ID: 1162131706

View in Genome Browser
Species Human (GRCh38)
Location 19:8530077-8530099
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 3, 1: 1, 2: 0, 3: 16, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162131702_1162131706 -5 Left 1162131702 19:8530059-8530081 CCAGGTGAGGGTGTACCTGTGAT 0: 1
1: 1
2: 0
3: 7
4: 97
Right 1162131706 19:8530077-8530099 GTGATGGAACAGATGGATCTAGG 0: 3
1: 1
2: 0
3: 16
4: 188
1162131698_1162131706 17 Left 1162131698 19:8530037-8530059 CCTGTGGGCAGGTGCATATGGGC 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1162131706 19:8530077-8530099 GTGATGGAACAGATGGATCTAGG 0: 3
1: 1
2: 0
3: 16
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900820054 1:4879647-4879669 GTGCTGGAACAGGAGGATCTTGG + Intergenic
901139931 1:7022093-7022115 GGGATGGGACAGATGCACCTGGG + Intronic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
908119853 1:60975732-60975754 GTTATGGAACGGATGGATTGAGG + Intronic
908764886 1:67545859-67545881 GTGGTTGGACACATGGATCTGGG - Intergenic
908869876 1:68597270-68597292 GTGATTTATCTGATGGATCTGGG + Intergenic
910889548 1:92002957-92002979 GTAATGGAACAGAGGGATGGAGG - Intronic
911712612 1:101092404-101092426 GTGATTCATCTGATGGATCTGGG - Intergenic
911952388 1:104191603-104191625 GTAGTGCAACAGCTGGATCTCGG - Intergenic
913072748 1:115315455-115315477 GTGAGGGAACAGGGGGATCGAGG + Intronic
915254751 1:154618679-154618701 GTTATTCAACAGATGGAGCTGGG + Intronic
917736940 1:177929989-177930011 TTGATTGGACAGATGGAGCTAGG + Intronic
918632442 1:186733963-186733985 GTGATTCCACTGATGGATCTAGG - Intergenic
920347367 1:205314973-205314995 GAGTTGAAAGAGATGGATCTTGG - Intronic
1064444676 10:15382894-15382916 ATGATGGAAGAGAGGGACCTAGG + Intergenic
1065687212 10:28298236-28298258 GTGATTGTTCTGATGGATCTTGG - Intronic
1069069396 10:63977878-63977900 GAGATGGACCAGATTGCTCTAGG - Intergenic
1070258140 10:74827439-74827461 GTGATGGGAAAGAGGTATCTGGG + Intronic
1071992099 10:91109484-91109506 CTGATGCAAAAGATGGAACTGGG + Intergenic
1074347408 10:112700844-112700866 GTGGTGGAACAGATGAAACTTGG - Intronic
1075258616 10:120944636-120944658 GTGATGGCTCAGCTGGAACTGGG - Intergenic
1076410486 10:130245433-130245455 GTGATGGGAGACCTGGATCTGGG + Intergenic
1078134256 11:8639118-8639140 GTGATGGCAGAGAAGGGTCTAGG - Intronic
1078526512 11:12105596-12105618 CTGCTGTAACTGATGGATCTTGG - Intronic
1079890884 11:26051480-26051502 GTGATTCCACTGATGGATCTGGG + Intergenic
1080064527 11:27995367-27995389 GTGATTCATCTGATGGATCTGGG + Intergenic
1087325219 11:96713353-96713375 GGGAGGGAACAGATTGATCTTGG - Intergenic
1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG + Intergenic
1088389293 11:109296607-109296629 GTGATTCCTCAGATGGATCTGGG - Intergenic
1090482124 11:127078051-127078073 GTGATGGAGCAGAGGCATCTTGG + Intergenic
1091945789 12:4540038-4540060 GGAATGGAACAGATGAATTTGGG + Intronic
1093122512 12:15289533-15289555 CTAATGGAACAGATTGACCTTGG - Intronic
1093203754 12:16221881-16221903 GAGAGGAAAGAGATGGATCTAGG + Intronic
1093635070 12:21457212-21457234 GTGATGCATCTGATGGATCTGGG - Intronic
