG - Intergenic
969720201 4:8889269-8889291 TGCACAAGGTTGGCGCAGGGAGG + Intergenic
974117773 4:57601370-57601392 GGCACAAGGCTGGCACTGCTTGG + Intergenic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
978818511 4:112936632-112936654 TGGATAATGCTGGCCGGGCGTGG - Intronic
980870006 4:138600466-138600488 TGCACAAGGATGGCCGGGCATGG + Intergenic
980990613 4:139735542-139735564 TGCACAAAGCCGGCCCGGGGAGG + Intronic
982562118 4:156942226-156942248 TCCAGAAGGCTGGCCAGGGGAGG + Intronic
982581625 4:157186394-157186416 TACATAAAGCTGGCCGGGCGCGG - Intergenic
984675663 4:182544590-182544612 TCCACAATGCAGGCCGGGCGCGG - Intronic
987674056 5:21051512-21051534 TGTACAATTCTGGCCGGGCGCGG + Intergenic
988538577 5:32089611-32089633 GCCACATGGCTGGCCAGGCGCGG - Exonic
989157064 5:38354436-38354458 TGCACACTTCTGGCCAGGCGCGG + Intronic
990753121 5:59039441-59039463 TGCAGAAGGCTCGGCAGGCGGGG - Intronic
991779738 5:70121050-70121072 AGCAGATGGCTGGCCGGGCGCGG + Intergenic
991811674 5:70480800-70480822 AGCAGATGGCTGGCCGGGCGCGG - Intergenic
991859025 5:70996494-70996516 AGCAGATGGCTGGCCGGGCGCGG + Intronic
991872185 5:71121378-71121400 AGCAGATGGCTGGCCGGGCGCGG + Intergenic
993479881 5:88411370-88411392 TGAAAAAAGCAGGCCCGGCGTGG + Intergenic
993739374 5:91518762-91518784 TGCACATGGCAGGCGCGGTGTGG + Intergenic
996200270 5:120664006-120664028 TGGACAAATCTGGCCGGGCGCGG + Intronic
996768473 5:127059853-127059875 AACACAAAGCTGGCCAGGCGTGG + Intronic
997110733 5:131071219-131071241 TACATAAGGCAGGCCAGGCGCGG - Intergenic
999904997 5:156131017-156131039 TACAGAATGCTGGCCGGGCGTGG - Intronic
1000792905 5:165628622-165628644 TGCACATTACTGGCCGGGCGCGG - Intergenic
1000949016 5:167457634-167457656 AGCAGAAGGCTGGTCGGGCGTGG - Intronic
1001152914 5:169247811-169247833 TGGACAAGGCTGCCCAGGCTGGG - Intronic
1001942660 5:175751578-175751600 TGCACAAGGCTGGCCCATCAAGG + Intergenic
1003183764 6:3813278-3813300 TGCACTCGGCTGGACCAGCGAGG - Intergenic
1003840381 6:10113391-10113413 TGCGCAGGCCTGGCCCAGCGGGG + Intronic
1004590006 6:17041318-17041340 TACAAAAGGTTGGCCGGGCGTGG - Intergenic
1005751917 6:28891565-28891587 TGGACAAGACTGGCCGGGCACGG + Intergenic
1006070011 6:31491358-31491380 TGCAAAAACCTGGCCTGGCGTGG + Intergenic
1006951198 6:37822123-37822145 GGTAAAAGGCTGGCCGGGCGCGG - Intronic
1007231447 6:40350029-40350051 AGCACAGGGCTGACCCGGTGTGG - Intergenic
1007406640 6:41639365-41639387 TGCACAGGGCAGGGGCGGCGGGG - Intronic
1007538791 6:42621749-42621771 TGGCCAAGGCTGGCCTGGCGCGG - Intronic
1007619893 6:43205538-43205560 TGGAGATGGCTGGCCAGGCGCGG + Intronic
1009167420 6:60357555-60357577 TACAAAAGGCAGGCCGGGCGTGG - Intergenic
1009753423 6:67902295-67902317 TGCTCAAAACTGGCCAGGCGCGG - Intergenic
1010963057 6:82168919-82168941 TGAAGAAAGCTGGCCGGGCGTGG - Intergenic
1011138100 6:84121351-84121373 TGCACAAGCGTGGCCAGGCATGG + Intergenic
1015147975 6:130008668-130008690 TGCACTAGGCTTGCCTGGTGTGG + Intergenic
1017844231 6:158241881-158241903 TTAACAAAGCTGGCCTGGCGCGG - Intronic
1017986684 6:159449134-159449156 TGCACAAGTCTGGCCTGGCGCGG - Intergenic
