ID: 1162137645

View in Genome Browser
Species Human (GRCh38)
Location 19:8565605-8565627
Sequence GGGCCTAGTGGGGCAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 533}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162137645 Original CRISPR GGGCCTAGTGGGGCAGGAGC AGG Intronic
900119063 1:1040957-1040979 GGGGCCAGTGGGGCGGGGGCAGG + Intronic
900119098 1:1041023-1041045 GGGCGGAGCGGGGCGGGAGCGGG + Intronic
900119136 1:1041098-1041120 GGGCGGAGCGGGGCGGGAGCGGG + Intronic
900121494 1:1050327-1050349 GGGGTCGGTGGGGCAGGAGCAGG + Exonic
900151017 1:1179420-1179442 CGGCCTCATGGGGCAGGGGCAGG + Intronic
900269699 1:1780845-1780867 GGGCCTGGTCAGGCAGGAGGGGG - Intergenic
900324330 1:2100621-2100643 GGGCCTCGGGGAGCAGGTGCAGG + Intronic
900342271 1:2194783-2194805 GGGCCTGGAGGGGCGGGGGCGGG - Intronic
900512552 1:3067531-3067553 GAGCCGGGTTGGGCAGGAGCTGG - Intergenic
900602610 1:3509512-3509534 GGGCCTAGAGGGGTAGGGGTGGG + Intronic
901634227 1:10663239-10663261 GGGTCTAGAGGGGCAGGACTGGG + Intronic
902292451 1:15444423-15444445 GGTCCCAGAGGGTCAGGAGCAGG - Intronic
902394333 1:16124497-16124519 GGGCCGACTGGGGCATGGGCAGG + Exonic
902801520 1:18832959-18832981 GGGGCTAGTGGAGCTGGAGCTGG - Intergenic
903486314 1:23691763-23691785 GGGCCTTATGGGCCAGGAGGCGG - Exonic
903614794 1:24643675-24643697 GGGCCTAGCGGAGCCGGAGGAGG + Intronic
904035691 1:27557338-27557360 AGGCCTAGTGGGGCTGGAGGAGG - Intronic
904354687 1:29931202-29931224 GGGCTGAGAGGGGCAGGGGCAGG - Intergenic
904400763 1:30254905-30254927 GGGCCAAGTGGGGGTGAAGCTGG + Intergenic
904447543 1:30587237-30587259 GGGCCTAGTGGAGGAGGGGGAGG - Intergenic
904468091 1:30719604-30719626 GAGCCTAGTGGGAGGGGAGCAGG - Intronic
904622646 1:31784514-31784536 TGGCCTGGGGGTGCAGGAGCTGG - Intergenic
904652256 1:32014247-32014269 TGGCCGAGGGGGGCAGCAGCGGG - Exonic
905145832 1:35886170-35886192 GGGCCTAGGGGGAAAGGGGCGGG - Intronic
905227020 1:36485728-36485750 GGGGCTGGTGAGGCAGGAGAGGG - Intergenic
905257091 1:36691766-36691788 GTGACTGGTGGGGCAGGTGCGGG + Intergenic
905734633 1:40316854-40316876 AGGCAGCGTGGGGCAGGAGCTGG - Intronic
905902812 1:41592906-41592928 GGGCCTAGACTGGCAGAAGCCGG - Intronic
906237816 1:44222373-44222395 GAGCCTACTGGGACAGAAGCAGG - Intronic
906480909 1:46198354-46198376 GGCCCTAGCGGGGCCCGAGCGGG - Intronic
906606708 1:47177763-47177785 GGGCCTGTTGGGGCAGGGGTGGG + Intergenic
906717578 1:47981587-47981609 GGGGCTAGTGGGGAAGGGGGTGG - Intronic
906952583 1:50346923-50346945 GGGCGCACTGGGGAAGGAGCTGG - Intergenic
907308753 1:53527701-53527723 GGGCCTCTGGGGGCAGGTGCTGG + Intronic
907964665 1:59317595-59317617 GGGCATAGAGGGGGAAGAGCAGG + Intronic
907988354 1:59554935-59554957 GGGCAGAGTGGGGGAGGAGCAGG + Intronic
908682862 1:66682093-66682115 GGGCCGAGAGGGCCTGGAGCTGG - Exonic
912496453 1:110095025-110095047 GTGCTAAGTGGGGCTGGAGCAGG - Intergenic
913454565 1:119018191-119018213 GGGTGAAGTGGGTCAGGAGCAGG - Intergenic
913661104 1:121007176-121007198 GGGGTTGGTGGGGCGGGAGCGGG + Intergenic
914012472 1:143790353-143790375 GGGGTTGGTGGGGCGGGAGCGGG + Intergenic
914165360 1:145170830-145170852 GGGGTTGGTGGGGCGGGAGCGGG - Intergenic
914651101 1:149698963-149698985 GGGGTTGGTGGGGCGGGAGCGGG + Intergenic
915185211 1:154099206-154099228 GGGGGTAGTGGGGCTGGGGCAGG + Intronic
915485750 1:156219450-156219472 GGACATAGTGGGCTAGGAGCTGG - Intronic
915579901 1:156807273-156807295 GGGGCTGGTGGGGCAGGGGAGGG + Exonic
917240818 1:172946615-172946637 GGACCTAGTGGGGCTAGAGATGG - Intergenic
918099782 1:181363508-181363530 GGGACTAGAGGGGCAGGACAAGG + Intergenic
919788902 1:201277442-201277464 GGGGCTACTGGGGCAGGGGCGGG - Intergenic
920659442 1:207902844-207902866 GGCCCCAGTGGGTCAGTAGCTGG - Intronic
920939911 1:210472497-210472519 GGGGCTTGTGGGACAGGATCTGG + Intronic
921165024 1:212500610-212500632 AGGCCTGGAGAGGCAGGAGCCGG + Intergenic
922377685 1:224985453-224985475 GGGACTTGTGGGGGAAGAGCTGG + Intronic
924812628 1:247416605-247416627 AGGACTGATGGGGCAGGAGCTGG + Intronic
1063385560 10:5614196-5614218 GGCCCTAGTGGAACAGGGGCAGG - Intergenic
1063535235 10:6876729-6876751 GGGCCATGTGGGGAAGCAGCAGG + Intergenic
1063983216 10:11473276-11473298 GGTGCTGGTGAGGCAGGAGCCGG + Intronic
1064011859 10:11742302-11742324 GGGCCTCGTGGGGGCGGGGCGGG + Intergenic
1066025850 10:31360168-31360190 TGGCATAAAGGGGCAGGAGCAGG - Intronic
1067314764 10:45151188-45151210 TGGCCTAGTGCCACAGGAGCCGG + Intergenic
1067429924 10:46236275-46236297 GGGACTAGCAGGGCAGGGGCAGG - Intergenic
1067443721 10:46327544-46327566 GGGACTAGCAGGGCAGGGGCAGG + Intronic
1069744844 10:70708619-70708641 GGGCCTGGTGGGGGACCAGCTGG + Exonic
1069948051 10:72000943-72000965 GGGCCTAGTGTGGCTGGTGTGGG - Intronic
1070843867 10:79506573-79506595 GGACCTACTGGTGCAGGAGATGG + Intergenic
1070913522 10:80137962-80137984 GGCCCTTGAGAGGCAGGAGCAGG - Intronic
1071471463 10:85987034-85987056 GGTCCTAGATGGGGAGGAGCTGG - Intronic
1071564278 10:86663581-86663603 GGGCCTGGTGGGGTAAGGGCAGG + Intronic
1072637594 10:97187627-97187649 GGGCCCCATGGAGCAGGAGCTGG - Intronic
1072757336 10:98030093-98030115 GGGCCTGGAGGGGGCGGAGCGGG - Intronic