1093806766 12:23443139-23443161 GAGATGGAAGAGATAGATCATGG + Intergenic
1094339407 12:29393920-29393942 TTGATAGAAAAGATGCATCTTGG + Intergenic
1095233242 12:39767080-39767102 GTGATTTCTCAGATGGATCTGGG - Intronic
1095364202 12:41382645-41382667 GTAATGGAAAAGGTGCATCTTGG - Intronic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1096440428 12:51638346-51638368 GTGATTTATCTGATGGATCTGGG + Intronic
1098453999 12:70651920-70651942 GTGAAGGAAAAGAAGCATCTTGG - Intronic
1099559290 12:84152452-84152474 GTCATGTATCAGATGGATGTAGG - Intergenic
1101190698 12:102329410-102329432 TGCATAGAACAGATGGATCTTGG + Intergenic
1101324500 12:103703300-103703322 GTGATGGAACTAATGAATATTGG + Intronic
1101568044 12:105928104-105928126 GGGATGGAACAGATGGTGTTGGG + Intergenic
1101874528 12:108589715-108589737 GTGAAGGGACAGATTGATGTGGG - Intergenic
1101949959 12:109166988-109167010 GAGAAGGTACAGATGGGTCTCGG + Exonic
1104362180 12:128144334-128144356 ATGTTGGCACAGATGGATCAGGG + Intergenic
1104882132 12:132079464-132079486 GTGATAGAACTGAAGTATCTAGG + Exonic
1106029381 13:25985909-25985931 GTGAGGGAAGAAATGGATGTTGG + Intronic
1106196012 13:27494462-27494484 GTGATGGAACAGTGGTCTCTAGG + Intergenic
1106309106 13:28537696-28537718 CTGATAGAAAAGATGCATCTTGG + Intergenic
1107068380 13:36242704-36242726 GAGATGGAAGTGATTGATCTGGG + Intronic
1107611344 13:42116371-42116393 GTCATGGGAGAGATGGATCAGGG - Intronic
1108801593 13:54102884-54102906 GTGATTCTGCAGATGGATCTGGG - Intergenic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1109495257 13:63161954-63161976 GGTATAGAACAGATGTATCTAGG - Intergenic
1110776789 13:79416980-79417002 GTGATGGAAGAGAGGAACCTGGG - Intergenic
1112622935 13:101070429-101070451 GTGATTGCTCTGATGGATCTGGG - Intronic
1113450428 13:110405478-110405500 GTGATGGAGAAGACGGGTCTGGG - Intronic
1113736224 13:112680520-112680542 CTGAAGGAAGAGATGGACCTGGG + Intronic
1113980902 13:114274553-114274575 GTGATTCCTCAGATGGATCTGGG - Intergenic
1117079618 14:52137818-52137840 TTGATGGAAAAGATGCATCTTGG + Intergenic
1117245964 14:53886959-53886981 GGGAGGGAAAAGATGGGTCTAGG + Intergenic
1117519668 14:56538366-56538388 GTGATTCCACTGATGGATCTGGG + Intronic
1125366735 15:38925494-38925516 GTGATTCATCTGATGGATCTGGG - Intergenic
1126971696 15:54120627-54120649 GTGATTTATCAGATGAATCTAGG + Intronic
1127081329 15:55383031-55383053 GTGATTGTTCTGATGGATCTGGG - Intronic
1128215121 15:65929591-65929613 GTGATGGGACACTTGGATTTAGG - Intronic
1133448567 16:5884421-5884443 GCGGTGGAACAGATGGATTTTGG - Intergenic
1133600955 16:7339942-7339964 GTGGTGGAAAAGATGGTTCTTGG + Intronic
1137867955 16:51920642-51920664 GTGATAGAACACATAGATGTGGG - Intergenic
1137903234 16:52291759-52291781 CTGAGAGAAGAGATGGATCTTGG - Intergenic
1140518413 16:75561414-75561436 CTTCTGGAATAGATGGATCTAGG + Intergenic
1141670905 16:85491262-85491284 GTGAAGAAACAGATTGATCCTGG - Intergenic
1203148105 16_KI270728v1_random:1816270-1816292 CTGCTGGAACGGATGGCTCTGGG - Intergenic
1145700459 17:26825864-26825886 GTAATGGAACGGATTGATATCGG + Intergenic
