ID: 1162131639

View in Genome Browser
Species Human (GRCh38)
Location 19:8529703-8529725
Sequence GTTGAGAGATGCATCTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162131636_1162131639 21 Left 1162131636 19:8529659-8529681 CCTCGTGGTTGGGGCTTCTAGAC 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1162131639 19:8529703-8529725 GTTGAGAGATGCATCTGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162131639 Original CRISPR GTTGAGAGATGCATCTGGCC AGG Intronic
900519990 1:3100828-3100850 GGTGAGAGATAAATGTGGCCTGG + Intronic
900776832 1:4592058-4592080 GTTCAGAGATGAAAGTGGCCAGG - Intergenic
903314152 1:22487885-22487907 GTTAAGAGATGAATCTGGAGAGG - Intronic
903383383 1:22911688-22911710 TTTCAGAGGGGCATCTGGCCAGG + Intronic
906193011 1:43910827-43910849 CCTGAGAGAGGCATCTGCCCTGG + Intronic
915170164 1:153972116-153972138 TTTGAAAGATGTATGTGGCCGGG - Intronic
916379238 1:164189903-164189925 GTTGAGGGCTGCATCTGGTGAGG + Intergenic
916843667 1:168626434-168626456 GTTGAGAGTCACTTCTGGCCTGG + Intergenic
917432650 1:174986685-174986707 GATGAGAGATCCCTGTGGCCAGG - Intronic
917528459 1:175810875-175810897 GGTGAGAGATGGACCTGGCTTGG - Intergenic
917554754 1:176072387-176072409 GCTGAGAGATTCATCTAGGCAGG - Intronic
917812671 1:178674754-178674776 GTTGAAAGTGGCATATGGCCAGG - Intergenic
922291816 1:224214662-224214684 GGTGAGAGAATCACCTGGCCTGG + Intergenic
922486118 1:225974604-225974626 GTTGACAGATCCTTCAGGCCAGG - Intergenic
924125553 1:240846832-240846854 ATGGAGAGGTGCATGTGGCCAGG + Intronic
924569678 1:245226756-245226778 TCAAAGAGATGCATCTGGCCAGG - Intronic
1063287697 10:4708480-4708502 GTTGACAGAGCCATCTGGACCGG + Intergenic
1065194964 10:23255446-23255468 CTTGAGAGTTGCATATAGCCTGG - Intergenic
1069602480 10:69716923-69716945 GTTCAGAGATGCCTTTGGCTGGG - Intergenic
1070706187 10:78640587-78640609 GTTGAGAGCTGGATCTAGGCAGG + Intergenic
1071276681 10:84061912-84061934 GTTGACAGGTGCAGCTGGCTAGG + Intergenic
1071397619 10:85238861-85238883 GGTGAGAGATGCTCCTCGCCCGG - Intergenic
1072563209 10:96596103-96596125 GTTGGGGCATGCATCTGGACTGG - Intronic
1077324967 11:1959725-1959747 CTTGGGAGATGCATCTTTCCGGG - Intronic
1079181172 11:18194799-18194821 GTGGAGAGAAGCATCAGGCGTGG - Intronic
1079284346 11:19116007-19116029 GTTCAGAGATGGATCTGACATGG + Intergenic
1080598889 11:33802817-33802839 GTTGAGAGAAAAATCTGGCCTGG + Intergenic
1081910695 11:46697992-46698014 GTAGAGAGAAGGCTCTGGCCTGG - Intronic
1084450152 11:69231975-69231997 GATGAGAGATGCAGCTGTCAAGG + Intergenic
1086027070 11:82306700-82306722 GTTAAGAGTTACAGCTGGCCGGG - Intergenic
1086238479 11:84660576-84660598 GTAGAGAGATGCTTTTGTCCAGG + Intronic
1090829852 11:130413684-130413706 ATTCAGAGCTGCCTCTGGCCAGG - Intronic
1202807949 11_KI270721v1_random:14904-14926 CTTGGGAGATGCATCTTTCCGGG - Intergenic
1091908753 12:4211760-4211782 GTTGAGAGAAGCAACTGCCTGGG + Intergenic
1096410861 12:51376336-51376358 GTTGTAAGAGGCTTCTGGCCGGG + Intronic
1096430568 12:51539469-51539491 GTTAAGAAATGTATCCGGCCCGG - Intergenic
