ID: 1162130368

View in Genome Browser
Species Human (GRCh38)
Location 19:8522577-8522599
Sequence GCAGGGGGTAGGGGAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162130368_1162130381 15 Left 1162130368 19:8522577-8522599 CCAGACACTCCCCTACCCCCTGC 0: 1
1: 0
2: 4
3: 68
4: 527
Right 1162130381 19:8522615-8522637 GCCCTCCCACCCCACCTACCCGG 0: 1
1: 0
2: 7
3: 57
4: 493
1162130368_1162130389 26 Left 1162130368 19:8522577-8522599 CCAGACACTCCCCTACCCCCTGC 0: 1
1: 0
2: 4
3: 68
4: 527
Right 1162130389 19:8522626-8522648 CCACCTACCCGGCCATGCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162130368 Original CRISPR GCAGGGGGTAGGGGAGTGTC TGG (reversed) Intronic
900479232 1:2890065-2890087 GGAGAGGGTAGAGGAGGGTCGGG + Intergenic
900622261 1:3592924-3592946 GCAGGGAGCAGGGGAGGGTGGGG - Intronic
900725838 1:4215968-4215990 GCAGGGGGTGGTGGAGAGGCAGG - Intergenic
900991836 1:6101696-6101718 GTGGGGGGTGGGGGCGTGTCCGG - Intergenic
901306791 1:8238776-8238798 CCAGGAGGTAGGGGACGGTCAGG + Intergenic
901772816 1:11539163-11539185 GCAGAGGGGAGGGGAGGGGCTGG + Intergenic
902089107 1:13888916-13888938 GCAGAGGGCAAGGGAGTGTGGGG - Intergenic
902188524 1:14743719-14743741 GCAGGGAGTAGTGGAGGGTGAGG - Intronic
902468175 1:16630802-16630824 GGTGGGGGTGGGGGCGTGTCTGG - Intergenic
902742528 1:18448835-18448857 GGAGGGGGTAGGTGATTTTCAGG - Intergenic
902798650 1:18815869-18815891 GCTGGGGGTGGGGGACTGGCGGG - Intergenic
903065535 1:20697202-20697224 GGAGGTGGTAGGTGAGTGGCAGG + Intronic
903172547 1:21563085-21563107 GCAGGTGGGAGAGGAGGGTCAGG - Intronic
903213397 1:21830718-21830740 GCTGGGGGTGGGGGAGTGCCTGG + Intronic
903391785 1:22969600-22969622 ACAGGGGGCAGGGGAGGGGCAGG - Intergenic
903532382 1:24041485-24041507 GGAGGGGGTTAGTGAGTGTCTGG + Intergenic
903654947 1:24943261-24943283 GCAGGGTGGAGGGGGGTGTCTGG + Intronic
903950266 1:26992612-26992634 GAAGGGGGAAGGGGGGTGTGCGG - Intergenic
904284071 1:29442896-29442918 GTAGGGTGGTGGGGAGTGTCTGG - Intergenic
904381068 1:30111550-30111572 GCCGTGGGGAGGGGAGTGGCGGG + Intergenic
904443093 1:30544800-30544822 GAAGGGGGTAGGGCACAGTCAGG - Intergenic
904480292 1:30789104-30789126 CCTGGGGGTAGGGGAGGATCCGG - Intergenic
905271430 1:36790166-36790188 GCAGGAGCTAGGGGCTTGTCTGG + Intergenic
905291270 1:36923307-36923329 GCAGGGGGTAGAGGGGTGGGAGG + Intronic
905386221 1:37606114-37606136 GCGGGGAGTAGGGGAGGGACAGG - Intergenic
905454175 1:38076200-38076222 GGAGGGGGGAGGGGAGGGACAGG - Intergenic
905786968 1:40766118-40766140 GCATGGGGCAGGGCAGTGTGAGG + Intronic
905885284 1:41488446-41488468 GCTGGGGGTTGGGGAGGGTTTGG + Intergenic
906155506 1:43611837-43611859 GCAGGGGGTAGGGGTGTCCTGGG + Intronic
906264960 1:44421620-44421642 GCAGGGGGAAGGGGAGGGCAGGG + Intronic
906510171 1:46406150-46406172 TCAGGTGGCAGGGCAGTGTCTGG + Intronic
906709058 1:47915850-47915872 GGTGGGGGTAGGGGAGCGTGGGG - Intronic
906836943 1:49094216-49094238 GGTGGGGGTAGGGGAGTGGGGGG - Intronic
907326314 1:53640789-53640811 GCATGGGGTAGGGGAGGGAGTGG - Intronic
907497981 1:54857851-54857873 GCTGGGGGAAGGGAAGTGACTGG + Intronic
908811699 1:67988090-67988112 GCATGGTGTAAGGGAGTGTATGG - Intergenic
908929993 1:69306464-69306486 GGAGGGGGCAGGGGAGTGCTGGG - Intergenic
909633676 1:77792430-77792452 GCATGGTGCAAGGGAGTGTCTGG + Intronic
910798228 1:91119591-91119613 GCTGGGGGTAGGGGTGTGTGTGG - Intergenic
911115809 1:94246489-94246511 GCGGGGGGAAGGGGAATGTTAGG - Intronic
911115996 1:94247444-94247466 GCAGGGGCTAGGGGCGCGCCCGG - Intronic
912707827 1:111927983-111928005 GCAGTGGGTAGGGGAGGCCCTGG - Intronic
913998572 1:143672803-143672825 GCAGGGGAGAGGGCAGGGTCAGG - Intergenic
914876044 1:151513245-151513267 GCAAGGGGAAGGGGAGGGCCGGG - Intronic
915163161 1:153933588-153933610 GCGGGAGGCAGGGGAGTGGCGGG + Exonic
915339308 1:155167554-155167576 GGAGGGGGGAAGGGAGTGGCGGG - Intergenic
915459552 1:156061582-156061604 GCAGGGAGTGGGGGAGGGTCTGG + Intronic
915589510 1:156862581-156862603 GCAGTGGGGAGGGGGATGTCAGG - Intronic
915962488 1:160278830-160278852 GCAGGGGATAGAGGAAGGTCAGG + Exonic
916059321 1:161088036-161088058 ACAGGTGGTAGGGGACTGTGAGG + Intronic
916247033 1:162698615-162698637 GCAGGAGTTAGGGGAGAGGCAGG - Intronic
918104771 1:181407257-181407279 GCAGGGAGTGGGGGTGGGTCAGG + Intergenic
918984962 1:191613599-191613621 GGAGTGGGTTGGGGAGTGCCAGG + Intergenic
920196190 1:204228788-204228810 TCAGGGCTCAGGGGAGTGTCAGG + Exonic
920914920 1:210251801-210251823 GCAGTGGGTGTGGGTGTGTCCGG + Intergenic
921101572 1:211933376-211933398 AGAGGGGGCAGGGGAGTGCCAGG - Intergenic
921207505 1:212861043-212861065 GCAGGGGGTAAGGATGTGCCCGG - Intronic
921218717 1:212958295-212958317 GCTGGGGGCAGGGCAGTGGCGGG - Intronic
921289332 1:213641805-213641827 GCAGGGGGTGGGGGTGGGTGGGG - Intergenic
923353355 1:233130285-233130307 TGAGGGGGTAGGAGTGTGTCCGG - Intronic
923390071 1:233505871-233505893 GCAGGGGGAGGGAGAGTATCAGG - Intergenic
923565033 1:235070113-235070135 GCAGGGAGAAGGGGAGTTTCTGG - Intergenic
924581543 1:245328245-245328267 GCAGGGGGGAGGGGGGTCCCAGG + Intronic
1063256104 10:4329082-4329104 GCAGGGTGGGGGTGAGTGTCAGG + Intergenic
1063363838 10:5478085-5478107 GCAGGGGGTAGCTGAGTTTAGGG - Intergenic
1063434263 10:6017970-6017992 GGAGGGGGTAGGGGGGAGGCAGG + Intronic
1063436214 10:6034367-6034389 GCAGGAGGTAGAAGAGTGTGTGG + Intronic