1147631542 17:41935519-41935541 GTGGTGGAACAGAAGGGTCCTGG - Intronic
1149205874 17:54247312-54247334 GTGATGGAGCAGATGGTTTCAGG + Intergenic
1149252785 17:54789293-54789315 TGGATGGACCAGATGGTTCTTGG - Intergenic
1149571477 17:57675321-57675343 GTGATGGAGCAGAAGGAGCATGG + Intronic
1149809282 17:59652389-59652411 GTGATTCATCTGATGGATCTGGG - Intronic
1150161322 17:62900721-62900743 ATGATGGAGTAGAGGGATCTAGG + Intergenic
1151575811 17:74952132-74952154 GTGATGGGAAACATGGGTCTTGG - Intronic
1153736924 18:8080834-8080856 GTGATGGCTCAGAAGGCTCTTGG - Intronic
1159272501 18:66170464-66170486 GTGCAGAAACAAATGGATCTTGG - Intergenic
1161901501 19:7122922-7122944 GTGATGGAGCTGATGGCTCACGG - Exonic
1162131656 19:8529846-8529868 GTGATGGAACAGATTGATCTAGG + Intronic
1162131673 19:8529923-8529945 GTGATGGAACAGATGGATCTAGG + Intronic
1162131688 19:8530000-8530022 GTGATGGAACAGATGGATCTAGG + Intronic
1162131706 19:8530077-8530099 GTGATGGAACAGATGGATCTAGG + Intronic
1162299810 19:9838119-9838141 GTGATGGAACAGAGGAAGCTGGG - Intronic
1167197494 19:48040625-48040647 GAGATGGAACTGATTGAGCTCGG - Exonic
927402052 2:22722546-22722568 GTGATGGAAGGGATGGAAATTGG + Intergenic
928991055 2:37233129-37233151 GTGATGGAACGGAGGAATCAAGG + Intronic
935257722 2:101327321-101327343 GTGATGTAAAAGATGTACCTCGG + Intergenic
936920332 2:117682125-117682147 GTGATTCCACAGATGGATCTGGG + Intergenic
937073791 2:119086066-119086088 GTCATAGAACAGATTGCTCTTGG - Intergenic
937535142 2:122877046-122877068 CTGAAGGAACAGATAGATGTGGG + Intergenic
938987141 2:136587961-136587983 GTGATTCCTCAGATGGATCTGGG - Intergenic
941439650 2:165518473-165518495 ATGAAGGAACAGGAGGATCTTGG + Intronic
942258858 2:174137030-174137052 GTGATTTATCTGATGGATCTGGG - Intronic
942916779 2:181318784-181318806 GTTATTGAACAAATGGATATAGG + Intergenic
944516975 2:200522087-200522109 GTCAAGTAACAGAAGGATCTTGG - Intronic
945589663 2:211714689-211714711 GTCCTGGTAGAGATGGATCTTGG + Intronic
947754076 2:232548782-232548804 GTGATGTCTCTGATGGATCTGGG - Exonic
948073336 2:235145127-235145149 ATCATGGACCTGATGGATCTAGG + Intergenic
948660160 2:239501973-239501995 GTGCTGGAGCAGAAGGAGCTGGG - Intergenic
948935900 2:241164473-241164495 GAGATGGAACAGAGTGCTCTGGG + Intronic
1168949341 20:1785968-1785990 GTGAGGGAACAGATGGTCATGGG + Intergenic
1172942425 20:38663705-38663727 GTGATGGGACACTGGGATCTGGG - Intergenic
1173349335 20:42230879-42230901 GCTATGGAACAGAGGGATCTGGG - Intronic
1175066126 20:56290498-56290520 GTGGGGGAAGAGATGAATCTTGG - Intergenic
1175250489 20:57607107-57607129 GTGATTCCTCAGATGGATCTGGG + Intronic
1176097486 20:63350973-63350995 GTCATGGAACAGGTGGGCCTTGG + Exonic
1176771839 21:13081680-13081702 GTGATGTAACAGTTAAATCTTGG + Intergenic
1176957532 21:15123616-15123638 CTGATGGAAGAGAGGGCTCTAGG - Intergenic
1179248852 21:39656394-39656416 GTGATGTAACAGGTGGAACCAGG - Intronic
1180168153 21:46040656-46040678 GGAATGGAAAAGAGGGATCTCGG - Intergenic
1182020893 22:27080697-27080719 GAGATAGAAGAGATGGAGCTGGG - Intergenic
1182869934 22:33637110-33637132 TTGATGGAACAGAGGGAATTGGG - Intronic