1073126387 10:101152889-101152911 GGGTCTATTGGGGCATGAGGTGG - Intergenic
1073205894 10:101769156-101769178 GGGCCTGGCGGGAGAGGAGCTGG - Intergenic
1073291148 10:102413934-102413956 GGGGCAAGTGGGGCGGGAGCTGG + Exonic
1073472208 10:103729850-103729872 TGGTCTTGAGGGGCAGGAGCTGG - Intronic
1074169597 10:110919538-110919560 GGGGCGAGTGGGGGAGGGGCGGG + Exonic
1074291220 10:112139293-112139315 GGGGCTAGTGGGGTGGGAGTGGG - Intergenic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1074377547 10:112951741-112951763 GGGCCTCCTGGGCCACGAGCGGG - Intronic
1075630928 10:124000240-124000262 GGGCCTCGAGGGCCATGAGCAGG + Intergenic
1075779349 10:125006782-125006804 AGGCCCAGTGGGGCAGGATTGGG + Intronic
1075961480 10:126571171-126571193 GGACCTCGTGGGTCAGGAGCTGG - Intronic
1076252187 10:128993720-128993742 GGACCCAGAGGGGCTGGAGCAGG - Intergenic
1076424563 10:130358441-130358463 GGGCCCAGAGGGCCAAGAGCAGG - Intergenic
1076451440 10:130559741-130559763 TGTCCTGGAGGGGCAGGAGCAGG + Intergenic
1076536588 10:131181687-131181709 GGGCCAGGTGGGCCAGGAGCAGG + Intronic
1076768223 10:132649023-132649045 GGGCCCTGTGGGGCAGAACCAGG - Intronic
1076916392 10:133424731-133424753 GGGCCTTGTGATGCAGGAGACGG - Intergenic
1076936499 10:133569526-133569548 GGGCCTTGTGATGCAGGAGACGG - Intronic
1077014759 11:394617-394639 AGGCCTGGTGAGTCAGGAGCCGG - Intronic
1077069209 11:660353-660375 GGGCTTTCTGGGGCAGGGGCGGG - Intronic
1077093312 11:789156-789178 GGGCGGGGAGGGGCAGGAGCTGG + Intronic
1077144786 11:1040031-1040053 GGGCCCAGCGGGGCAGGGGCAGG - Intergenic
1077180141 11:1208581-1208603 GGGCCAGGTGGGGCAGGAGCCGG + Intergenic
1077431225 11:2516941-2516963 GGCCCTAGAGGGACAGGTGCTGG - Intronic
1077474243 11:2778903-2778925 AGGACGGGTGGGGCAGGAGCAGG - Intronic
1078017787 11:7630078-7630100 GGGCATAGTGGTGCATGTGCCGG + Intronic
1078059102 11:8032005-8032027 GGGGCTGGAGGGGCAGCAGCTGG + Intronic
1081323340 11:41717146-41717168 GGGATGAGTGGGGCAGGAGAGGG - Intergenic
1081774717 11:45669425-45669447 GGACCTGGTGGGGCAGGAAAGGG - Intergenic
1083193892 11:61071614-61071636 GGGCCTTGTGGGGATGGAGCCGG + Intergenic
1083419945 11:62546885-62546907 GGGCCGGGCGGGGCCGGAGCGGG + Intronic
1083663021 11:64260543-64260565 GGGCCAGGGGGTGCAGGAGCGGG + Intronic
1083888349 11:65583682-65583704 GTGGCCAGTGGGGCAGGGGCTGG + Exonic
1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG + Exonic
1083955739 11:65982008-65982030 GGCCCTGGGAGGGCAGGAGCTGG - Intergenic
1084033107 11:66492547-66492569 GGCCCTACTGGGTCAGGACCTGG - Intronic
1084150158 11:67284384-67284406 GGGCCTGGTGCCGCAGCAGCCGG - Intronic
1084607336 11:70180116-70180138 GGGCCCTGTGGAGAAGGAGCTGG + Intronic
1085056300 11:73406085-73406107 GGGCATTGTGGGGAAGGAGAGGG - Exonic
1085125520 11:73999585-73999607 GGGTCTGGAGGGGTAGGAGCAGG + Intergenic
1085519522 11:77129955-77129977 GGGCCTAGCGGGGCGGGCCCGGG + Intronic
1086753539 11:90529738-90529760 GGCCACAGTGGGGCAGGGGCAGG - Intergenic
1087990655 11:104743093-104743115 TGGCTTAGTGGGGCAGGGGTGGG + Intergenic
1088829570 11:113523894-113523916 AGGCCAAGGCGGGCAGGAGCTGG - Intergenic
1089461800 11:118658242-118658264 AGGTTTAATGGGGCAGGAGCTGG + Exonic
1089646878 11:119886337-119886359 GGGCCTGGAGGGGCAAGAGAAGG - Intergenic
1090561516 11:127937954-127937976 GATCCTAATGGGGAAGGAGCTGG - Intergenic
1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG + Intronic
1091066143 11:132514989-132515011 GGGCTAAGTGGAGCAGGAGGAGG + Intronic
1091558450 12:1593616-1593638 GGGCCTGGAGGTGCTGGAGCTGG - Exonic
1091797437 12:3305392-3305414 GGGCTCCGTGGGGCAGGGGCAGG - Intergenic
1091872742 12:3908480-3908502 TGGGCTAGTGGGGAAGGAGATGG - Intergenic
1092145682 12:6212938-6212960 GGGGGGAGTGGGCCAGGAGCGGG + Intronic
1092160290 12:6312044-6312066 GGGTATAGTGGGGGAGGAGAGGG - Intronic
1092209226 12:6635612-6635634 GGGCCTAGAGGGGGAGGGGGAGG + Intronic
1092296984 12:7208611-7208633 GGGGCTGGTGGGGCAGGACTGGG + Exonic
1094692069 12:32779406-32779428 GTAGCTAGTCGGGCAGGAGCAGG + Intergenic
1095130062 12:38530502-38530524 GGGGCGAGTGGGGCATAAGCTGG - Intergenic
1095712431 12:45305036-45305058 CTGCAAAGTGGGGCAGGAGCTGG - Intronic
1097107777 12:56635368-56635390 AGGCCTAGGGGTGCAGGAGAGGG + Intronic
1099885084 12:88519237-88519259 GGGACTAGTGTGACAGGAGGAGG + Intronic
1100478021 12:94952032-94952054 TGGCCTAATGTGGCAGGGGCAGG - Intronic
1101649998 12:106668648-106668670 GGGTTTAGTGGGGAAGGAGTAGG + Intronic
1102458829 12:113087655-113087677 GGGCCAAGTGGGTGAGGAGGGGG - Intronic
1102625611 12:114233168-114233190 GGGCCTAGCAGGGAGGGAGCAGG - Intergenic
1103029235 12:117599269-117599291 GGGCCAAGAGGGGCAGTTGCAGG - Intronic
1103995143 12:124824784-124824806 GGCCCTAGCCTGGCAGGAGCTGG - Intronic
1104064432 12:125295366-125295388 CAGCCTGTTGGGGCAGGAGCTGG + Intronic
1104362226 12:128144607-128144629 TGTCCTTGTAGGGCAGGAGCAGG - Intergenic
1104692853 12:130839355-130839377 GGGCCTAGGCGGGGAGGGGCGGG + Intergenic
1104993800 12:132641888-132641910 GGGGCTGGTGGTGCTGGAGCTGG - Intronic
1106787972 13:33126042-33126064 GGGGGTGGTGGGGCAGCAGCGGG + Intronic
1107314252 13:39114149-39114171 GGGCCTATTGGGGGAGGGGAGGG - Intergenic