1064216703 10:13406493-13406515 GCTGGGGATGGGAGAGTGTCAGG - Intergenic
1064342749 10:14501387-14501409 GCAGGGGTGGGGGGGGTGTCGGG - Intergenic
1064863985 10:19858648-19858670 GCAAGGTGCAGGGGAGAGTCTGG + Intronic
1066198956 10:33127944-33127966 GCGGGGGGGAGGGGAGGGGCGGG - Intergenic
1067354999 10:45516049-45516071 GGATGGGGTAGGGGAGTGGGTGG - Intronic
1067743882 10:48918746-48918768 GCAGGGGGTAGGATGGTGACAGG + Intronic
1070497151 10:77034990-77035012 GCAGAGGGGAGGGGAGGGGCTGG - Intronic
1070802436 10:79251507-79251529 TGAGGGGTTGGGGGAGTGTCTGG - Intronic
1071600404 10:86956130-86956152 GCAGGGGGCGGGGGAGGGGCGGG - Intronic
1072245756 10:93542538-93542560 GCAGGTGGAAGGGGAGGGTCAGG - Intergenic
1073053432 10:100684033-100684055 GCAGGGGGGAGGGGAGGAGCAGG + Intergenic
1073283994 10:102376240-102376262 GCAGGGAGAAGGGCAGAGTCAGG - Intronic
1073424580 10:103448760-103448782 GCAGGGGGTGAGGGAGAGACAGG - Intronic
1074088711 10:110227238-110227260 GCGGGGGGGAGGGGCGTGTGCGG + Intronic
1074732495 10:116393633-116393655 GTAGGGGGTCGGGGAGGCTCAGG - Intergenic
1074830138 10:117241868-117241890 GCAGGGGTAAGTGGAGTGCCGGG - Intronic
1075521135 10:123144178-123144200 GGAGGGGGGTGGAGAGTGTCGGG + Intergenic
1075639412 10:124054071-124054093 TCAGGAGGTGGGGGAGTGTGGGG - Intronic
1075677869 10:124308726-124308748 GGAGGGGGTAGGGGAGAGCTGGG - Intergenic
1075960247 10:126562271-126562293 GCAGGGGGTAAGGGAGGGCAGGG - Intronic
1076053030 10:127350365-127350387 GGAGGGAGTAGGGGAGTGCCTGG - Intronic
1076076716 10:127539072-127539094 GCAGGAGATATGGGAATGTCAGG - Intergenic
1076258676 10:129048819-129048841 GGAGGGGGTAGAAGAGAGTCTGG + Intergenic
1076475203 10:130746770-130746792 GCATGGGGAAGGGGAGGGTCTGG - Intergenic
1076618253 10:131770923-131770945 GCAGGAGGTAGGAGAGGGGCGGG + Intergenic
1077031239 11:468906-468928 GGAGGGAGGAGGGGAGTCTCTGG + Intronic
1077080169 11:721513-721535 GCGGGGCGGTGGGGAGTGTCAGG + Intronic
1077300921 11:1846570-1846592 GCTGGGGCTGGGGGAGAGTCGGG - Intergenic
1077413215 11:2413092-2413114 GCAGGGTGGAGGGGACTGGCGGG - Intronic
1077476066 11:2791181-2791203 GCAGGCGGCAGGGGCGTGTCAGG + Intronic
1078524433 11:12089822-12089844 GCAGGGGGAAGGAGAGCATCAGG + Intergenic
1078771629 11:14357986-14358008 GCTGGGGGTAGGGGAGAGGGTGG + Intronic
1078827930 11:14949661-14949683 GCAGAGGGTGGGGGAGTGAATGG - Intronic
1080283992 11:30586794-30586816 GCAGGGGTAAGGGGAGCGGCTGG + Intronic
1080341124 11:31266412-31266434 GAAGGGGTTTGAGGAGTGTCAGG + Intronic
1081352053 11:42066147-42066169 GCACGGGATAGGGGCGTGGCAGG - Intergenic
1081407180 11:42711220-42711242 GCAGTGGGTACGTGAGTGGCTGG - Intergenic
1081719852 11:45280624-45280646 GCAGCGGGTAGGAGAGCTTCTGG - Intronic
1081814885 11:45933422-45933444 GAAGAGGGAAGGGGAGTGGCTGG - Intronic
1082793188 11:57361429-57361451 GCAGGGGGAAGGAGAGCATCAGG - Intronic
1083261987 11:61528185-61528207 GCTGGGGGTGGGGGAGAGGCCGG + Exonic
1083264734 11:61541443-61541465 GCAGGGGGTGGGCGAATGGCTGG + Intronic
1083702307 11:64487461-64487483 GCAGGGGGTGGGTGAGTGGGGGG + Intergenic
1084266595 11:68008357-68008379 GCAGGTGGGAGGGGTGTTTCAGG - Intergenic
1085273136 11:75282089-75282111 GATGGGTGTATGGGAGTGTCTGG - Intronic
1085322516 11:75583638-75583660 GCAGGGAGTCGGGGGGTCTCTGG - Intergenic
1086487683 11:87326118-87326140 GCTGGGGGTGGGGGAGAGTATGG - Intergenic
1086842635 11:91706381-91706403 GAAAGGGCTAGGGGAGAGTCAGG - Intergenic
1087244602 11:95819605-95819627 GGAAGGGGCAGGGGAGTATCTGG - Intronic
1087300951 11:96434760-96434782 ACAGGGGCTAGGGCAGTGTCTGG - Intronic
1088510905 11:110573721-110573743 TCAGGGGTGAGGGGAGTCTCAGG + Intergenic
1088527374 11:110771674-110771696 GCAGGGGGTGGGAGAGCATCAGG + Intergenic
1088912668 11:114203811-114203833 GCAGGGAGTAGGGGTGGCTCTGG + Intronic
1089585246 11:119506374-119506396 GCAGGTGGAATGGGAGTGTGTGG + Intergenic
1090064484 11:123491457-123491479 GCTGGGGGAAGGGGAGGGGCAGG - Intergenic
1090636110 11:128691584-128691606 GCGGGGGGTAGTGGAGAGCCTGG - Intronic
1090809416 11:130223652-130223674 GCAGGTAGAAGGGGAGTGTGAGG + Intergenic
1092092487 12:5814237-5814259 GCAGGGAGTTGGGGAATGCCAGG - Intronic
1092970902 12:13693756-13693778 GCAGAGAGTAGGGGAGTCACCGG - Intronic
1093247810 12:16761893-16761915 GCTGGGGGTGGGGGGTTGTCCGG - Intergenic
1093434573 12:19121850-19121872 GCAGTGGGTAGAAGAGTGACTGG + Intergenic
1094294571 12:28889864-28889886 GCAGGGGGCAGGGGAGGTGCTGG - Intergenic
1094469311 12:30788731-30788753 GGAGGGGGAAGGGGGGTGTTAGG + Intergenic
1094514502 12:31119278-31119300 GCAGGGGGAAGGAGAGGGGCTGG - Intergenic
1095349954 12:41198321-41198343 GCAGGGGTTAGGGGAGTGCTGGG - Intronic
1096502772 12:52075161-52075183 GCAGGGGGTTGCCCAGTGTCAGG + Intronic
1096756608 12:53804780-53804802 GAAGGGTGTAGGGGAATGTCTGG - Intergenic
1096784476 12:54009200-54009222 CCCGGGGGGAGGGGAGTTTCGGG + Exonic
1099941497 12:89194541-89194563 GCAGGGGATTGTGGAGTGTTGGG - Intergenic
1100922326 12:99502149-99502171 ACAGAGGGTAGGGGAATATCAGG - Intronic
1101928455 12:108992723-108992745 CCAGGGGCTAGGGGATTGCCAGG + Intronic
1102196617 12:111029991-111030013 GTAAGGGGTATGGGACTGTCTGG - Intergenic
1103440587 12:120959909-120959931 GCTGGGGGGAGGTGACTGTCTGG + Intergenic
1103885032 12:124193988-124194010 GCTGGGTGTGGGGGAGTTTCTGG + Intronic
1104178779 12:126357859-126357881 GGAGGGGATAGGGGAGGGACGGG + Intergenic