1183317895 22:37146907-37146929 GAGATGGAACCCATGGCTCTTGG - Intronic
1184822056 22:46916869-46916891 GTGATGGGAGAGATCGATCATGG + Intronic
951340351 3:21478468-21478490 CTAATGGAACAGGTGTATCTGGG - Intronic
953718910 3:45338467-45338489 AGGATGGAAAAGAGGGATCTGGG + Intergenic
953876868 3:46671545-46671567 GTCACGGATCAGGTGGATCTCGG + Exonic
955604228 3:60682799-60682821 GTGATTTATCAGATTGATCTGGG + Intronic
955734997 3:62029160-62029182 GTGAAGGGCCAGATGCATCTAGG + Intronic
957028499 3:75213390-75213412 GTGACGGAAGAGCTGGAACTTGG - Intergenic
957988840 3:87605677-87605699 TTCATGGCACAGATGGAACTTGG - Intergenic
958534484 3:95381002-95381024 GTGATGTTTCTGATGGATCTTGG + Intergenic
959546427 3:107602344-107602366 GTGATTGCTCTGATGGATCTGGG + Intronic
960669426 3:120142043-120142065 GTGATTCCTCAGATGGATCTGGG + Intergenic
960868937 3:122230386-122230408 GTGCTGGAGCAGAAAGATCTAGG - Intronic
961089290 3:124095832-124095854 CTGATGGAAAAGATGGCCCTGGG + Intronic
961444679 3:126973694-126973716 GAGAAGGAAGAGATGGCTCTGGG + Intergenic
961933848 3:130562354-130562376 GTGATGGCACCAATGTATCTTGG - Intronic
963081289 3:141396601-141396623 GTGATTGCTCTGATGGATCTGGG - Intronic
963393318 3:144697688-144697710 GTCATGGATCAGATGGTTGTAGG + Intergenic
964535095 3:157712421-157712443 GTGATTGCTCTGATGGATCTGGG + Intergenic
967538668 3:190638786-190638808 GTGCTGGAACAACTGGATATCGG - Intronic
967846262 3:194045518-194045540 GTGGTGGTACAGAGGGATGTGGG - Intergenic
970578917 4:17455541-17455563 GTGATTCCACTGATGGATCTGGG + Intergenic
977999627 4:103541337-103541359 GTGAAAGATCAGATGGTTCTAGG + Intergenic
979005555 4:115290641-115290663 ATGCTGGAACAGATTGGTCTAGG + Intergenic
979576912 4:122303520-122303542 GTGATTCCTCAGATGGATCTGGG + Intronic
980403153 4:132320162-132320184 GGGGATGAACAGATGGATCTGGG + Intergenic
981874870 4:149529968-149529990 TAGCTGGAACAGATGGATCAAGG - Intergenic
985529095 5:423393-423415 GTGCTGGGACAGTTGCATCTGGG + Intronic
986682060 5:10242671-10242693 GTGATTACACTGATGGATCTGGG - Intronic
986928463 5:12789165-12789187 GTGATGCTTCTGATGGATCTGGG - Intergenic
987124586 5:14799913-14799935 GTGATTCCACTGATGGATCTGGG + Intronic
988641376 5:33044069-33044091 TTGATAGAAAAGATGCATCTTGG + Intergenic
990572247 5:57090605-57090627 GTGATGCTTCTGATGGATCTGGG + Intergenic
991455546 5:66799636-66799658 TGGATGGAACAGATAGACCTTGG + Intronic
992074649 5:73180168-73180190 GTGATTGCTCTGATGGATCTGGG + Intergenic
992555450 5:77898655-77898677 GTGATGGCACACATGTAACTAGG + Intergenic
992812108 5:80398975-80398997 GTAATGGAATAGATGAAACTAGG + Intergenic
997583049 5:135029053-135029075 GTCATGGAGGAGATGGAGCTGGG + Exonic
998498269 5:142609923-142609945 GTTATGGATCAGATGGGTGTAGG - Intronic
998571396 5:143261886-143261908 GTGATGGAACAGATCAAACATGG - Intergenic
1000953965 5:167520299-167520321 GTTATGAAACAGCAGGATCTCGG + Intronic
1002821596 6:730388-730410 GAGATGGAACAGATTGAGTTTGG - Intergenic
1005512814 6:26526636-26526658 GTGATAGAAAAGATGCATCTTGG + Intergenic
1005894632 6:30167465-30167487 GTGATATACAAGATGGATCTTGG - Intronic