1107548765 13:41457025-41457047 GGGGCGAGAGGGGCAGGAGTTGG - Intergenic
1107851680 13:44577476-44577498 GGGTCTGGCGGGGCAGGAGGCGG + Intergenic
1108567846 13:51718937-51718959 GGCACAAGTGGGGCAGGAGGGGG + Intronic
1110368918 13:74718715-74718737 GGGCGTGGTGGGGCAGGGGGTGG - Intergenic
1113456118 13:110450208-110450230 GGGCCCACTGGGGCACTAGCGGG - Intronic
1114182860 14:20380353-20380375 CTGCCTGCTGGGGCAGGAGCCGG + Exonic
1114664352 14:24369213-24369235 GGGTCCAGAGGGGCTGGAGCTGG - Intronic
1118849303 14:69572296-69572318 GGGCCTCCTGCGGCGGGAGCGGG - Exonic
1119434185 14:74587134-74587156 GGTCCTGGTGGGGGAGGGGCCGG - Intronic
1120115143 14:80607665-80607687 AGGTCTAGTATGGCAGGAGCAGG + Intronic
1121106570 14:91283669-91283691 GGGCCTGGCGGGGCAGGTGGGGG + Intronic
1121423946 14:93834927-93834949 GAGCCTGCAGGGGCAGGAGCAGG + Intergenic
1121605802 14:95238842-95238864 GGGCATGGTGGGGCAGGACATGG - Intronic
1121742534 14:96264252-96264274 AGGCCTCATGGGGGAGGAGCAGG - Exonic
1121836919 14:97100622-97100644 GGTCCTAGTGAGGTAGGAGGTGG - Intergenic
1122891752 14:104735251-104735273 GTGCCTGGTGGGGCAGGTGGAGG - Intronic
1122902943 14:104789262-104789284 GGACCAAGTGGGTCAGGAGAGGG - Intronic
1122925677 14:104898355-104898377 GGGCCACTTGGGCCAGGAGCTGG - Intergenic
1123684289 15:22786539-22786561 GGGACGGGTGGGGGAGGAGCAGG - Intronic
1124745964 15:32342560-32342582 CGGCCTCGCGGGGCAGGAGGAGG - Intergenic
1125461418 15:39910444-39910466 GGGCCTGGTGGGGCTGAGGCAGG + Intronic
1125593579 15:40870730-40870752 GGCCCTGGTGGGGCAGGAAGTGG + Intergenic
1125599850 15:40909488-40909510 GGGCCTTGTGAGGGATGAGCTGG - Intergenic
1125742055 15:41972216-41972238 GGGCGGAGCGGGGCGGGAGCCGG + Intronic
1126952245 15:53893959-53893981 GGCCCTGGTGGGGCAGGCACTGG + Intergenic
1127371364 15:58344920-58344942 GGCATGAGTGGGGCAGGAGCAGG + Intronic
1127828449 15:62727236-62727258 GGGTGTAGTGGGGGAGGAGGAGG + Intronic
1128506899 15:68278788-68278810 GGCATTAGTGGGGCAGGAGGTGG - Intronic
1128551700 15:68601750-68601772 GGGCTTAGTGGTGCTGGGGCAGG + Intronic
1128943936 15:71809073-71809095 GGGCCTGGGGGTGGAGGAGCAGG + Intronic
1129152390 15:73697132-73697154 GGCCCTTGTGGGGCAGGATGTGG + Intronic
1129322324 15:74782185-74782207 GGCGCGGGTGGGGCAGGAGCGGG - Exonic
1129367998 15:75068785-75068807 GGGCCCAGTGAGGCAGGGACTGG + Intronic
1130369845 15:83275838-83275860 GGACCTTGTGGGGCAGGTGAAGG + Intronic
1131172917 15:90191178-90191200 GGGCCTGTTGGGGCCTGAGCTGG - Intronic
1132004395 15:98213520-98213542 GGGCGTACTGGGGCTGAAGCTGG - Intergenic
1132067680 15:98745543-98745565 GGCCCTGGTAGGGCAGGAACAGG + Intronic
1132462997 16:64637-64659 GGGGCTGGTGGGGCAGAGGCAGG - Intronic
1132670581 16:1100766-1100788 GGGCCTAGAGGTGCAGGGGGAGG + Intergenic
1132747576 16:1443371-1443393 GGGGCCAGTGGTGCCGGAGCTGG - Intronic
1132969161 16:2676884-2676906 GGGCCTTGTGGGCCAGAAGAAGG - Intergenic
1133044022 16:3076180-3076202 GGGGGCAGTGGGGCAGGGGCAGG - Intronic
1133287783 16:4698551-4698573 GGGCCAGGTGTGTCAGGAGCAGG - Exonic
1133411524 16:5573027-5573049 GGGCCATATGGGGCAGGGGCAGG + Intergenic
1134742448 16:16559998-16560020 GGCCCTCGTGGTGCAGGAGAAGG + Intergenic
1134911956 16:18035464-18035486 GGGCATAGTGGTGCATTAGCTGG + Intergenic
1134925115 16:18152461-18152483 GGCCCTCGTGGTGCAGGAGAAGG - Intergenic
1135200916 16:20436978-20437000 GGGGCTACTGGGGCAGTAACTGG + Intronic
1135218199 16:20590889-20590911 GGGGCTACTGGGGCAGTAACTGG - Intergenic
1136033314 16:27519228-27519250 GGGCCTACTGGGGAAGGGGAGGG + Intronic
1136070249 16:27783103-27783125 GGGCCCAGTGGGCGTGGAGCTGG + Intergenic
1136737064 16:32475079-32475101 GGGCCTTGTGGGCTAGGTGCCGG + Intergenic
1137603973 16:49775010-49775032 GGGGCTGGTGGGGCAGCTGCTGG - Intronic
1139300771 16:65943532-65943554 GGGGCCAGTGGGGCAGCAACAGG - Intergenic
1139518100 16:67463803-67463825 GGGCCTTGTGGGACAGGTGCGGG + Intronic
1139548686 16:67661655-67661677 GCGCCTACTGGTGCAGAAGCGGG + Exonic
1139603555 16:68001597-68001619 GGGCCCTGGGGTGCAGGAGCTGG + Intronic
1140663398 16:77208911-77208933 GGGCATAGAGGGGGAGAAGCTGG + Intronic
1140699566 16:77568827-77568849 GAGTCCAGTGGGGCAGGGGCAGG - Intergenic
1141266520 16:82502727-82502749 GGGCCTGGTGGGCCAAGAGCAGG + Intergenic
1141714238 16:85717575-85717597 GGGCCTAGGGGGTCCTGAGCTGG + Intronic
1142015829 16:87746720-87746742 GGGAGTGGTGGGGCAGGAACAGG - Intronic
1142142901 16:88480446-88480468 GGTGCTGGTGGGGGAGGAGCGGG + Intronic
1142154828 16:88528180-88528202 CGGCCTGCTGGGGCAGGAGCTGG - Exonic
1203016007 16_KI270728v1_random:354498-354520 GGGCCTTGTGGGCTAGGTGCCGG - Intergenic
1203034342 16_KI270728v1_random:627656-627678 GGGCCTTGTGGGCTAGGTGCCGG - Intergenic
1142596748 17:1033516-1033538 TGCCCTAGTGTGGCAGGATCTGG + Intronic
1142608573 17:1095818-1095840 AGGCCTTCTGGGGCAGGAGGTGG - Intronic
1142953379 17:3503057-3503079 GGCCCTGGTGGGGCTGGAGAGGG - Exonic
1143089344 17:4439804-4439826 GGACCCAGTGGGGCTGGAGCTGG - Intronic
1143465325 17:7132674-7132696 GGGACCAGCTGGGCAGGAGCAGG - Intergenic
1143625907 17:8110051-8110073 GGGCCCAGCGGGGCAGGGGCCGG - Intronic
1143628547 17:8124190-8124212 GGTCCTAGAGGGGCAGAATCTGG - Intergenic