1104513732 12:129404668-129404690 GCAGGGGGCAGGGGGGTGTAGGG + Intronic
1104933406 12:132352245-132352267 GCAGGGGGTGTGGGGGTGACCGG - Intergenic
1105305967 13:19169501-19169523 GCAGGGAGAAAGGGAGTGGCAGG - Intergenic
1105589959 13:21783229-21783251 GCTGGGGGTAAGGGAGTGAGGGG + Intergenic
1106101471 13:26697521-26697543 GAAGGGAGCTGGGGAGTGTCGGG + Intergenic
1106582811 13:31032363-31032385 AGAGGGGGCAGGGGAGTGGCGGG - Intergenic
1107513495 13:41107566-41107588 GTGGGGGGTAGGGATGTGTCGGG - Intergenic
1107912215 13:45115859-45115881 CCTGGGGGTAGGGGAGTTTAGGG + Intergenic
1108694198 13:52888458-52888480 GAAGGTGGTAGGGGGGTCTCTGG + Intergenic
1108844427 13:54660308-54660330 GCTGGGAGCAGGGGAATGTCAGG + Intergenic
1109973632 13:69802674-69802696 GCAGGGGGTACGGGACTGGGGGG - Intronic
1113004098 13:105679184-105679206 GTATGGGGTAGGGGAATGACTGG - Intergenic
1113851486 13:113421014-113421036 GCGGGGGGTAGGGGTGTCCCAGG - Intergenic
1114073313 14:19132341-19132363 GCAGGTGGACGGGGAGTATCGGG - Intergenic
1114088954 14:19267642-19267664 GCAGGTGGACGGGGAGTATCGGG + Intergenic
1114530509 14:23392665-23392687 GGTGGGGGTGGGGGAGTGACAGG + Intronic
1114562946 14:23606541-23606563 GCAGGAGGTAGGAGAGTGTTTGG - Intergenic
1114607245 14:24007355-24007377 GCATGGGGTAGCGGGGTGTGAGG - Intergenic
1114610283 14:24035924-24035946 GCAGAGGGAAGGGCAGTGCCAGG + Intergenic
1114872153 14:26671692-26671714 GGAGGGGTTAGGGGAGTTGCAGG + Intergenic
1115513592 14:34162655-34162677 CCAGGGGGTAGGGTGGTGTGGGG + Intronic
1115650271 14:35398061-35398083 GCTGGGGGTGGGGGAGTGGGTGG + Intergenic
1116916857 14:50532996-50533018 GAAGGAGGTGGGGGAGTGCCAGG + Intronic
1119716687 14:76864426-76864448 GCGGGGGGAAGGGGGGTGGCGGG + Intronic
1119759595 14:77141309-77141331 ACAGGGGCTAGGGGAGTGAGGGG + Intronic
1120656721 14:87198882-87198904 GCTGGGAGTAGGGGAATGTTTGG - Intergenic
1121078164 14:91086308-91086330 GCAGGGGGTCGGGGATGGTTTGG - Intronic
1121328262 14:93034263-93034285 ACAGGGGGTGGGGGAGTGTTGGG - Intronic
1121612725 14:95292666-95292688 GCTGGTGGTAGGGGAGGGTGGGG + Intronic
1122077627 14:99246167-99246189 GAGTGGGGGAGGGGAGTGTCAGG + Intronic
1122372616 14:101237009-101237031 GCTGGTGGTAGGTGAGTGCCAGG + Intergenic
1122378690 14:101286333-101286355 GCCGAGGGCAGGGGAGTGGCGGG + Intergenic
1122977853 14:105178350-105178372 ACTGGGGGTAGGGGTGTGTGGGG - Intronic
1122984466 14:105205820-105205842 CCAGTGGGGAGGGGAGTGTCTGG + Intergenic
1123004326 14:105314271-105314293 GCAGGGGGGCGGGGAGACTCGGG + Exonic
1125261285 15:37827937-37827959 GAAAGGAGTAGGGGAGTGACAGG + Intergenic
1125537993 15:40453784-40453806 GCAGGGGGTTGGGGGGGGCCGGG - Intronic
1125991145 15:44109542-44109564 GTAGGGGGTAGGGGAGTATATGG - Intronic
1126372748 15:47964512-47964534 GCAGGGAGTGGAGGAATGTCTGG - Intergenic
1126821483 15:52508615-52508637 GCAGGGGGTGGGGGTGAGGCGGG - Intronic
1127666069 15:61148249-61148271 GCAGGAGGTAGGTGGGTATCAGG + Intronic
1128208893 15:65878243-65878265 GCAGAGGCTCAGGGAGTGTCAGG + Intronic
1128330255 15:66751007-66751029 GCAGGGGGTGGGGGTGTCTCTGG - Intronic
1128618320 15:69127825-69127847 GCAGGGGGCAGGGGAGGGGCAGG - Intergenic
1128637422 15:69312097-69312119 GCGGGGTGCAGGGGAGTGTGTGG + Intronic
1128691381 15:69726989-69727011 GCAGAGGGCAGGGGAGGGCCCGG + Intergenic
1129685493 15:77684136-77684158 GCAGAGTGTGGGGGAGTGTTTGG - Intronic
1129696460 15:77743143-77743165 GCATGGGGTAGGGGGTAGTCCGG - Intronic
1130232903 15:82110058-82110080 GAAGGGGGAACGGGAGTGGCTGG - Intergenic
1131008732 15:88999800-88999822 GGAGGGGAAAGGGGAGTGTGTGG + Intergenic
1131570100 15:93525940-93525962 TCAGGGGGTAGGGGAGAGGAGGG - Intergenic
1132618410 16:853271-853293 GCAGGGGGAAGGGGTGGGTGGGG + Intergenic
1132652762 16:1029029-1029051 GCAGGGGCAGGGGCAGTGTCTGG - Intergenic
1132674767 16:1117069-1117091 GCAGGGGAGAGGGGAGGGTGTGG - Intergenic
1132882570 16:2168875-2168897 GCAGGGGGTGGGGGTGTGTGGGG + Intronic
1133039414 16:3052468-3052490 GCAGGGGGTAGGATAGAGGCAGG + Intronic
1133043257 16:3072101-3072123 GCAGGGGGTAGGATAGAGGCAGG + Intronic
1133745061 16:8680080-8680102 GCTGGAGGTGGGGGAGGGTCGGG - Intronic
1135379980 16:21987757-21987779 GAAGTGGGTGGAGGAGTGTCTGG + Intronic
1135755253 16:25091932-25091954 GCAGGTGGTGTGGGAGTGGCTGG - Intergenic
1136094702 16:27946704-27946726 GCAAGGGGTATGAGAGTATCAGG + Intronic
1136174868 16:28509648-28509670 GCAAGGGATTGGGGTGTGTCAGG - Intronic
1136315751 16:29453950-29453972 GCAGGGGTAGGGGGAGTGGCTGG + Intronic
1136430328 16:30193292-30193314 GCAGGGGTAGGGGGAGTGGCTGG + Intronic
1137918282 16:52456507-52456529 GGTGGGGGTAGGGGAGTGCCTGG + Intronic
1138478424 16:57285230-57285252 GCGCGGGGAAGGGGAGGGTCTGG + Intergenic
1138667788 16:58586439-58586461 GCAGGGAGGAGGGGAGGGTGAGG + Intronic
1139426223 16:66881287-66881309 GCAGGGGGTGGGGGAGTGAAGGG + Intronic
1139489468 16:67278876-67278898 GAAGGGGGTAAGGGGGTGCCAGG + Exonic
1140219433 16:73033158-73033180 GTAGGGGGTAAGGAGGTGTCTGG - Intronic
1140684063 16:77416095-77416117 GAAGGGGGTTGGGGAGTGATGGG + Intronic
1140885097 16:79236050-79236072 GCATGGACTATGGGAGTGTCAGG - Intergenic
1141015420 16:80444507-80444529 GGCTGGGGAAGGGGAGTGTCAGG - Intergenic
1141443270 16:84042838-84042860 GCAGGGGGCTGGGGAGAGGCGGG - Intergenic
1141694752 16:85614078-85614100 GCGGGGGGGAGGGGAGGGGCAGG - Intronic
1141836752 16:86545658-86545680 GGAGGGGGAAGGGGAGTCTGAGG - Intronic