1018940993 6:168308770-168308792 TCCTCGAGGCTGGCCCGGCCAGG - Exonic
1019584323 7:1789174-1789196 TACACTAAGCTGGCCGGGCGTGG + Intergenic
1019639457 7:2095719-2095741 CGCACAAGGCTCAGCCGGCGGGG + Intronic
1020097941 7:5378892-5378914 TACACATGGCTAGCCAGGCGAGG + Intronic
1020107805 7:5430226-5430248 TGCACAGGCCTGCCCCGGAGGGG - Intergenic
1024982038 7:55165646-55165668 TGCACAACACAGGCCCGGCCGGG - Intronic
1025066969 7:55865373-55865395 TCCCCAAGCTTGGCCCGGCGCGG - Intergenic
1026945764 7:74314984-74315006 GACACAAAGCTGGCCGGGCGTGG + Intronic
1027218412 7:76198876-76198898 TGCAAAAGCCTGGTCAGGCGCGG - Intergenic
1029333287 7:99878234-99878256 TGCACACACCTGGCCGGGCGCGG + Intronic
1029480886 7:100812297-100812319 GGCAGAGGGCTGGCCAGGCGTGG + Intronic
1032752684 7:134857445-134857467 AGCACAAAACTGGCCGGGCGCGG - Intronic
1033204170 7:139402812-139402834 TGCAGAGAGCTGGCCAGGCGTGG - Intronic
1035295219 7:157863482-157863504 GGCACAAGTCTGGCCCAGCCAGG - Intronic
1035588846 8:798038-798060 TACAAAAGACTGGCCAGGCGTGG - Intergenic
1035845457 8:2859467-2859489 TGCCCAACGTTGGCCGGGCGCGG + Intergenic
1037580658 8:20244310-20244332 AGCACAAGGCGGGCCAGGTGCGG - Intergenic
1037752938 8:21694414-21694436 TGCAGAAGGCTGGGCCGGTGGGG - Intronic
1037802452 8:22043051-22043073 TGCACGGGGCTGGCAGGGCGGGG + Intronic
1042401748 8:68357635-68357657 TGCATAAGGCTGGCCTGTTGAGG + Intronic
1045455765 8:102377415-102377437 TGTACAATACTGGCCAGGCGTGG + Intronic
1046498503 8:115044765-115044787 TACACAAGTCAGGCCAGGCGCGG + Intergenic
1048410626 8:134168727-134168749 TGCACAAGCCAGGCACGGCCTGG - Intergenic
1049161976 8:141103585-141103607 TGCAAATGGCTGGCCTGGAGGGG - Intergenic
1049356496 8:142191735-142191757 TGCACAGCGCTGGCCAGTCGGGG + Intergenic
1052985018 9:34480555-34480577 TGTACAAAGTTGGCCAGGCGCGG - Intronic
1053446137 9:38154679-38154701 AGCACGAGGCTGGCCCTGGGGGG - Intergenic
1056959332 9:91108168-91108190 TGCATTAGGCTGGCCGGGTGTGG - Intergenic
1057585486 9:96324843-96324865 TGCAGCAGGCGGGCCAGGCGCGG - Intronic
1058110707 9:101028715-101028737 AGCAAAAGGCTGGCGCGGAGGGG - Exonic
1060189870 9:121585564-121585586 TGCACAAGATTGGCTGGGCGCGG + Intronic
1060482639 9:124026166-124026188 TGAACAAGACTGGCTGGGCGTGG + Intronic
1060598356 9:124861694-124861716 TGCCCAAGGCACGGCCGGCGAGG - Intronic
1061930780 9:133832081-133832103 TGCAGAAGGCTTGCCCTGCTAGG + Intronic
1062461109 9:136662926-136662948 TGCACCAAGCTGGCCCTGCACGG + Intronic
1062529527 9:136993812-136993834 AGCACAAGCGTGGCCCCGCGGGG + Exonic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062586860 9:137253408-137253430 TGGACAAGGCTGGCCCAGCCTGG + Exonic
1185472562 X:393141-393163 TACAAAATGCTGGCCAGGCGCGG - Intergenic
1190003621 X:46713207-46713229 TGCACAAGGCAGGCTGGGCATGG + Intronic
1190476517 X:50833367-50833389 AGAACAGGGCTGGCCGGGCGCGG + Intergenic
1193216878 X:78874820-78874842 TACAAAAAGCTGGCCGGGCGTGG + Intergenic
1196486896 X:116222250-116222272 TACACAAGACAGGCCAGGCGCGG - Intergenic
1196928241 X:120655355-120655377 TGAAAAAGGTAGGCCCGGCGCGG - Intergenic
1200242698 X:154506261-154506283 TGGAGCAGGCTGGCCCGGGGTGG - Exonic