1143771323 17:9170808-9170830 CGACACAGTGGGGCAGGAGCAGG - Intronic
1145163219 17:20589481-20589503 GGGCCAAGAGGGGGAAGAGCGGG - Intergenic
1145218898 17:21072748-21072770 GGGCTGAGTGGGACAGGAGCTGG - Intergenic
1145959664 17:28880023-28880045 AGACCTAGAGGGGCAGCAGCAGG + Exonic
1146404839 17:32528196-32528218 TGGCCCAGTGGGGCAGAAGAGGG - Intronic
1146576826 17:34001444-34001466 GGGTCCAGTGGGGCTGGTGCTGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147657370 17:42098494-42098516 GGGCCCGGCGGGGCAGGGGCGGG + Intergenic
1147705638 17:42423121-42423143 CGGCCGGGTGGGGCTGGAGCTGG + Exonic
1148773271 17:50079078-50079100 GGGCCCAATGGGGGAGGGGCTGG + Exonic
1148796763 17:50200826-50200848 ACGCTTACTGGGGCAGGAGCCGG - Intronic
1149565356 17:57637149-57637171 GGGCCAGGTGGCGCAGGAGTGGG - Intronic
1149604416 17:57914738-57914760 AGGCCAGGTGGGGCAGGTGCAGG - Intronic
1151432181 17:74071073-74071095 GGGCCTAGGGAGGCAGGAGGAGG - Intergenic
1151757990 17:76085594-76085616 GAGCCCAGGGGGGCAGGGGCTGG + Intronic
1152069987 17:78129589-78129611 GGGCCCAGGAGGGCAGGAGAGGG + Intronic
1152689184 17:81710219-81710241 GGGCCCAGCGGGTAAGGAGCAGG - Intergenic
1152693635 17:81733205-81733227 GGGCCACGAGGGGCAGGAGGAGG - Intergenic
1152756740 17:82090197-82090219 GGGGCCAGTGGGGCAGCTGCAGG + Intronic
1153376645 18:4388047-4388069 GTGCCTAGTGGGGAAGAATCGGG + Intronic
1155056920 18:22193056-22193078 GGGCAGAGTGGGGGAGCAGCCGG + Intronic
1156536750 18:37871785-37871807 GGGGCCAGTGGGGCTGGAGGAGG + Intergenic
1157335376 18:46733799-46733821 GGGCCAAGTGAGCCAGGGGCAGG + Intronic
1157479035 18:48040978-48041000 GCTCCTGGTGGTGCAGGAGCAGG - Exonic
1158146505 18:54320235-54320257 GGGCACAGTGGGGGAGAAGCTGG - Intronic
1158878319 18:61753163-61753185 GAGCCTGGTGGTGCAGGTGCAGG + Intergenic
1160080761 18:75725221-75725243 GGGCCCTGTGGGGCGGGGGCGGG - Intergenic
1160605371 18:80045903-80045925 GGGCCTGGTGTGGCAGGGGCAGG + Exonic
1160780919 19:877710-877732 GGGGCACGTGGGGCAGGGGCTGG - Intronic
1160833147 19:1112596-1112618 GGGCCTAGTGGGTGAGGAGGTGG - Intronic
1160950677 19:1665783-1665805 AGGCCTGATGGAGCAGGAGCTGG - Intergenic
1160981531 19:1818664-1818686 CGGCCTAGGTGGGCAGGTGCGGG - Intronic
1161221530 19:3120282-3120304 GGGCCACGTGCGGCTGGAGCAGG - Intronic
1161361999 19:3855693-3855715 GGGCCTGGTGGGTGAGGAGGAGG + Intronic
1161543802 19:4867786-4867808 GGGCCTAGTGGAGGCGGGGCAGG - Intergenic
1161696437 19:5771209-5771231 GGGGCCAGTGGGGCTGGGGCAGG - Intronic
1161720389 19:5899016-5899038 GGGGCTGCTGGGCCAGGAGCAGG - Intronic
1161983761 19:7643384-7643406 GGACCTGGTGGGGAAGGAGTGGG + Intronic
1162137645 19:8565605-8565627 GGGCCTAGTGGGGCAGGAGCAGG + Intronic
1162480249 19:10923439-10923461 GGGGCTAGGGGGGCATGGGCTGG - Intronic
1162566435 19:11447677-11447699 GGGCCTCCTGGGGCAGGGGCAGG - Exonic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1163111032 19:15161080-15161102 GGGCCTGGAGGGGCAGGTGGGGG + Exonic
1163440261 19:17319208-17319230 GGGCTTAGTGGGGCAGGTCCTGG + Intronic
1163617940 19:18340785-18340807 GGGCCGAGAGGGGCAGGTGCTGG + Intronic
1164557956 19:29268209-29268231 GGGGCTTGAGGGACAGGAGCCGG + Intergenic
1164623928 19:29714685-29714707 GTGGCTGGTGGGGCAGGGGCGGG - Intronic
1164672768 19:30082361-30082383 GGGCCACGTGGGGCAGCACCAGG + Intergenic
1164761484 19:30731655-30731677 GGCCCAAGCGGGGCAGGAGGAGG + Intergenic
1165327875 19:35124812-35124834 GGGACCAGCGGGGTAGGAGCGGG + Exonic
1165370462 19:35402474-35402496 GGGCCTGTAGGGGCAGCAGCTGG + Intergenic
1165408675 19:35645160-35645182 GGGCCTAAGGGGGCGGGACCGGG - Intergenic
1165432522 19:35780841-35780863 GGGCCTGGTGGGGTAGGGGCTGG - Intronic
1165463809 19:35960109-35960131 TGGCCTAGGGGCGCAGGTGCAGG + Intergenic
1165845061 19:38812811-38812833 GGGCGGAGTGGGGCCTGAGCTGG + Intronic
1166098146 19:40554450-40554472 GGGCCTGGGGGCGCTGGAGCCGG + Intronic
1166112380 19:40630570-40630592 GGAACAAGTGGGGCAAGAGCAGG + Intergenic
1166226575 19:41399404-41399426 TGGGCAAGTGGGGCAGGAGGTGG + Intronic
1166695793 19:44850986-44851008 GGGTCTAGGGGAGGAGGAGCTGG - Intronic
1166789770 19:45391935-45391957 GGAGCTGGTGGGGCAGGAGCAGG + Exonic
1166830119 19:45634247-45634269 AGGCATAGAGGGGCAGGGGCTGG + Intronic
1167103270 19:47416938-47416960 GGGCCAAGAGGGGGAAGAGCGGG + Exonic
1167428479 19:49441584-49441606 GGGCCTGGTGGGGCCGGGGCGGG - Intronic
1167565961 19:50257303-50257325 GGGCATCGTGGGGCTGGAACAGG + Exonic
1168094457 19:54106793-54106815 GGGCACTGTGGGGCAGGAGGTGG - Exonic
1202648688 1_KI270706v1_random:161968-161990 GGGCGTGGTGGGAGAGGAGCTGG + Intergenic
925068759 2:950602-950624 GGGGCTGGCGGGGCAGGGGCCGG - Intergenic
926515051 2:13832967-13832989 GGGCCTGCTGGGGCAGGGGTGGG + Intergenic
926797288 2:16629306-16629328 GGGCCTAGTGGGGAAGGAGGTGG + Intronic
927148084 2:20179944-20179966 TGGCCCAGTGGGGCAGGGCCAGG + Intergenic
927476065 2:23415023-23415045 GGGCCTTGTGGGGCCTGATCTGG - Intronic
927636247 2:24819522-24819544 GGGCTTGGTGGGGCAGGACATGG - Exonic
928409449 2:31043251-31043273 GGGAATACTGAGGCAGGAGCAGG - Intronic
930834811 2:55782163-55782185 GTGGTTAGTGGGGCAGGCGCTGG + Intergenic
931025275 2:58106512-58106534 GGTCCTAATGGGGCAGTAGATGG + Intronic