1141919685 16:87127586-87127608 GCAGGGGGAAGGCGAGAGCCTGG + Intronic
1142483599 17:233228-233250 GCGGGGGGTAGAGCAGTGGCTGG - Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1142715994 17:1747239-1747261 GTAGCGAGTAGGGGCGTGTCTGG + Intronic
1142807952 17:2381327-2381349 GCAGGGGGTAGGGATGGGACAGG - Intergenic
1142831674 17:2553800-2553822 GCTGAGGGTAGGGCAGTGGCAGG - Intergenic
1142986896 17:3700907-3700929 GCTGGGGTGAGGGGAGTTTCTGG - Intergenic
1144106444 17:11990696-11990718 GGAGGGGGTTGGAGTGTGTCAGG - Intronic
1144253305 17:13440885-13440907 GCTAGGGGTACGGGATTGTCTGG - Intergenic
1145274020 17:21419432-21419454 GCAGAGGGTCGGGGACTGTGGGG - Exonic
1145285917 17:21506008-21506030 CCAGGGGGTGGGGGTGTGACGGG - Intergenic
1145388274 17:22435183-22435205 GCAGGGGGGGGGGTGGTGTCGGG - Intergenic
1145784077 17:27582829-27582851 GCTGGGGGTGGGGGAGTCTGAGG - Exonic
1146005605 17:29158808-29158830 GTAGGGTGAAGGGGAGTGTGTGG - Intronic
1146046387 17:29512038-29512060 GCGGGGGGTAGGGGGGAGGCCGG - Intronic
1146113183 17:30110584-30110606 GCTGGGGGTAGGGGAAAGTGGGG - Intergenic
1146946904 17:36879640-36879662 GCAGGGTGTATGGGAGTGTGCGG + Intergenic
1147021387 17:37536836-37536858 GCAGGGGTTAGGGATGTGTCTGG - Intronic
1147059354 17:37862191-37862213 GCAGGGGGTAGGGGAGAAAGAGG + Intergenic
1147867600 17:43563462-43563484 GCAAGGGGGAGGGGAGAGTGGGG + Intronic
1148150869 17:45395936-45395958 GGATGGGGTAGGGGCGTGGCGGG - Intronic
1148565055 17:48627677-48627699 GCAGGGGGTAAGGCAGTGAGGGG - Intronic
1149458884 17:56811354-56811376 GCAGGGGGTAGGGATGAGGCAGG - Intronic
1149590152 17:57823067-57823089 GCAGGGGAGAGGGGATGGTCTGG - Intergenic
1150155872 17:62852528-62852550 GCAGGGGTGAGAGGAGTGGCAGG - Intergenic
1150216958 17:63476551-63476573 GCCGGGGGTAGGGGTGTGGCGGG - Intergenic
1150467078 17:65403020-65403042 AGAGTGGGTAGGGGAGTTTCTGG + Intergenic
1151167802 17:72219891-72219913 GGAGGGGAGAGGGGAGGGTCCGG - Intergenic
1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG + Intronic
1152031682 17:77846832-77846854 GCATGGGGTGGGGAAGTCTCAGG + Intergenic
1152210446 17:79000451-79000473 GCGGGGGGTATGGGAGTGTCAGG - Intronic
1152210466 17:79000512-79000534 GCAGGTGGCGAGGGAGTGTCAGG - Intronic
1152239854 17:79155584-79155606 GCTGGGGGCAGGGGGGTCTCAGG + Intronic
1152493509 17:80654030-80654052 CCAGGGGCAAGGGGAGTGTGTGG + Intronic
1152637622 17:81436576-81436598 GGCGGGGGTAGGGGAGTGGCAGG - Intronic
1152755433 17:82085159-82085181 ACAGCGGGTCGGGGAGGGTCAGG + Intronic
1152799587 17:82324539-82324561 GCAAGGGGGAGGGGAGTGAGAGG - Intronic
1152847315 17:82609461-82609483 GCAGAGGGAGGGGCAGTGTCTGG - Intronic
1154109371 18:11552594-11552616 GAAGGAGGAAGGGGAGAGTCAGG - Intergenic
1154370823 18:13761837-13761859 GCCGGGGGGAGGGGGGTGTAGGG - Exonic
1155250235 18:23947201-23947223 GCAGGGGGTAGGAGAGAGGAAGG - Intronic
1157528360 18:48402103-48402125 CCAGGGCTTAGAGGAGTGTCCGG - Intronic
1157549383 18:48570764-48570786 GCAGGGGGTAGGGGTGACTCAGG + Intronic
1158015295 18:52775908-52775930 GAAGGGGGCAGGGAAGTGCCGGG - Intronic
1158146860 18:54323747-54323769 CCATGGGATAGGGGTGTGTCAGG + Intergenic
1158599346 18:58843770-58843792 GCAGGGTGTGGGAGAGTGGCAGG - Intergenic
1160534655 18:79585620-79585642 GCATGGGGTGTGGGAGTGTGCGG - Intergenic
1160657817 19:282348-282370 GCAGGGGGAGGGGGAGCGCCTGG - Intronic
1160657829 19:282396-282418 GCAGGGGGAGGGGGAGCGCCTGG - Intronic
1160657841 19:282444-282466 GCAGGGGGAGGGGGAGCGCCTGG - Intronic
1160657853 19:282491-282513 GCAGGGGGAGGGGGAGCGCCTGG - Intronic
1160657865 19:282539-282561 GCAGGGGGAGGGGGAGCGCCTGG - Intronic
1160769003 19:821987-822009 GGACGGGGGAGGGGAGGGTCCGG + Intergenic
1160933065 19:1579707-1579729 GCAGGAGGTAGGGTCCTGTCTGG - Intronic
1161059303 19:2207136-2207158 GCAGGGGGCATGGGAGGGGCCGG - Intronic
1161396079 19:4045607-4045629 GAAGGGGGTATGGGGGGGTCGGG + Exonic
1161455383 19:4367187-4367209 GCAGGGGGAGGGGGAGGGTGGGG + Intronic
1161473720 19:4473406-4473428 GCAGGGTGTCTGGGAGGGTCTGG + Intronic
1161515014 19:4691590-4691612 GAAGGGGGGCGGGGAGTGTGGGG + Intronic
1162130368 19:8522577-8522599 GCAGGGGGTAGGGGAGTGTCTGG - Intronic
1162222440 19:9189296-9189318 GCATGGGGTTGGGCAGGGTCAGG - Intergenic
1162399414 19:10435855-10435877 GGTGGGGATAGGGGAGAGTCAGG - Intronic
1162809240 19:13154324-13154346 GGAGGGGGAAGGGGAGTGCCTGG - Exonic
1162913863 19:13864204-13864226 GCAGGGGGAGGGGGGATGTCTGG + Intronic
1162936323 19:13983447-13983469 CCAGGGGGTGGGGGAGGGCCCGG - Intronic
1163463745 19:17454778-17454800 GCACGAGGTAGGGGACTGTCTGG - Intronic
1163484505 19:17577874-17577896 GCAGGGGGTGGTGGAATGGCCGG + Intronic
1163493012 19:17627986-17628008 GCGGTGGGTAGGGGAGGCTCTGG - Intronic
1164453253 19:28384668-28384690 GCATGGGACAAGGGAGTGTCTGG + Intergenic
1164494407 19:28746275-28746297 GCAGGGGGTGGGGCAGGGTTAGG - Intergenic
1165233044 19:34399402-34399424 GCAGGGGCTTGGGGCGTGCCTGG + Intronic
1165391334 19:35540665-35540687 GCAGAGGGGAGGGGAGTGAGAGG - Intronic
1165434942 19:35790446-35790468 GCTGGAGGCAGGGGAGAGTCCGG - Intergenic
1165866509 19:38942754-38942776 GCAGGGGGAAGGGGAGTGAGAGG + Intronic
1166043974 19:40218590-40218612 GCAGGAGGTTGGGGAGGGTAAGG - Intergenic
1166253374 19:41586127-41586149 GCAGGGGAGAGAGGGGTGTCAGG - Intronic
1166703218 19:44893987-44894009 GCAGGTGGACGGGGAGTATCGGG + Exonic