1096520621 12:52182668-52182690 GTTGAGGGAGACAGCTGGCCTGG + Intronic
1099219156 12:79891813-79891835 GTTGAGAGACACATGTGGCAAGG + Intronic
1100782939 12:98048640-98048662 TTTGAAAGCTGCATGTGGCCTGG + Intergenic
1102228009 12:111242786-111242808 GTTGATGGATGCAGCTGCCCCGG - Intronic
1103277449 12:119724566-119724588 GATGAGAGATGAATTTGACCAGG + Intronic
1105419323 13:20238747-20238769 TCTGGGAGATGCCTCTGGCCTGG + Intergenic
1112758221 13:102664038-102664060 GTTCAGATTTCCATCTGGCCAGG - Intronic
1115895728 14:38084721-38084743 GTTGTGAGATGCATCTGAGTGGG + Intergenic
1117000119 14:51363794-51363816 GTTGGGAGAGGTATCTGGGCTGG + Intergenic
1120768091 14:88349693-88349715 ATTAAGAAATGCATGTGGCCAGG - Intergenic
1123800534 15:23815230-23815252 AGTGAGAGATGCACCTGACCTGG - Intergenic
1124383721 15:29188991-29189013 GTGGAGAGATGCATGTGGCGAGG - Intronic
1124934456 15:34157083-34157105 GTGGAGAGTTGCCTCTGGCTTGG + Intronic
1126101739 15:45122039-45122061 GGTGAGAGAAGCATATGGGCAGG + Intronic
1127347887 15:58119206-58119228 ATTGGGAGACGCATATGGCCAGG + Intronic
1129742491 15:77996216-77996238 CCTGAGAGATGCACCTGACCAGG - Exonic
1129842992 15:78755261-78755283 CCTGAGAGATGCACCTGACCAGG + Intergenic
1133431732 16:5742868-5742890 GCCGAGAGATGGATCTGGTCAGG + Intergenic
1141217692 16:82040482-82040504 GGTGAGAGATGGATCTGATCTGG - Intronic
1144033895 17:11347838-11347860 ACTCAGAGCTGCATCTGGCCTGG + Intronic
1145244219 17:21257671-21257693 GATGAGAGAGGAATCTGTCCTGG - Intergenic
1146488723 17:33264547-33264569 TGTGAGAGATGCACGTGGCCTGG - Intronic
1149366757 17:55952875-55952897 CCTGAGAGGGGCATCTGGCCAGG - Intergenic
1149454527 17:56777154-56777176 GGGGAGAGATGAATGTGGCCTGG - Intergenic
1149613639 17:57977905-57977927 GTTTAGAGATCACTCTGGCCAGG + Intronic
1150378432 17:64701387-64701409 GTTGGCAGATGCATCTGCTCAGG + Intergenic
1151117603 17:71755738-71755760 GTTGAAAGAAAAATCTGGCCGGG + Intergenic
1152276215 17:79359056-79359078 GTTGATGGATACACCTGGCCTGG - Intronic
1152355892 17:79807057-79807079 GTTGAGAGAGGCAGCTGGTGAGG - Intergenic
1153265640 18:3266281-3266303 GTGGAGAGATCCATGTGGCAGGG - Intronic
1155239997 18:23855866-23855888 GCTGAAAGATGCAACTTGCCAGG + Intronic
1157288450 18:46393331-46393353 GGTGTGGGGTGCATCTGGCCAGG + Intronic
1158127258 18:54114791-54114813 ATTGACAGATGCATGTCGCCAGG - Intergenic
1158458130 18:57625161-57625183 GTGGAGAAATTCATCTGGACAGG - Intergenic
1162131639 19:8529703-8529725 GTTGAGAGATGCATCTGGCCAGG + Intronic
1163557074 19:17998949-17998971 GGGGAGCGATGCTTCTGGCCAGG - Exonic
1166103348 19:40584134-40584156 GATGAGAGTTGAATCTGGCTGGG - Intronic
1168102148 19:54146989-54147011 GAGGAGAGATGAGTCTGGCCAGG + Intronic
1168211036 19:54890247-54890269 GTTTGAACATGCATCTGGCCAGG - Exonic
1168411566 19:56143429-56143451 TTTGAGACTTGGATCTGGCCTGG + Intronic
928110653 2:28506277-28506299 GCTGAGAGATGAATGTGGGCTGG + Intronic
932356797 2:71073971-71073993 GCTGTGAGCTGCTTCTGGCCTGG + Intronic
932634312 2:73374705-73374727 GGTGAGAGATGCTTGTGGCCTGG + Intergenic
933680148 2:85092536-85092558 ATTGAGGAATGCATCTGGCGAGG - Intergenic