931197210 2:60064182-60064204 GAGGCTCCTGGGGCAGGAGCTGG + Intergenic
932207135 2:69893195-69893217 GGGCCTGTAGGGGGAGGAGCTGG + Intergenic
932544060 2:72688521-72688543 AGGACTACTGGGGCAGGGGCAGG + Intronic
933274937 2:80273633-80273655 GGGGCCAGTGTGGCAGGAGAAGG - Intronic
933876484 2:86625223-86625245 CGGGCTAGTGGGGGAGGAGTTGG + Intronic
936084580 2:109458044-109458066 AGGCCATGTGGTGCAGGAGCCGG + Intronic
936094934 2:109524136-109524158 GGGCCTAGTGGCGCAAGAGCAGG + Intergenic
936655973 2:114488218-114488240 TGGCCTAGTGGGGAAGCAACGGG + Intronic
937317527 2:120941475-120941497 GAGCCGAGGGTGGCAGGAGCTGG + Intronic
937856454 2:126675115-126675137 GGGCCTGGTAGGGCTGCAGCAGG - Intronic
938266050 2:129929074-129929096 GGCCCTTGAGAGGCAGGAGCAGG + Intergenic
939459719 2:142484262-142484284 GGGCTTATTAGGGCAGCAGCTGG - Intergenic
945312801 2:208334457-208334479 GAGGCCAGTGGGGCAGCAGCAGG - Intronic
946478287 2:220029957-220029979 GGGCCTGCTGAGGGAGGAGCGGG + Intergenic
947002914 2:225477902-225477924 TGGCCTAGTGGAGGAGGAGGAGG + Intronic
947544287 2:231000393-231000415 GGGGCAAGTGGCACAGGAGCAGG - Exonic
947740201 2:232481452-232481474 AGGCCTGGTGGGGCACGGGCCGG - Intronic
947749547 2:232525305-232525327 CGGCCTGGTGGGCCTGGAGCCGG + Exonic
948052958 2:234992235-234992257 GTGCCTTGGGGGGCAGGAGCTGG + Intronic
948148800 2:235728771-235728793 GTGCCTAGTGGAGCAAGAGCGGG + Intronic
948230638 2:236346629-236346651 GGAGCTAGTCGGGCATGAGCAGG + Intronic
948259119 2:236590031-236590053 GGGCCTTGTGGGGAAGGGCCGGG - Intergenic
948425843 2:237886164-237886186 GGGCAGAGTGGGGCAGTGGCTGG + Intronic
948473703 2:238203350-238203372 GGGCCTGGCCAGGCAGGAGCAGG + Intronic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
948810391 2:240472326-240472348 TGGCAGAGTGGGGCTGGAGCTGG - Intergenic
948887841 2:240892871-240892893 GGGTGTAATGGGGCTGGAGCTGG + Intronic
948917346 2:241041177-241041199 GGGGAGGGTGGGGCAGGAGCGGG + Intronic
948983128 2:241505189-241505211 GGGCCTGCTGGAGGAGGAGCAGG - Intronic
1169250381 20:4056150-4056172 GGACCTGGTGGGGCTGGAGGGGG + Intergenic
1169843958 20:9969866-9969888 TGGTCTAGTGGGGCAGGATGGGG + Intergenic
1170309340 20:14975449-14975471 GGGCCTAGTTTGGCAGCAGAGGG + Intronic
1172786046 20:37469563-37469585 GGTCCTAGGGGAGCAGGAGAAGG - Intergenic
1172836511 20:37876930-37876952 GGGCCTGGTGAGGCTGGAGAAGG + Intergenic
1172931399 20:38588697-38588719 GTGCCTAGTTTGGTAGGAGCAGG + Intergenic
1173385570 20:42584333-42584355 GAGGCCAGTGGGGCTGGAGCAGG - Intronic
1173388673 20:42611823-42611845 GAGCCTAGTGGGGCTGGATCTGG - Intronic
1173479235 20:43386106-43386128 GGGGCTAGTGAGGCCGCAGCTGG - Intergenic
1173595632 20:44257176-44257198 GGGCCTGGTGTGCGAGGAGCGGG + Exonic
1173872732 20:46351953-46351975 GGGCCCTGGGGTGCAGGAGCTGG + Intronic
1174061595 20:47836806-47836828 GGGACTAGTGGGGAGGGGGCTGG - Intergenic
1174069928 20:47892519-47892541 GGGACTAGTGGGGAGGGGGCTGG + Intergenic
1175203003 20:57290852-57290874 GGGCCAGGTGGAGCAGCAGCAGG - Intergenic
1175441212 20:58993463-58993485 GGACCTGGGGGTGCAGGAGCTGG - Exonic
1175560551 20:59925207-59925229 GTGCCTGGTGGGGCAGCAGGAGG + Intronic
1175701084 20:61137607-61137629 GGTCCTGTTGGGGAAGGAGCCGG - Intergenic
1175795448 20:61767681-61767703 GAGCCCAGTGGGGCTGAAGCAGG + Intronic
1175822518 20:61918073-61918095 GGGCCTGGGGGGGCAGCTGCAGG + Intronic
1175956433 20:62611991-62612013 CAGCCTGGTGGGGCGGGAGCTGG - Intergenic
1175957381 20:62618328-62618350 GGTCCTAGTGGGGCACAAACAGG - Intergenic
1176257191 20:64158660-64158682 GGGACCAGTGGGGCAGGTGGGGG - Intronic
1176300081 21:5095234-5095256 GGGCCAACTGCAGCAGGAGCTGG + Intergenic
1176603163 21:8810720-8810742 GGGCGTGGTGGGAGAGGAGCTGG - Intergenic
1176643191 21:9325286-9325308 GGTTCTAGAGGCGCAGGAGCAGG + Intergenic
1177239964 21:18443687-18443709 GGGACTATTGGGCCAGTAGCTGG - Intronic
1177894615 21:26844759-26844781 GGAGCTAGTGGTGCCGGAGCTGG - Exonic
1178551501 21:33543262-33543284 GGCCCTAGCGGGGCCTGAGCCGG - Intronic
1178827413 21:36028421-36028443 TGGCCAGGTGGGGCAGGGGCTGG - Intergenic
1178837804 21:36113265-36113287 GTAGCTAGTGGGGCATGAGCAGG - Intergenic
1179434433 21:41350528-41350550 TGGGCTGGTGGGGCAGGACCCGG - Intronic
1179708442 21:43195648-43195670 GGGCCTAGCAGGGCAGGAAATGG + Intergenic
1179786605 21:43733854-43733876 GGGCCTTGTGTGTCTGGAGCTGG - Intronic
1179856941 21:44166677-44166699 GGGCCAACTGCAGCAGGAGCTGG - Intergenic
1179905226 21:44419107-44419129 GGGCCTAATGGCCCAGCAGCGGG + Intronic
1179979557 21:44889023-44889045 GGCCCAAGTGGGGCAGATGCGGG + Intronic
1179987537 21:44930011-44930033 GGGCCTTGTGGGGCAGAGGCTGG - Intronic
1180002560 21:45001949-45001971 AGGCCTAAGGGGGCAGGGGCAGG - Intergenic
1180009848 21:45041942-45041964 GGCCCTAGTGGGTCAGAAGGCGG + Intergenic
1180082547 21:45493446-45493468 AGGCTTTGTGGGGAAGGAGCTGG + Intronic
1180170223 21:46054727-46054749 CGGCCATGTGGGCCAGGAGCTGG - Intergenic
1180245834 21:46546685-46546707 GGGGCTGGTGGGGCAGCATCAGG - Intronic
1180345449 22:11702277-11702299 GGGCGTGGTGGGAGAGGAGCTGG - Intergenic
1180376495 22:12098175-12098197 GGTTCTAGAGGCGCAGGAGCGGG + Intergenic