1166719790 19:44990366-44990388 GCAGGGGGTAGGGGGGAACCAGG - Intronic
1167414140 19:49361600-49361622 GCACGGGGGAGGGGAGGGGCGGG - Intronic
1167638074 19:50666816-50666838 GCAGGGGGTGGGGGCGGGGCTGG - Exonic
1167719151 19:51166949-51166971 GTAGGGTCTATGGGAGTGTCTGG - Intergenic
1167774313 19:51544839-51544861 GTAGGGGGTAGAGGAGGGTCAGG - Intergenic
1168263796 19:55210030-55210052 GCAGTGGGTAGGAGACTGTTAGG - Intergenic
1168273807 19:55265349-55265371 GCAGGGTGTGCGCGAGTGTCGGG - Exonic
925030839 2:649009-649031 GCAGGAGGTAGCTGAGTGCCTGG + Intergenic
925192026 2:1892636-1892658 GCAGGGTGTAGGGAAGTGACTGG + Intronic
925982521 2:9188903-9188925 GCAGATGGCAGTGGAGTGTCTGG - Intergenic
926047985 2:9724283-9724305 GCAGTGGGGAGGGGAGGGACTGG - Intergenic
926250408 2:11152709-11152731 TCAGGAGGTTGGGGAGTGTCTGG - Intergenic
929571458 2:43025625-43025647 GCAGGGAGTAGGGCAGAGTCTGG + Intergenic
929761983 2:44814521-44814543 GCAGGGGGTGGGGGAAGGCCAGG + Intergenic
930484377 2:51994067-51994089 GCAGGGGATAGGGAAGAGGCTGG + Intergenic
930816422 2:55602734-55602756 GCAGGGTCTAGGAGAGTTTCAGG - Intronic
931253040 2:60550452-60550474 GCAGGAGGTGGGGGAGGCTCTGG + Intronic
931501586 2:62874972-62874994 GGAGGGGGCAGGGTAGGGTCAGG - Intronic
931601440 2:64007301-64007323 GGAGGTGGTAGGGGAGTGACTGG + Intronic
932773514 2:74514399-74514421 GCTGGGGGTAGGGCAGGGGCGGG - Intronic
934768946 2:96895816-96895838 GCAGGTGGTAGGTGAGTCACCGG - Intronic
934980294 2:98833854-98833876 GCCCAGGGTAGGGGAGTGGCAGG - Intronic
935804848 2:106735209-106735231 GCAGGGGGCAGGAGGGTGGCAGG - Intergenic
936523952 2:113230258-113230280 GCAGGGGGAAGGGGAGTGCGGGG - Intronic
936740555 2:115501657-115501679 GCAGGGGTTAGGGGAGTGGAAGG + Intronic
937484110 2:122295912-122295934 GCAGGTGGAAGGAGAATGTCAGG - Intergenic
938061877 2:128261247-128261269 GCAAGGGGTGGGGAAGTCTCGGG + Intronic
938112941 2:128581300-128581322 GCAGAGGGGACGGGAGTGTGTGG - Intergenic
938487239 2:131723694-131723716 GCAGGTGGACGGGGAGTATCGGG - Intronic
940272779 2:151909564-151909586 GCTGGGGGTTGGGGAGTGAGGGG - Intronic
943821187 2:192323654-192323676 GGATGGGGTTGGGGAGTGGCGGG + Intergenic
943892739 2:193311074-193311096 GCAGGGGGCTGGGAGGTGTCAGG + Intergenic
944652807 2:201848555-201848577 CTAGGGGCTAGGGGAGTGTGGGG - Intronic
946411948 2:219519899-219519921 GCTGGGGGCAGTGGGGTGTCTGG + Intronic
946687044 2:222280835-222280857 GCAGGGGTTAGAGGAATGCCTGG - Intronic
947380804 2:229543682-229543704 GCAGGGGGTGGAGGAGGGGCAGG - Intronic
947779317 2:232743177-232743199 GCAGGAGCTAGTGGAGTGGCAGG + Intronic
948490246 2:238308215-238308237 GCTGGGGGAGGGGCAGTGTCAGG + Intergenic
949070206 2:242019736-242019758 GCAGAGGGGAGGGGAGGGCCGGG + Intergenic
1169005213 20:2201008-2201030 ACAGGGAGTAGGGGTGTGTTGGG - Intergenic
1169261718 20:4143990-4144012 GGAGGGGTTTGGGGAGTTTCTGG + Intronic
1171189837 20:23151114-23151136 GCAGGGAGTAGGGAAGACTCTGG - Intergenic
1171218738 20:23374120-23374142 TCTTGGGGTAGGAGAGTGTCAGG + Intergenic
1172125246 20:32621695-32621717 TCAGGGGGCAGGGGTGTGACAGG + Intergenic
1172843692 20:37916902-37916924 CCAGGGGTTAGGGGAGAGTGGGG + Intronic
1173069994 20:39754637-39754659 GCAGGGGGAAGGGGAGACACAGG - Intergenic
1173220228 20:41126281-41126303 GCAGTGGGTGGGGGAATGACTGG - Intergenic
1173571042 20:44076311-44076333 GCGGGGGGGGGGGGGGTGTCTGG - Intergenic
1174022360 20:47541337-47541359 GGAGGGGGGAGGGGAGAGTGGGG - Intronic
1174137549 20:48391019-48391041 GGAGGGGGTAGGGGAGAGGAGGG + Intergenic
1174421287 20:50400659-50400681 CCAGGGGGAAGGGGACAGTCAGG + Intergenic
1174819394 20:53713755-53713777 GCAGAGGGGAGGGGCGTTTCAGG - Intergenic
1175051637 20:56161061-56161083 GCAGGGAGGAGGAGTGTGTCGGG - Intergenic
1175736089 20:61388272-61388294 GGTGGGGGTAGGGGGGTGTGGGG + Intronic
1175947234 20:62564622-62564644 GCAGGGGTCTGGGGAGGGTCGGG - Intronic
1176178124 20:63738127-63738149 GCAGGGGGCAGGAGCGGGTCTGG - Intronic
1176515531 21:7780776-7780798 GCTGGGGGCAGGGGAGTGGGTGG - Intergenic
1176670364 21:9728401-9728423 GGAGGGGGAAGGGGAGTGTGAGG + Intergenic
1176848032 21:13891539-13891561 GCTGGGGGTTGGGGAGGGTTGGG - Intergenic
1178649559 21:34410788-34410810 GCTGGGGGCAGGGGAGTGGGTGG - Intergenic
1179182437 21:39057279-39057301 ACAGAGGGAAGAGGAGTGTCTGG - Intergenic
1179575372 21:42305230-42305252 GCAGGAAGGAGGGGAGTGTGGGG - Intergenic
1179983959 21:44910899-44910921 GCAGGGGGTGGGTTAGGGTCAGG + Intronic
1180000236 21:44992290-44992312 GCAGGGGGTGGGGGAGACTGAGG + Intergenic
1180085066 21:45504743-45504765 GCAGGGGGACGGGGGGTGTCCGG - Intronic
1180491752 22:15854694-15854716 GCAGGTGGACGGGGAGTATCGGG - Intergenic
1180961799 22:19765674-19765696 GCGGAGGATAGGGGAGTGTTAGG - Intronic
1181493940 22:23277493-23277515 GCAGGGGATGGGGTAGTGTGCGG - Intronic
1181515070 22:23405533-23405555 GCGGTGGCTGGGGGAGTGTCGGG - Intergenic
1181600607 22:23949760-23949782 GCTGGGGGTAGGTGAGGGTTGGG - Intergenic
1183246204 22:36695478-36695500 GGTGGGGGTGGGGGAGTGGCAGG - Intronic
1183642686 22:39101694-39101716 GCAGGGGGTGGGGGGGTGGCGGG + Intronic
1183728858 22:39605785-39605807 GCTGGGGGAAAGGGAGTTTCAGG + Intronic
1183753004 22:39732782-39732804 GCATTGTGTAGGGGAGTGGCCGG - Intergenic
1183814786 22:40290655-40290677 TCGGGGGGTGGGGGAGTGACAGG - Intronic
1184071679 22:42150988-42151010 ACAGGAGGCAGGAGAGTGTCAGG - Intergenic
