ID: 1162127691

View in Genome Browser
Species Human (GRCh38)
Location 19:8508146-8508168
Sequence CTGTATATCCAGGAGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162127687_1162127691 1 Left 1162127687 19:8508122-8508144 CCTGGGTTCTTGCTCACAGGATG No data
Right 1162127691 19:8508146-8508168 CTGTATATCCAGGAGGATGAGGG No data
1162127686_1162127691 2 Left 1162127686 19:8508121-8508143 CCCTGGGTTCTTGCTCACAGGAT No data
Right 1162127691 19:8508146-8508168 CTGTATATCCAGGAGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162127691 Original CRISPR CTGTATATCCAGGAGGATGA GGG Intergenic
No off target data available for this crispr