939272415 2:139957330-139957352 GTTGAGAGAAGAACCAGGCCTGG + Intergenic
940270906 2:151889171-151889193 TTTAAGAGTTGCATTTGGCCAGG + Intronic
940657880 2:156510296-156510318 GTTGAGAAATGCATCTGGAGTGG - Intronic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
944912398 2:204323328-204323350 GTTAAGAGCTGAATCTAGCCGGG - Intergenic
945104778 2:206299754-206299776 GTGAATAGATGCATCCGGCCTGG + Intronic
946139070 2:217672772-217672794 GTTTAGAGAGGCCACTGGCCTGG - Intronic
946158796 2:217823559-217823581 GTCTAGAGAGGCCTCTGGCCTGG - Intronic
947742642 2:232491631-232491653 GCTGAGAGATGCTTCAGGCAGGG - Intergenic
1172068937 20:32242151-32242173 GTTGGGAGATGCATCAGGCATGG - Intergenic
1173202368 20:40963247-40963269 GTTGTGAGAAGCACCTGGGCTGG - Intergenic
1173626621 20:44477504-44477526 GCTGAGAGATGCTGGTGGCCTGG - Intronic
1175576561 20:60064956-60064978 GTGAAGAGATGCATAGGGCCAGG - Intronic
1177217860 21:18152603-18152625 TTTGAGAGAGCCATGTGGCCAGG - Intronic
1177858779 21:26428471-26428493 GTGGAGAGATGAATTTGACCAGG + Intergenic
1178713578 21:34942912-34942934 GTTGATATGTGCATCTGGTCCGG - Intronic
1179302469 21:40124701-40124723 TTTGAGACAAGCATCTGTCCTGG - Intronic
1179548128 21:42125711-42125733 GGTGAGAGGTGCATGTGGGCCGG + Intronic
1180997042 22:19970850-19970872 GTGGATAGAAGCATCTGCCCTGG + Intronic
1181984878 22:26793190-26793212 TTTGGGAGAAGCATCTGTCCAGG - Intergenic
1183521136 22:38296668-38296690 GTGGAGAGGTGCTCCTGGCCTGG + Intronic
1183887088 22:40893216-40893238 TTTAATAGATACATCTGGCCGGG + Intronic
1184711992 22:46256193-46256215 TTTGAGAGAGGGACCTGGCCAGG - Exonic
1184821873 22:46915536-46915558 CCTGAGAGCTGCAGCTGGCCTGG + Intronic
949513797 3:4789198-4789220 GCTGAGGGATGGATTTGGCCTGG - Intronic
950813472 3:15673070-15673092 GTTAAGAGATAAAACTGGCCGGG - Intronic
954106697 3:48413401-48413423 GTTGTGGGATGGATTTGGCCTGG - Intronic
956520349 3:70096867-70096889 GTTGAGAGATGTCTATGGCCTGG + Intergenic
956880646 3:73507796-73507818 ATTCTGAGATGCAGCTGGCCGGG + Intronic
962389893 3:134962636-134962658 GCTGAGAGATGCATGCGGCAGGG - Intronic
962390087 3:134964039-134964061 ATTCAGAGATGCATCAGGCATGG - Intronic
963636142 3:147798984-147799006 GTGGAGAGGGCCATCTGGCCAGG + Intergenic
968471413 4:784327-784349 GTTAAAAGATGATTCTGGCCAGG - Intergenic
969874203 4:10123906-10123928 GTTGAGATCTGCATGTGGCTGGG + Intergenic
972399940 4:38691384-38691406 GTTGAGGGATGTTTCTGGCAAGG + Intronic
976031364 4:80758300-80758322 CTTTGGAGAGGCATCTGGCCTGG - Intronic
976614591 4:87063532-87063554 GTAAAGAGGTGGATCTGGCCGGG - Intronic
976724970 4:88206923-88206945 GGTGAGAGATGAAGCTGGCTGGG - Intronic
977737106 4:100430224-100430246 CTTGAGAGATTCATTTGCCCAGG + Intronic
978576152 4:110191892-110191914 GCTGAAAGATTCCTCTGGCCGGG + Intronic
979187199 4:117811710-117811732 CTTGAGAGCTATATCTGGCCTGG - Intergenic
980556298 4:134410024-134410046 GATGAGAGATGCTTGTGTCCCGG - Intergenic
980565873 4:134539869-134539891 GTTGAGAGAGGCAACTGACATGG + Intergenic
982573314 4:157076536-157076558 GTGGAGAGATGCAGAGGGCCGGG + Intronic