1180701636 22:17784483-17784505 GGGGCTAGAGGGGCAGGCCCTGG + Intergenic
1180998444 22:19976914-19976936 GGGGTCAGTGGGGCAGGGGCAGG + Intronic
1181435979 22:22911106-22911128 GGGCCTAGAGCTGCAGGATCAGG + Intergenic
1181756477 22:25028332-25028354 CGGCTTGGTGGGGCAGGAGGTGG + Exonic
1182585983 22:31344666-31344688 GGGCCTCGTGCTGCCGGAGCCGG + Exonic
1183341676 22:37284990-37285012 GGGGCTTGTGGGGCTGGGGCGGG + Intronic
1183467098 22:37985290-37985312 GAGCCCAGTGTGGAAGGAGCTGG - Intronic
1183601720 22:38843937-38843959 GGGCCGAGCGGGGCAGGCGCGGG + Exonic
1184160144 22:42692914-42692936 GTGCGTCGTGGGGCAGTAGCGGG + Exonic
1184388719 22:44190854-44190876 GGGTCTAGTGGGGCTGGCGGAGG + Intronic
1184674734 22:46035700-46035722 GGGCCTGGCGGGGCTGGGGCGGG - Intergenic
1184730109 22:46367145-46367167 GTGCCTAGGGAGGCAGCAGCAGG - Intronic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1185046673 22:48531868-48531890 GGGCCTGGCAGGGCAGGAGAGGG + Intronic
1185055572 22:48576871-48576893 GAGCCCAGTGGGGCAGGGGATGG - Intronic
1185093051 22:48786594-48786616 GTCCGTAGTGAGGCAGGAGCAGG - Intronic
1185108329 22:48886688-48886710 GGAGCTAGTGCAGCAGGAGCCGG + Intergenic
1185370908 22:50460465-50460487 GGGCCTAGGAGGGTTGGAGCGGG + Intronic
1185388482 22:50547163-50547185 GGGCCAAGGGTGGCTGGAGCAGG + Intergenic
949831941 3:8224110-8224132 GGGCCTAAGGGGACAGGAGTGGG - Intergenic
950132056 3:10554006-10554028 GGGTCTAGTGGGGCGGGGGTGGG + Intronic
950465488 3:13150928-13150950 TGGCCTGGTGGGGCAGGGCCAGG + Intergenic
950611903 3:14132352-14132374 GCGCCTTGGAGGGCAGGAGCTGG + Intronic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
951569242 3:24044641-24044663 GGGCATCCTGGAGCAGGAGCAGG + Intergenic
952315612 3:32229713-32229735 GAGGCTGGTGGGGAAGGAGCAGG - Intergenic
953037280 3:39224113-39224135 GGGCCTTGTGGGGCATTAGGAGG - Intergenic
953464369 3:43105933-43105955 GGGCCTCCTGGGCCAGAAGCTGG - Exonic
953876187 3:46668101-46668123 GGACCTAGTGGGACTGGAGGAGG + Intergenic
953876581 3:46670181-46670203 GGACCAAGAGAGGCAGGAGCTGG - Exonic
954292404 3:49656532-49656554 CCAGCTAGTGGGGCAGGAGCTGG - Exonic
955634336 3:61009574-61009596 GGGAGCAGTGGGGCAGGAGTAGG - Intronic
956332726 3:68129113-68129135 AGGGCGAGTGGGGCAGGAGGGGG + Intronic
956390007 3:68761761-68761783 GGGATTACTGTGGCAGGAGCTGG - Intronic
957096889 3:75785299-75785321 GGTTCTAGAGGCGCAGGAGCGGG - Intronic
958622264 3:96576394-96576416 GGGCCCAGTGGGGTAGGCACCGG + Intergenic
963258520 3:143170167-143170189 GGACCTCGTGGGTCAGCAGCAGG - Intergenic
963774401 3:149423330-149423352 GGGAGTAGGGGGGCAGGGGCAGG + Intergenic
965066092 3:163850625-163850647 GGGACTTGTGGGGCAGGGGGTGG + Intergenic
965648350 3:170908364-170908386 GGCCCTAGTGGGGCCGGGCCGGG - Intronic
965977309 3:174641036-174641058 GGGGCTGGTGGGGCCAGAGCAGG + Intronic
966739751 3:183221617-183221639 GGGCCCAGTGAGGCATGAGCAGG - Intronic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
966940169 3:184741134-184741156 GGGCATGGAGTGGCAGGAGCTGG - Intergenic
1202743693 3_GL000221v1_random:79743-79765 GGTTCTAGAGGCGCAGGAGCAGG - Intergenic
968473724 4:793288-793310 GGCCCTGCTGGGGCAGGAGCTGG + Intronic
968477722 4:820297-820319 TGGCCCAATGGGGCAGGAACTGG + Intronic
968647988 4:1749417-1749439 GGGCATAGTGGGGAAGGGGGAGG - Intergenic
968695932 4:2026672-2026694 GGGCCTGCTGGGGGAGGAGAGGG - Intronic
968699382 4:2047418-2047440 GGGGCAACTGGGGCAGGGGCAGG + Intergenic
968840956 4:3005454-3005476 GAGCATAGTGGGGCTGGGGCTGG + Intronic
968956807 4:3723622-3723644 TGGTCAAGAGGGGCAGGAGCTGG + Intergenic
968969859 4:3788164-3788186 GGGGCAGGAGGGGCAGGAGCTGG - Intergenic
969090552 4:4690851-4690873 GGGACTGGTGGGGCATCAGCTGG + Intergenic
969675075 4:8610114-8610136 GGGCTTCCTGGGGCAGGAGCTGG + Intronic
972395438 4:38655331-38655353 GAGTCTAGCGGGGCAGGAGGTGG - Intergenic
973375816 4:49285953-49285975 GGGCGTGGTGGGGGAGTAGCTGG + Intergenic
973376716 4:49291972-49291994 GGGCGTGGTGGGGGAGTAGCTGG + Intergenic
973380505 4:49317243-49317265 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
973381594 4:49324288-49324310 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
973386114 4:49515360-49515382 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
975212910 4:71722109-71722131 GGGCCTCCTGAGGAAGGAGCAGG - Intergenic
976035883 4:80820525-80820547 GAGCGTAGTGGGGCAGGGGAGGG + Intronic
976390465 4:84499589-84499611 GGGCCAGGAGGGGCGGGAGCTGG + Intergenic
979308373 4:119174114-119174136 GGGCGCAGTGGAGCAGGAGGTGG - Intronic
979670028 4:123352056-123352078 GGGACGGGTGGGGCTGGAGCAGG - Intergenic
980851605 4:138389040-138389062 GGGCCTATTGGGGGAGGATGGGG - Intergenic
1202758095 4_GL000008v2_random:83608-83630 GGTTCTAGAGGCGCAGGAGCGGG + Intergenic
985750509 5:1671365-1671387 GAGCCTGTTTGGGCAGGAGCTGG - Intergenic
986263988 5:6176794-6176816 GGGAGGGGTGGGGCAGGAGCAGG - Intergenic
986593598 5:9396774-9396796 GGGCCACGTGGGGAAGGACCAGG - Intronic
987474038 5:18368876-18368898 GGGCCCAGTGTGGCTGCAGCAGG + Intergenic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
991088186 5:62667646-62667668 GGTCCTGGTGGGGCCAGAGCTGG + Intergenic