1184817791 22:46885156-46885178 GCAGCGGGTGGGAGAGTGGCTGG + Intronic
1184988043 22:48148827-48148849 GCAGGGGGAAGGGGAGCATTAGG - Intergenic
1185055416 22:48576279-48576301 GCAGGGGGGAGGGGAGCGGGCGG - Intronic
1185058495 22:48593330-48593352 GCACGGGGCAGGGGAGGGACTGG + Intronic
1185080481 22:48707039-48707061 GCAGGGGGCAGGGCAGGGCCAGG - Intronic
1185245890 22:49772616-49772638 GGAGGGGCTGGGGGAGTGCCTGG - Intergenic
1185305531 22:50113362-50113384 GCAGGAGGTAGGGGAGTGCTGGG + Intronic
949875370 3:8623148-8623170 GCTGGGGGTTGGGAAGTGCCAGG + Intronic
949903749 3:8840983-8841005 GCAGGGGGCAAGGGAGTGAGGGG + Intronic
950039500 3:9910932-9910954 TCAGTGGGCAGCGGAGTGTCAGG - Exonic
950196214 3:11011055-11011077 GCAAGGGGGAGGGAAGTGTGTGG - Intronic
950452570 3:13073448-13073470 GCGGGGGGTGGGGGAGGCTCCGG - Intergenic
950542694 3:13621663-13621685 GCAAGGGGCAGGGGCCTGTCTGG - Intronic
950868713 3:16210835-16210857 CCAGAGGGCAGGGGAGTCTCAGG + Intronic
951137877 3:19125140-19125162 GAAGGGAGTAGGGTAGTGACTGG + Intergenic
951287902 3:20837608-20837630 CCAGGGGTTAGGGAAGTGCCAGG - Intergenic
952354457 3:32571089-32571111 GCAGGGGGGTTGGGTGTGTCAGG + Intergenic
952871284 3:37903446-37903468 GCAGGGGGTGGGAGAGATTCTGG + Intronic
953435503 3:42874393-42874415 ACATGGGGTAGTGGTGTGTCAGG + Exonic
954291204 3:49650963-49650985 GCAGGGGTTGGGGTAGTCTCTGG - Exonic
954325485 3:49861153-49861175 GCAGGGGGTGGGGCAGGGGCAGG - Intronic
954505731 3:51070934-51070956 GCAGGGGTTAGGACAGTTTCAGG - Intronic
954682499 3:52353315-52353337 GCAGGGAGGAGGGGATTGGCCGG - Intronic
954839003 3:53495019-53495041 GCAGGGGGGTGGGGAGGGACGGG - Intronic
955225490 3:57056948-57056970 GCAGGGGGCAGGGGTGTGTGGGG - Intronic
955262492 3:57407298-57407320 GCCGGGGGTAGGGAGGTGGCAGG + Intronic
956008437 3:64805150-64805172 GAAGAGGGTAGAGGAATGTCAGG - Intergenic
956160652 3:66347981-66348003 GCAGGGGGAAGGAGAGCATCAGG + Intronic
957704962 3:83769475-83769497 TCAGTGGGTAGGGGAGAGTTGGG - Intergenic
957994877 3:87676792-87676814 GCTGGGAATAAGGGAGTGTCAGG - Intergenic
958762847 3:98329115-98329137 GCAGGGGCTCTGGGAGGGTCTGG - Intergenic
960550790 3:118973956-118973978 GCCGGGGGAAGGAGAGCGTCAGG + Intronic
961000663 3:123371894-123371916 GCAGGGGAGAGGGGAGTGAGGGG + Intronic
961400854 3:126641462-126641484 GAGGGTGGTGGGGGAGTGTCAGG - Intronic
961477420 3:127157438-127157460 GCAGGGGGGTGGGGAGGGGCAGG + Intergenic
962024199 3:131529703-131529725 GTAGAGGGGAGGGCAGTGTCAGG - Intergenic
962671663 3:137714613-137714635 GCAGGGGGTGGGGGAGACTCAGG + Intergenic
965911473 3:173782796-173782818 GCGGGGGGTAGGGGAATGAAGGG - Intronic
966114255 3:176443173-176443195 GCAGGGGATGGGGGAGTGCAGGG - Intergenic
966863397 3:184242850-184242872 ACAGGAGGTAGGGCAGTGTGTGG + Exonic
967151041 3:186651360-186651382 GGAGGGGGTAAGGTAGTGGCAGG - Intronic
967456305 3:189690371-189690393 GGGGGGAGTAGGAGAGTGTCTGG - Intronic
967856320 3:194120149-194120171 GAAAGGGGAAGGGGAGTGCCGGG - Intergenic
968733337 4:2282174-2282196 GCAGCCGGTGCGGGAGTGTCTGG - Intronic
968851015 4:3078416-3078438 GAAGGGGATAGGGAAATGTCAGG + Intronic
968943516 4:3651842-3651864 GCTGGGAGCCGGGGAGTGTCAGG - Intergenic
968961390 4:3746017-3746039 GCAGGGAGTGGGGGAGGGGCGGG + Intergenic
969707586 4:8820293-8820315 GTAGGGGGTAGGGGATGGTGAGG + Intergenic
969902157 4:10360116-10360138 GCAGGGGGTAGGGGGTAGTCAGG - Intergenic
971379892 4:26087051-26087073 GCAGGGGGTGGGGGAGCCTTTGG - Intergenic
972238945 4:37167842-37167864 GCAGGGGGATGGGGAGCATCAGG + Intergenic
973272523 4:48276294-48276316 ACATGGGGTAGGGGTGTGTGTGG - Intergenic
973821330 4:54664263-54664285 GCTGGGGGTAGGGAATTGGCTGG + Intronic
976720944 4:88168071-88168093 GGAGGGGGCAGGGGATTGTGGGG + Intronic
977513805 4:97995164-97995186 GCAGGGGGTGGGGGGGTGAGGGG - Intronic
978225744 4:106333011-106333033 GCAGGGGGTTGGGAAGGGTAGGG - Intronic
978577725 4:110202815-110202837 GCAGGGGCTAGGGGAAAGGCTGG + Intergenic
978626983 4:110697545-110697567 GCAGGGGGTTGGGGGGAATCAGG - Intergenic
978917952 4:114148676-114148698 GCAGGGTGTGGGGGAGGCTCAGG + Intergenic
979264337 4:118683818-118683840 GCAGAGGGTAGGTGAGTATGGGG + Intergenic
979707328 4:123736119-123736141 GCAGAGGGAATGGGAATGTCAGG - Intergenic
979758727 4:124373876-124373898 GCAGGGGGTTGGGGGCTCTCAGG + Intergenic
981001906 4:139836418-139836440 GCAGGAGGTAGGGTGGTGACAGG + Intronic
981164822 4:141545378-141545400 GCAGGGGGTGAGTGAGGGTCTGG - Intergenic
982240352 4:153293900-153293922 GCAGGGGGTTGGGGAGAGGGAGG + Intronic
982908618 4:161111768-161111790 TCAGTGAGCAGGGGAGTGTCTGG - Intergenic
984794958 4:183651480-183651502 GCAGGGGTGAAGGGAGTCTCAGG + Intronic
984830549 4:183968752-183968774 GCAGGGGGGCGGGGGGTGTTGGG + Intronic
985790903 5:1926430-1926452 GCAGGGGCTAGGGCAGGGGCAGG - Intergenic
986178956 5:5375921-5375943 ACAGGAGGTAGGGCAGTGTGTGG + Intergenic
986415032 5:7519810-7519832 GCTGGGGGAAGGGGACTGGCTGG - Intronic
986833385 5:11607124-11607146 GCAGGAGCTAGGGGAGTGACCGG + Intronic
987374108 5:17218083-17218105 GCTGGGGGGAGGGGGCTGTCGGG + Intronic
988517020 5:31913931-31913953 GCTGGGGGTAGGGGAGAGGTTGG - Intronic
989178878 5:38556710-38556732 GCCGGGGGCAGGGGCGGGTCAGG - Intronic
990323148 5:54649111-54649133 GCGGGGGGTGGGGGAGGCTCAGG + Intergenic
990781758 5:59372630-59372652 GCTGGGGGTAGGGTGGTGGCAGG - Intronic