985061295 4:186081929-186081951 GTAAAGAACTGCATCTGGCCGGG + Intronic
988904737 5:35774897-35774919 TATGGGAGATGCATCTGTCCTGG - Intronic
990309823 5:54527298-54527320 GGTGAGAGATGCTGGTGGCCTGG + Intronic
990714391 5:58620808-58620830 CTTGAGTGATGCATCTGGGATGG + Intronic
991034920 5:62119549-62119571 GTTGAGAGGTGAAGCTGGCTGGG + Intergenic
992434141 5:76739244-76739266 TTTGAAAGCTGCATCTGGCCAGG + Intergenic
995756141 5:115506433-115506455 GCTGAGAGATGGTTCTGACCTGG - Intergenic
1001840146 5:174868999-174869021 GTTGAGAGGTGAAGCTGGCTGGG - Intergenic
1003848422 6:10197679-10197701 ATTAAGAGATGCATACGGCCAGG - Intronic
1004927838 6:20432638-20432660 ATTGAGAGATGGATGTGGTCTGG + Intronic
1005108597 6:22252786-22252808 CCTGAGAGATGCATCTGGTTAGG + Intergenic
1005416371 6:25604534-25604556 GGTGAGAGGTGCATGGGGCCAGG - Intronic
1005735742 6:28743967-28743989 GCTGAGAGATGCATCTCTCTGGG - Intergenic
1006471581 6:34232299-34232321 GTGGAGGGATCCATCTGGCCAGG + Intergenic
1010790665 6:80061102-80061124 GTTGAGAGATGTTTCTGACTAGG + Intergenic
1015577854 6:134691560-134691582 GTGTAGAGATGCCTATGGCCAGG - Intergenic
1018434068 6:163745230-163745252 GTGGAGAGAGGCATCTGAGCTGG - Intergenic
1019160026 6:170063385-170063407 GGTGGGAGATGCATGTGGCCAGG - Intergenic
1020613459 7:10429244-10429266 GTTGAGAGCTGCAGCTGTCTGGG - Intergenic
1023639288 7:42241468-42241490 CCTGAGAGATTCATGTGGCCAGG - Intergenic
1024914489 7:54484180-54484202 GATGAGAAGTGCATCTGTCCGGG - Intergenic
1026459601 7:70602037-70602059 CTTGAGAGAGGCACCTGCCCTGG - Intronic
1033591729 7:142814107-142814129 GTTGAAAGATGCATTTTGCCTGG + Intergenic
1036747967 8:11423642-11423664 CTTTGGAGATGCATGTGGCCAGG + Exonic
1037951690 8:23022794-23022816 GTGGACAGAGGCATCTCGCCCGG + Exonic
1042297620 8:67238869-67238891 GGAGAGAGATGCATATGTCCAGG - Exonic
1045891233 8:107160151-107160173 GTTGACAGCTGCTGCTGGCCTGG - Intergenic
1048603950 8:135948004-135948026 TTTGAGAGAGGCATATGGCAAGG - Intergenic
1048664566 8:136646245-136646267 TTTGACAGGTTCATCTGGCCGGG + Intergenic
1049157035 8:141073605-141073627 GTTGAGAAATGGAGCTGGGCTGG + Intergenic
1051160866 9:14205586-14205608 GTTGAGAGACACATTAGGCCTGG + Intronic
1052422604 9:28263148-28263170 GTGGAGAGGGCCATCTGGCCAGG - Intronic
1052998278 9:34563328-34563350 GTTGAGAGATTCACCTGGGGTGG - Intronic
1057224440 9:93282611-93282633 GGTGAAAGATTCAACTGGCCAGG + Intronic
1057710583 9:97439273-97439295 CTTGAGAGATGCATCTGCAAAGG - Exonic
1059121518 9:111643247-111643269 GTGGAGAGATGCATATTGCAAGG + Intronic
1059228647 9:112696822-112696844 ATGAAGAGATGCATCGGGCCAGG + Intronic
1059806676 9:117808754-117808776 CTTGAGAGATGCATTTGGAAAGG - Intergenic
1061580914 9:131535432-131535454 TTTAAGATATGCAACTGGCCGGG - Intergenic
1185748536 X:2591598-2591620 CTTGAGAGATGTTTCCGGCCAGG - Intergenic
1195596675 X:106699096-106699118 GGTGAGAGATGATTTTGGCCTGG - Intronic
1198588869 X:138153814-138153836 TTTCAAAGACGCATCTGGCCAGG - Intergenic
1199604798 X:149568672-149568694 GCTGTGAGCTGCATCTGGCTTGG - Intergenic