991963238 5:72066099-72066121 ATGCCTAGTGGGGGAGGGGCTGG + Intergenic
993068258 5:83127656-83127678 GGGCCTAATGGTGCATGATCAGG + Intronic
993727789 5:91388370-91388392 GGGACTACTGGAGCAGGAGTAGG - Intergenic
996315753 5:122158866-122158888 GGGACTAGAGGGGAAGAAGCTGG + Intronic
997949420 5:138230418-138230440 GGGCCTTCAGAGGCAGGAGCTGG - Intergenic
998136764 5:139678150-139678172 GAGCTTAGTTGGGCAGGAGCTGG + Intronic
998411492 5:141914620-141914642 GGGCCTAAAGGGGCAGGCGTTGG + Intergenic
999520786 5:152348782-152348804 GGGCATAGAGGGGCAGGGTCAGG + Intergenic
999531813 5:152471598-152471620 GAGCCAAGTGGGGTGGGAGCGGG + Intergenic
1000889280 5:166784573-166784595 GGGCGCCGTGGGGCAGGAGGCGG + Intergenic
1000911676 5:167030442-167030464 GGGGGTAACGGGGCAGGAGCAGG - Intergenic
1001455747 5:171858556-171858578 GGGCTTAGTGTGGAGGGAGCTGG - Intergenic
1001719057 5:173841526-173841548 GAGAGAAGTGGGGCAGGAGCCGG - Intergenic
1002029464 5:176416985-176417007 CGGCCTAGTGGGAAAGGACCTGG - Intergenic
1002315572 5:178341106-178341128 AGACCTAGTGGGGCAGGCACTGG - Intronic
1002460928 5:179373473-179373495 GAGCCTAGAGGGGAAGAAGCTGG + Intergenic
1002522853 5:179800984-179801006 AGGCCTTTTGGGGCAGCAGCAGG - Intronic
1003688026 6:8323717-8323739 AGGCCCAGTGTGGCAGGAGAAGG - Intergenic
1005258124 6:24026568-24026590 GGGCCTGGTTGGGGAGGAACAGG + Intergenic
1005826067 6:29632585-29632607 GGGCCGAGGGAGGCAGGAGGAGG - Intronic
1006075298 6:31528871-31528893 GGGCAGAGTGGGGCAGGGGCAGG + Exonic
1006475410 6:34249439-34249461 AGGCCGAGTGGGCCCGGAGCAGG - Exonic
1010167016 6:72927134-72927156 GGGCCCACTGGGGCATGAGGGGG + Intronic
1011337335 6:86275813-86275835 GGGGCTAGTGGGGGTGGGGCTGG + Intergenic
1014125074 6:117768178-117768200 GGCCCAAGTGGGTAAGGAGCAGG - Intergenic
1014826517 6:126053668-126053690 GGGCCATGTGGGGAAGGACCAGG - Intergenic
1016454888 6:144220567-144220589 GGGCCAAATGGGGAAGGAGTGGG + Intergenic
1017052150 6:150403395-150403417 GGGCTGAGTGGGGCAGGAGAAGG - Exonic
1018736351 6:166689631-166689653 GGACCTAGTGGGACAGGTGTGGG + Intronic
1018928244 6:168222043-168222065 GGCCCTAGAGGGGCAGCATCGGG - Intergenic
1018986062 6:168638056-168638078 GGGCAGGGTGGGGCAGGGGCAGG - Intronic
1019294670 7:267389-267411 GGTCCTGGGGAGGCAGGAGCAGG - Intergenic
1019418200 7:936940-936962 AGGCCCAGTGGGGCTGGGGCTGG + Intronic
1019517712 7:1447088-1447110 GCCCCTAATGGGGCAGGAGGAGG - Intronic
1019605323 7:1907220-1907242 GGTCCAGGTCGGGCAGGAGCTGG - Intronic
1019648276 7:2142460-2142482 GGGCAGAGGGGGACAGGAGCAGG + Intronic
1019713276 7:2526976-2526998 GGGCCTCGTGGAGCTGCAGCAGG + Intronic
1022171296 7:27834587-27834609 GAGCCTACTGGGGCAGGAAAGGG + Intronic
1022465953 7:30653364-30653386 GGCTCTCGTGGGGCAGGAGATGG - Exonic
1023512576 7:40969006-40969028 GGGCCGGCTGGAGCAGGAGCTGG - Intergenic
1023873377 7:44274510-44274532 GGGACGACTTGGGCAGGAGCGGG - Intronic
1024671800 7:51602505-51602527 GTGGCTGTTGGGGCAGGAGCAGG - Intergenic
1025912962 7:65842107-65842129 GGCCATTGTGAGGCAGGAGCTGG - Intergenic
1026045726 7:66904275-66904297 GGCCCGCGTGAGGCAGGAGCCGG - Intergenic
1026574454 7:71560569-71560591 GGTCCTAGTGGCGCAGGCACAGG + Intronic
1026727582 7:72881475-72881497 AGACCTAGAGGGGCAGAAGCAGG - Intronic
1027116259 7:75484253-75484275 AGACCTAGAGGGGCAGAAGCAGG + Intronic
1027121555 7:75525960-75525982 AGACCTAGAGGGGCAGAAGCAGG + Intergenic
1027173505 7:75889056-75889078 GGGCCCAGTGGGTCAGGAATGGG + Intergenic
1027219106 7:76202543-76202565 GCCCCTAGGGAGGCAGGAGCTGG + Intronic
1027270321 7:76515269-76515291 GGGCCTGTGGGTGCAGGAGCTGG - Exonic
1027275569 7:76551445-76551467 AGACCTAGAGGGGCAGAAGCAGG - Intergenic
1029485653 7:100838398-100838420 GGCCCTAGTGGGGCACGCGCAGG + Intronic
1029721275 7:102365999-102366021 AGACCTAGAGGGGCAGAAGCAGG - Exonic
1029816922 7:103106267-103106289 GGCCCTGGTGGGGCAGGCACCGG - Intronic
1031528539 7:122850244-122850266 GCCCCCAGTGGAGCAGGAGCTGG - Intronic
1032068362 7:128789695-128789717 GCGCCTAGTGGGGCAGGGATGGG + Intergenic
1032187827 7:129742538-129742560 AGGCCTGGTGGGGGAGGGGCTGG + Intronic
1034356883 7:150457937-150457959 GGGCCTGTTGGGGAAGGAGCAGG - Intronic
1034424469 7:151007322-151007344 GGGCAGAGTGAGGCAGGAGGAGG - Intronic
1035043771 7:155950883-155950905 GGTCCTTGTGGGGAAGGAGCTGG + Intergenic
1035553097 8:544911-544933 GGGCCTGGTGGGGAGGGGGCGGG - Intronic
1035724035 8:1813744-1813766 GGGCCCGGTGGGGGAGGAGTGGG - Intergenic
1036528281 8:9556027-9556049 GGGCTGAGTGGGGGAGGAGGTGG - Exonic
1037715055 8:21390707-21390729 GGGCATGGTGGTGCAGGAGGTGG - Intergenic
1038165376 8:25080699-25080721 GGGCCAGGTGGGGCAGGGGAGGG + Intergenic
1038484975 8:27928575-27928597 TGGCAAAGTGGGGCAAGAGCTGG - Intronic
1039874990 8:41577985-41578007 GGGCGGGGCGGGGCAGGAGCAGG - Intronic
1040310468 8:46234197-46234219 GGGGATGTTGGGGCAGGAGCGGG + Intergenic
1041594536 8:59633064-59633086 AATCCTAGTGGGGCAGGAGGAGG - Intergenic
1042386001 8:68175287-68175309 GGGGATTGAGGGGCAGGAGCTGG + Intronic
1042487896 8:69366887-69366909 AGGGCTGGTGGGGCAAGAGCTGG - Intergenic
1044887887 8:96798893-96798915 GGGCCTAGTGCTACAGGAGATGG - Intronic
1045521059 8:102903765-102903787 GGGCCTGGAGGGGCATGATCAGG + Intronic