991098006 5:62759756-62759778 GCAGGGTGTAGGGGATGGTTTGG - Intergenic
991245771 5:64506875-64506897 GCTGAGGGTGGGGGAGTGGCTGG - Intronic
992490006 5:77233627-77233649 TCAGGGGGTTGGGGGCTGTCAGG - Intronic
993487850 5:88508426-88508448 GCAGGTGGTAGGGGAGTTTGGGG + Intergenic
995292535 5:110473970-110473992 GCTGGGGGTGGGGGAGAGTAGGG + Intronic
995481533 5:112597971-112597993 GTAGGGTGGAGGGGAGTGTGAGG + Intergenic
995721608 5:115140571-115140593 GAGGGGGGTAGGTTAGTGTCTGG - Intronic
995854353 5:116576356-116576378 GGAGGGGGTTGGGGAGTGTGGGG + Intergenic
996055690 5:118979853-118979875 GCAGGGGGTGGGAGAGCATCAGG + Intronic
996483044 5:123997276-123997298 GCAGGGGCTAGGGCAGTGCCTGG - Intergenic
997077350 5:130695035-130695057 ACAGGGGGTAGGGGAGTATCAGG + Intergenic
998385901 5:141756983-141757005 GTAGGGGGTGCGGGAGTGTCAGG - Intergenic
998584745 5:143415349-143415371 GCAGGGGGAAGGGGAGGATGGGG + Intronic
999240536 5:150124901-150124923 GCCGGGGGTAGGGGAGTGGGGGG - Intronic
1001264882 5:170266949-170266971 GGCGGGGCTAGGGGAGTGCCTGG + Intronic
1001569316 5:172719715-172719737 GCTTGGGGTACGGGACTGTCAGG + Intergenic
1001892488 5:175351106-175351128 GCAGGCGGTAGGGGAATTCCTGG - Intergenic
1002182018 5:177435560-177435582 GCCGGGAGCAGCGGAGTGTCTGG - Intronic
1002735475 5:181384306-181384328 ACAGGGGGTAGGAGAGCATCAGG - Intergenic
1002735495 5:181384383-181384405 ACAGGGGGTAGGAGAGCATCAGG - Intergenic
1003069961 6:2938238-2938260 GCACAGGGTAGGGGCGTGGCAGG + Intergenic
1003274324 6:4636615-4636637 GCAGGGTGAAGGGGAGACTCGGG - Intergenic
1004171337 6:13297632-13297654 GCTGGGGGCAGGGGTGTCTCAGG - Intronic
1004250730 6:14021406-14021428 CCTGGGGGCAGTGGAGTGTCAGG - Intergenic
1004397657 6:15260194-15260216 GCAGGGGGCCAGGGAGGGTCTGG + Intronic
1004798620 6:19118243-19118265 GCAGGGAGAGGGAGAGTGTCAGG + Intergenic
1004901897 6:20202010-20202032 GCAGGGGGTGGGGGAGTCTTAGG + Intronic
1005511762 6:26517990-26518012 GTGGGGGGTAGGGGAGTGGGGGG + Intergenic
1005813426 6:29532554-29532576 TCAGGGGGCTGGGCAGTGTCTGG - Intergenic
1006192395 6:32217631-32217653 GCAGGGGACAGAGGAGTGTCCGG + Intronic
1006335904 6:33420383-33420405 GCAGGGGGCGGGGGAGAGTCGGG + Intronic
1006337741 6:33429203-33429225 GCAGTGGGGAGGAGAGAGTCAGG + Intronic
1006409501 6:33864184-33864206 GTGGGGGGTAGGTGAGTGTGTGG + Intergenic
1006412170 6:33880308-33880330 GCTGAGGGTAGGGGAGAGTGAGG - Intergenic
1006474074 6:34244097-34244119 GCTGGGGGTAGGAGAGGGCCAGG - Intronic
1006578037 6:35060163-35060185 GCAGAGTGTCGGGGAGTGGCTGG + Exonic
1007309529 6:40934550-40934572 GCAGGGGATAGGGGATGATCAGG + Intergenic
1007473870 6:42106716-42106738 GGAGGGGGCAGGGGAGGGGCTGG + Exonic
1007729368 6:43936597-43936619 GCGGGGCCTAGGGGAGTGCCAGG + Intergenic
1009724556 6:67521126-67521148 GCAAGGAGTAGGGTAGTGACTGG - Intergenic
1009842621 6:69095400-69095422 GCAGGGGGCAGGGGCATGGCTGG + Intronic
1011277354 6:85643507-85643529 GGAGAGGGAGGGGGAGTGTCGGG - Intronic
1012459502 6:99444771-99444793 TCAGGAGGTAGGGGAGTGAGGGG - Intronic
1013209362 6:107973008-107973030 GCATGGTGTAAGGGAGTGTATGG + Intergenic
1014422867 6:121266922-121266944 GCAAGGGGAGGGAGAGTGTCAGG + Intronic
1016090428 6:139971246-139971268 GCATGGGGAAGGGGTTTGTCAGG + Intergenic
1016997068 6:149968230-149968252 GCAGGAGGTGGGAGAGTGTGTGG - Intronic
1017326697 6:153149241-153149263 GCAGGAGGTAGGGAGGTGCCAGG + Intergenic
1018934632 6:168265659-168265681 GCAGGTGGGAGCGGAGTGCCGGG - Intergenic
1019359964 7:599681-599703 GCAGGGGGCAGGGCAGAGCCAGG - Intronic
1019654810 7:2185828-2185850 GCTGGGGGTGGGGGTGAGTCCGG - Intronic
1021200392 7:17722691-17722713 GGAGGGGCTAGGGGAGTGGGAGG + Intergenic
1021609380 7:22442933-22442955 GAAGGGGGTAGGGGTGAGCCTGG - Intronic
1021988081 7:26116638-26116660 GCAGGCAGTAGGGGAGTTTATGG + Intergenic
1022187017 7:27979726-27979748 GCAGGGGATAGGGGAGAGGCAGG - Intronic
1024283624 7:47738909-47738931 GCAGCAGGTGGGGGAGGGTCTGG - Intronic
1025835281 7:65087289-65087311 GCAGGGGGTTGGGGAGGGGAGGG + Intergenic
1025905057 7:65776762-65776784 GCAGGGGGTTGGGGAGGGGAGGG + Intergenic
1026209408 7:68290335-68290357 GCAGGGGTTAGGGGACAGGCTGG + Intergenic
1028376945 7:90154764-90154786 GCCGGGGGTTGGGGAGAGCCAGG + Intronic
1028744371 7:94310517-94310539 GCAGGGGGTCGGGGGGTGGCGGG - Intergenic
1028920169 7:96302224-96302246 GCAGGGGGTAGGGGAGAACATGG + Intronic
1029686990 7:102155845-102155867 GCAGGGAGTGGGGAAGGGTCAGG - Intronic
1030597903 7:111561977-111561999 GCAGGTGGTGGGAGAGCGTCAGG - Exonic
1031992755 7:128208701-128208723 TCAGGGGGCAGGGGACTGACAGG + Intergenic
1033037570 7:137889045-137889067 GCAAGGGGTAGGGGATGGGCAGG - Intronic
1033242366 7:139690702-139690724 GGCGGGGGCAGGGGAGTGCCAGG - Intronic
1034441962 7:151090190-151090212 GCAGGGGCTTGGGGAGGGCCTGG + Intronic
1036727340 8:11231593-11231615 GCAGTGGGGAGGGGAGTTGCAGG + Intergenic
1036761968 8:11515432-11515454 TCAGGGCCTGGGGGAGTGTCTGG + Intronic
1037688707 8:21165070-21165092 GCCGGGGGTAGGGGGTGGTCTGG + Intergenic
1037932043 8:22886963-22886985 GCAGGGTGTAGGGGAGGGGATGG + Intronic
1038646894 8:29369450-29369472 GGGGAGGGTAGGGGAGGGTCAGG + Intergenic
1040849339 8:51882370-51882392 GCATGGGGTAGGGGGCGGTCAGG + Intronic
1041107012 8:54454028-54454050 GCGGGCGGGAGGGGAGTGTAAGG - Intergenic
1041115036 8:54527126-54527148 GCAGGGGGAAGGGGAGAGGGAGG + Intergenic
