ID: 1162125619

View in Genome Browser
Species Human (GRCh38)
Location 19:8498279-8498301
Sequence TCTACCCCACAGATCTACGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162125619_1162125624 -10 Left 1162125619 19:8498279-8498301 CCTCCGTAGATCTGTGGGGTAGA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162125624 19:8498292-8498314 GTGGGGTAGAGAGTAGGGCAGGG 0: 1
1: 0
2: 6
3: 67
4: 605
1162125619_1162125627 8 Left 1162125619 19:8498279-8498301 CCTCCGTAGATCTGTGGGGTAGA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162125627 19:8498310-8498332 CAGGGAAGCCGGCACTGCCTGGG 0: 1
1: 0
2: 2
3: 16
4: 210
1162125619_1162125626 7 Left 1162125619 19:8498279-8498301 CCTCCGTAGATCTGTGGGGTAGA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162125626 19:8498309-8498331 GCAGGGAAGCCGGCACTGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 293
1162125619_1162125625 -3 Left 1162125619 19:8498279-8498301 CCTCCGTAGATCTGTGGGGTAGA 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1162125625 19:8498299-8498321 AGAGAGTAGGGCAGGGAAGCCGG 0: 1
1: 0
2: 5
3: 83
4: 902

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162125619 Original CRISPR TCTACCCCACAGATCTACGG AGG (reversed) Exonic
901229234 1:7632785-7632807 TCTTCCCCAGAGACCCACGGAGG - Intronic
923152121 1:231242566-231242588 TCTTCCCCACAGTTCTGTGGTGG + Intronic
1067088338 10:43254345-43254367 CCCACCACACAGATCTAAGGGGG - Intronic
1069491795 10:68867358-68867380 TATACCCCCCAGATCAACAGGGG - Intronic
1081639688 11:44744272-44744294 TCTAGCCCAGAGATCAACAGGGG + Intronic
1083108653 11:60383341-60383363 TCTAGACTACAGATCTACAGTGG + Intronic
1085364781 11:75929679-75929701 TGTCCCCCACAAATCTATGGAGG - Intronic
1086669774 11:89532284-89532306 TCTACCCTACAGAGCCACAGAGG + Intergenic
1089300453 11:117495600-117495622 TCTAGCACACAGCTCTAGGGAGG + Intronic
1090256693 11:125289386-125289408 TCTACTCCACAAATCTTCTGAGG + Intronic
1091667427 12:2429500-2429522 TTTACCCCACTGGACTACGGTGG - Intronic
1102456252 12:113072590-113072612 TCTACCCCAAAGAATTACTGGGG - Intronic
1103169346 12:118800731-118800753 TCCACCCTACAGATCTACCCAGG - Intergenic
1103902524 12:124310748-124310770 TCCACCCCACAGCTCCACGCTGG - Intronic
1115377733 14:32696482-32696504 TCTACCCCTCAGATCTTCCCAGG + Intronic
1129332248 15:74833680-74833702 TCTATCCCACAGACCTGAGGTGG + Intergenic
1130783990 15:87075246-87075268 TCTACCTCACATAGCTACTGTGG + Intergenic
1162125619 19:8498279-8498301 TCTACCCCACAGATCTACGGAGG - Exonic
928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG + Intronic
932642980 2:73468917-73468939 TCTACCCCACAGAAATGCAGAGG + Intronic
934525241 2:95047947-95047969 CCTCCCCCGCAGATCTTCGGGGG + Exonic
935915747 2:107947620-107947642 TACACCCCACAGATCAACAGGGG - Intergenic
944876640 2:203968994-203969016 CCTAGCCCAAAGATCTACTGTGG - Intergenic
1169448953 20:5695073-5695095 TCTACCACAAAGATTTAAGGGGG + Intergenic
1174191745 20:48745398-48745420 TCTATCTCACAGATTTACAGTGG - Intronic
1183916182 22:41121462-41121484 TCTCCCACACAGATCTGCTGAGG - Intronic
1184734703 22:46391275-46391297 TCTACCCCAGTGATCTACAATGG - Exonic
952392632 3:32893319-32893341 TCTACCCCACAGTTCTGCAGTGG - Exonic
953304558 3:41815636-41815658 GCTACCCCACTGATCTGAGGAGG - Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
960285845 3:115827697-115827719 TCTTCCCCACTGATCTGTGGTGG + Intronic
976842241 4:89445268-89445290 TGTACCCCACAAAGCTACAGGGG - Intergenic
976949680 4:90813384-90813406 TATACCCCACAGAGCCACAGGGG - Intronic
981819916 4:148874569-148874591 TCTTCCCCTTAGATCTACAGTGG - Intergenic
1006341474 6:33449382-33449404 TCTGCCTCACAGATATAAGGAGG - Intronic
1006529757 6:34641478-34641500 TATACCCCACAGAGCTCCAGCGG + Intronic
1012212357 6:96536473-96536495 TATAACCCACAGATCAAAGGAGG - Intronic
1027953146 7:84845764-84845786 TTTACCCCACAGAAATATGGTGG + Intergenic
1032739196 7:134721957-134721979 TCTACCCTGAAGATCTATGGTGG + Intergenic
1037561569 8:20079655-20079677 TCTCCCCCACTTATCCACGGGGG - Intergenic
1046311189 8:112440358-112440380 TATACCCTGCAGATCTACAGAGG - Intronic
1049672444 8:143875987-143876009 TCGACCCCACAGCTCTGGGGCGG + Intronic
1187271128 X:17780695-17780717 TCTACCCCACAGATAAATAGAGG - Intergenic
1189158473 X:38785038-38785060 TCTAGCCCACTGATCCAAGGAGG + Intergenic