1011907302 6:92387807-92387829 GAGATGGAAAAGATGGAACTTGG + Intergenic
1013569268 6:111404530-111404552 GTGATTCCACTGATGGATCTGGG + Intronic
1016489675 6:144583609-144583631 GTGATTGAAAATAAGGATCTCGG + Intronic
1018220493 6:161573181-161573203 GAGATGGAACATTTGAATCTGGG + Intronic
1018818400 6:167353354-167353376 GTGATTCCTCAGATGGATCTGGG + Intronic
1019495967 7:1340870-1340892 GTGATGGGACAGGTGGGTCCTGG - Intergenic
1021029995 7:15720741-15720763 GTGATGAATCAGAAAGATCTTGG - Intergenic
1022246807 7:28568179-28568201 GTGATGGAAAAGAGGCATCCAGG + Intronic
1027242817 7:76344059-76344081 GTAATGGAACAGATGAACCTGGG + Intronic
1028091795 7:86711855-86711877 CTAATAGAAGAGATGGATCTAGG - Intronic
1029505418 7:100960916-100960938 GCTGTGGAACAGGTGGATCTAGG + Exonic
1029642892 7:101832266-101832288 GTGATGGGAGAGATGGGGCTGGG + Intronic
1030101244 7:105947333-105947355 GTGTTGGACAAGATGTATCTTGG + Intronic
1031988921 7:128183306-128183328 GGGATGGGAGAGATGGACCTGGG + Intergenic
1034675802 7:152891721-152891743 AGGATGCAACACATGGATCTGGG - Intergenic
1035975075 8:4301154-4301176 GTGATGGAAAAGAACGCTCTGGG + Intronic
1036703440 8:11029353-11029375 GAGATTTAACATATGGATCTGGG - Intronic
1037762974 8:21754286-21754308 GTGATGGAATAAATGTATTTAGG + Intronic
1042180508 8:66082562-66082584 GTGATGGAATTGATAGCTCTGGG - Intronic
1042862235 8:73326460-73326482 GTGATGCAATGGATGGATTTGGG + Intergenic
1044552126 8:93524362-93524384 GTGGTGGAAAAGATGGAAGTTGG - Intergenic
1045541745 8:103092997-103093019 GTGATGCATCTGATGGATCTGGG - Intergenic
1045752861 8:105507058-105507080 TAGAGAGAACAGATGGATCTAGG + Intronic
1046290982 8:112160624-112160646 TTGATGGAATAGATGGATAGTGG + Intergenic
1049659474 8:143813333-143813355 AAGCTGGAACAGCTGGATCTGGG - Exonic
1050902133 9:10962354-10962376 GTGATTTATCTGATGGATCTGGG + Intergenic
1051123926 9:13782528-13782550 GTGATTCCACTGATGGATCTGGG + Intergenic
1052016579 9:23475337-23475359 GAGAAGGAAGAGATGGATTTGGG - Intergenic
1056807501 9:89740318-89740340 ATGATGGAAAAAATGGAGCTGGG + Intergenic
1058606703 9:106730866-106730888 GTGATGGGACAGTTGCATCTTGG - Intergenic
1059811421 9:117859645-117859667 ATGAGGGAAAAGATGGGTCTAGG + Intergenic
1060197357 9:121632349-121632371 GTGATAAAACAGATGGGTCCTGG + Intronic
1062350732 9:136137481-136137503 GTTCTGGCACAGATGGCTCTAGG + Intergenic
1187540834 X:20192649-20192671 GAGATGCAACAGAGCGATCTTGG + Intronic
1187585596 X:20658022-20658044 GTGATGGCACAGATAGGTGTTGG + Intergenic
1187777103 X:22772890-22772912 GTGGAGGAACAGAGGGATCATGG + Intergenic
1188139367 X:26529504-26529526 GTGATTCTACTGATGGATCTGGG + Intergenic
1189119174 X:38375632-38375654 GTGATGGAACAAATGGAAAGGGG + Intronic
1189536206 X:41937725-41937747 GTGATGGAAAAGTTGTATTTGGG + Intergenic
1190588717 X:51975225-51975247 ATGAAGGAACAGGTAGATCTGGG + Intergenic
1192668514 X:73113947-73113969 GTGATTCCTCAGATGGATCTGGG - Intergenic
1193385292 X:80863699-80863721 GTGAAGGATCAGATGGTTGTAGG + Intergenic
1200681601 Y:6219097-6219119 GTCATGGAGCAGATGGCTGTAGG + Intergenic