1042465816 8:69129412-69129434 GCAGGGGGGCGGGGAGAGGCGGG + Intergenic
1042557320 8:70044401-70044423 GTAGGGGGTGGGGGAGGGGCAGG - Intergenic
1042893727 8:73642719-73642741 GCAGGGGCCTGGGGAATGTCAGG + Intronic
1043792531 8:84490592-84490614 GCAGGGGCTAGAGGAGTGTTTGG + Intronic
1043803708 8:84644070-84644092 GCATGGTGTAAGGGAGTGTATGG + Intronic
1043844930 8:85152877-85152899 TGGGGGGGTAGGGGAGGGTCAGG - Intergenic
1044070702 8:87756513-87756535 GCATGGTGTAAGGGAGTGTCTGG - Intergenic
1045287575 8:100805253-100805275 GCAGGGGGTGGGGGAGTGGTGGG - Intergenic
1045498269 8:102726520-102726542 GTAGGGGTTGGGGGAGGGTCGGG + Intergenic
1046890354 8:119415843-119415865 GTTGGGGGGAGGGGAGTGGCAGG - Intergenic
1048387543 8:133926621-133926643 GCAGGGAGTAAGTCAGTGTCTGG + Intergenic
1049135421 8:140893621-140893643 GCTGGGGGTAGGGCAGAGTTGGG + Intronic
1049440511 8:142607338-142607360 GCAGGGGGGAGGGGAGGGGAGGG + Intergenic
1049567607 8:143349304-143349326 GCAGGGGGCAGGGGGGTGGGAGG - Intronic
1049580499 8:143408561-143408583 CCTGGGGGTTGGGGACTGTCTGG - Intergenic
1049675752 8:143888168-143888190 GCAGGGGGTTGCGTAGCGTCAGG + Intergenic
1049775063 8:144400319-144400341 GGAGTGGATAGGGGAGTGTGTGG - Intronic
1050309647 9:4339843-4339865 GGAGGGGGTAGGGGAGGGGTGGG + Intronic
1050911638 9:11078844-11078866 GCAGGGGGAAGGAGAGCATCAGG + Intergenic
1050941821 9:11470519-11470541 GGAGGGGTTAGGGGAGGGACAGG + Intergenic
1051357425 9:16252768-16252790 GCAGGGATAAGGGGAGTGTCAGG - Intronic
1051748748 9:20319706-20319728 GCAGGGTTTAGGGGACCGTCAGG - Intergenic
1053277102 9:36791342-36791364 GCTGGGAGCAGGGGTGTGTCAGG + Intergenic
1053426736 9:38015096-38015118 GCAGGGTGCAGGAGAGTGGCTGG - Intronic
1054451340 9:65404978-65405000 GGAGGGGGAAGAGGAGGGTCAGG - Intergenic
1056615495 9:88161786-88161808 GCAGGGGGTGGGGGAGGTTGTGG + Intergenic
1056735467 9:89205957-89205979 ACAGGTGGGAGGGGAGTGGCTGG - Intergenic
1056786047 9:89593264-89593286 GAAGGGAGTAGGGAAGAGTCTGG - Intergenic
1056962253 9:91135887-91135909 CCAGGGGCTAGGGGAGAGTGAGG + Intergenic
1057677379 9:97146588-97146610 GCAGGGGGTAGAGGTGTGTTGGG - Intergenic
1058835252 9:108854525-108854547 GCAGAGGGTAGGGGGGAGTCGGG - Intergenic
1059224142 9:112655973-112655995 GCATGGTGTAAGGGAGTGTCTGG + Intronic
1059583794 9:115583059-115583081 GCAGGGGGTTGGAGAGCATCAGG - Intergenic
1059802457 9:117763982-117764004 GATGGGGGTAGGGGAGTGTCAGG - Intergenic
1060277696 9:122194296-122194318 CCAGTGCTTAGGGGAGTGTCTGG - Intronic
1060918137 9:127403294-127403316 TCAGTGGGGAGGGGAGGGTCAGG + Intronic
1061052985 9:128206943-128206965 GCAGGGGGTAGTGGGGGGCCTGG + Intronic
1061196264 9:129108725-129108747 GCAGTGGGCAGGCGAGTGGCAGG + Intronic
1061793342 9:133070354-133070376 GCAGTGGGCAGGGAAGTGTCTGG - Intronic
1061795949 9:133086151-133086173 GCAGTGGGCAGGGAAGTGTCTGG - Intronic
1062318525 9:135979490-135979512 GAAGGGGGTGGGGGAGGCTCTGG - Intergenic
1062523668 9:136969836-136969858 GAAGGGGGTGGGTGAGGGTCTGG - Intronic
1062532321 9:137007341-137007363 GCTGGGGGTTGGGGGGGGTCTGG + Exonic
1062562322 9:137147004-137147026 GCTGGGGGGAGGGGCCTGTCGGG - Intronic
1062619176 9:137411734-137411756 GGAGGGGGTGGGGGAGTGGGAGG + Intronic
1186301558 X:8204952-8204974 GCAGGGGGTGGGGGATGGTGGGG + Intergenic
1186357212 X:8800899-8800921 GCAGTGGGTAGGGGTGGGGCAGG - Intronic
1186784827 X:12947603-12947625 GCAGGGGGTAGGGGGGTCCCTGG - Intergenic
1186917933 X:14244043-14244065 GGAGGGGGTTGGGCAGTGCCTGG - Intergenic
1188302094 X:28517084-28517106 GGATGGGGTAGGGGAGTTTCTGG - Intergenic
1189332773 X:40153541-40153563 GCGGGGGGTGGGGCAGAGTCTGG - Intronic
1190050782 X:47146992-47147014 GGTGGGGGTAGGGGACTCTCAGG - Intronic
1190062729 X:47221584-47221606 ACAGGGAGTAGGGGAGGGGCTGG - Intronic
1190091116 X:47438244-47438266 GCATAGGGTAGGGAAGTGCCAGG - Intergenic
1190253840 X:48747824-48747846 GCAGGAGGTAGGGCAGGGGCAGG - Intergenic
1190266837 X:48831839-48831861 GCAGGGGGTGGGGAGGGGTCGGG - Intronic
1192151050 X:68712628-68712650 GCAGGGGGTGGGAGAGTGGGAGG + Intronic
1192206284 X:69098630-69098652 GCAGGAGGCAGGGGAGAGACTGG - Intergenic
1192276688 X:69638927-69638949 GCTGGGGGGAGGGGAGAGTAGGG - Intronic
1192366478 X:70477879-70477901 GCAGAGGGAAGGGGAGTGTCAGG + Intronic
1192601669 X:72471013-72471035 GCTGGGGGTTGGAGAGTGTTGGG - Intronic
1193217453 X:78880887-78880909 GCAGGGGGAGGGAGAGTGTTAGG + Intergenic
1193329658 X:80222212-80222234 GCAGGGGGAAGGAGAGCATCAGG + Intergenic
1193602855 X:83529659-83529681 GCAGGGGTTGGGGGAGTTGCAGG + Intergenic
1194105898 X:89766817-89766839 TCATGGGTGAGGGGAGTGTCAGG + Intergenic
1194358788 X:92920629-92920651 GCAGGGGGTGGGGGTGGTTCCGG + Intergenic
1194427846 X:93762161-93762183 GCAGGGGGCAGGGGGGTGGTGGG - Intergenic
1196005609 X:110834036-110834058 GCAGGGGAGAGGGGAGCTTCAGG - Intergenic
1197776008 X:130119208-130119230 GGAGGGGGTGGGGGAGTGGGAGG - Intergenic
1198394624 X:136208957-136208979 GAAGGGGGTGGGGGAGGGTGGGG + Intronic
1198715904 X:139557956-139557978 CCAGGTGGTAGGGGAGTGGGAGG - Intronic
1199179628 X:144838507-144838529 GCAGGGGGGAGGGGAGGGGAGGG - Intergenic
1199330801 X:146555934-146555956 GCAAGGGGAAGGAGAGTGTTAGG + Intergenic
1199482398 X:148311925-148311947 GCAGGGGGTAGGGAAATATCAGG - Intergenic
1200457856 Y:3414676-3414698 TCATGGGTGAGGGGAGTGTCAGG + Intergenic
1200782479 Y:7229126-7229148 GCAGGGGGAAGGAGAGCATCAGG - Intergenic