1049043043 8:140126796-140126818 GGGCCTAGCGTGGCAGGTGTGGG + Intronic
1049195762 8:141314848-141314870 GAGCCTAGTGGGGCAGTGGCTGG + Intergenic
1049272031 8:141701073-141701095 GGGCCTGGGCGGGCAGGAGGGGG - Intergenic
1049463924 8:142742508-142742530 GGGCCCAGTGGGGAGGCAGCTGG + Intergenic
1049544090 8:143221512-143221534 AGGCCTGGAGGGGCAGGAGCAGG - Intergenic
1049731662 8:144181328-144181350 GGGCCTGGTGGGGCCCGGGCAGG + Intronic
1049779630 8:144423021-144423043 GGGCCTGGTGGGGAGGCAGCGGG - Intergenic
1050968776 9:11842382-11842404 GGGCCTATTGGGGGAAGATCGGG + Intergenic
1052108160 9:24545607-24545629 AGGCTGAGAGGGGCAGGAGCAGG + Exonic
1052359063 9:27534800-27534822 GGGCGTAGTAGGGTAGGAGTGGG - Intergenic
1053456111 9:38234154-38234176 AGGACAAGTGGGTCAGGAGCAGG + Intergenic
1054777040 9:69132465-69132487 GGGCCTGGTGCTGCAGGAGAAGG + Intronic
1057050498 9:91919974-91919996 GAGCCTGGTGGGGCAGGTGTGGG - Intronic
1057541474 9:95976366-95976388 AGGCCTGGAGGGGCTGGAGCAGG - Intronic
1057772220 9:97978799-97978821 GTGCCTGGTTGGACAGGAGCAGG + Intergenic
1058467699 9:105245145-105245167 GGGCCGACTGGGGAAGGGGCCGG - Intronic
1058638802 9:107063205-107063227 GGGAATAGGGAGGCAGGAGCGGG + Intergenic
1058884548 9:109313455-109313477 TGGCAGAGTGGGGCTGGAGCCGG - Intronic
1060552442 9:124492094-124492116 GGGCCTGGGAGGGCTGGAGCTGG + Intronic
1060583666 9:124772398-124772420 GGGGCGGGTGGGGCAGGAGAGGG - Intergenic
1061544796 9:131298492-131298514 GGGGCTAGTGGGGTAGGGGTGGG - Intronic
1061637319 9:131920771-131920793 GGGCCTAGTGGTGGGGGAGAGGG + Intronic
1061805630 9:133136250-133136272 GGGGCCCATGGGGCAGGAGCAGG + Intronic
1061888714 9:133606414-133606436 GTGCCAAGTGTGGCAGCAGCTGG + Intergenic
1061935478 9:133855181-133855203 GGGACTCGTGGGGCAGGACAAGG + Intronic
1061940050 9:133878989-133879011 GAGCATGGTGGGGCAGGGGCAGG + Intronic
1061974399 9:134061122-134061144 AGACCCAGAGGGGCAGGAGCAGG + Intronic
1062024271 9:134333087-134333109 GGGCCTCTTGGGGCCGGATCAGG + Intronic
1062326506 9:136015057-136015079 GGGAGTGGTGGGGCAGGAGACGG - Intronic
1062341168 9:136094620-136094642 GGCCCGAGTGGGGGAGGCGCGGG + Intronic
1062547625 9:137070742-137070764 GGCCAGAGTGGAGCAGGAGCTGG - Intergenic
1203780013 EBV:96019-96041 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780033 EBV:96073-96095 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780049 EBV:96118-96140 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780063 EBV:96154-96176 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780079 EBV:96199-96221 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780093 EBV:96235-96257 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780112 EBV:96286-96308 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780131 EBV:96337-96359 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780155 EBV:96406-96428 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780164 EBV:96430-96452 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780173 EBV:96454-96476 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780183 EBV:96481-96503 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780193 EBV:96508-96530 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780202 EBV:96532-96554 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780211 EBV:96556-96578 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203780220 EBV:96580-96602 GGGGCAGGAGGGGCAGGAGCAGG + Intergenic
1203712327 Un_KI270742v1:109707-109729 GGTTCTAGAGGCGCAGGAGCAGG - Intergenic
1203538884 Un_KI270743v1:68480-68502 GGTTCTAGAGGCGCAGGAGCGGG + Intergenic
1203548731 Un_KI270743v1:151430-151452 GGGCGTGGTGGGGGAGTAGCTGG + Intergenic
1203549686 Un_KI270743v1:156975-156997 GGGCGTGGTGGGGGAGTAGCTGG - Intergenic
1186191138 X:7068694-7068716 GTGCCTGGAGGGACAGGAGCAGG + Intronic
1188699153 X:33236816-33236838 GAGGCTAGTGGGGAAGGACCGGG + Intronic
1189321222 X:40088821-40088843 GTGCCTAGAGGGGCAAGACCTGG - Intronic
1189321966 X:40092243-40092265 GGGCGGAGTGGGGCAGGGTCCGG - Intronic
1189377136 X:40474879-40474901 GGGCCTACAGGGGCAGGAAGAGG + Intergenic
1190362915 X:49666143-49666165 TGGCCTAGTGGAGCAGCTGCGGG - Intergenic
1190641438 X:52484607-52484629 GGCCATGGTGGGGCAGGAGCAGG + Intergenic
1190646234 X:52528258-52528280 GGCCATGGTGGGGCAGGAGCAGG - Intergenic
1190732751 X:53235753-53235775 AGGACGAGTGGGGCAGGAGCTGG + Intronic
1190735055 X:53250594-53250616 GGCCCTGGTGGGGCTGGGGCTGG + Exonic
1195317449 X:103692950-103692972 GGGAGTATTGGGGCAGGAGATGG + Intergenic
1196001996 X:110795994-110796016 GGGCCAAGTGGGGAGCGAGCGGG - Intergenic
1197835151 X:130686363-130686385 GTGTCTCGTGTGGCAGGAGCAGG - Intronic
1198361280 X:135897827-135897849 GGGCCTGTTGGGGGAGGAGTTGG - Intronic
1200032385 X:153306980-153307002 GGGCCCAGGCAGGCAGGAGCCGG + Intergenic
1200115010 X:153766081-153766103 GGGGCCCATGGGGCAGGAGCAGG + Intronic
1200149497 X:153944358-153944380 GGAGCGCGTGGGGCAGGAGCTGG - Exonic
1200256481 X:154585552-154585574 GGGCCAGGTGGGGGAGGAGGCGG + Intronic
1200261288 X:154618851-154618873 GGGCCAGGTGGGGGAGGAGGCGG - Intronic