ID: 1162138023

View in Genome Browser
Species Human (GRCh38)
Location 19:8568077-8568099
Sequence GGGCCTCTAGTGCCTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 315}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162138023_1162138034 21 Left 1162138023 19:8568077-8568099 CCTGCCCCAGGCACTAGAGGCCC 0: 1
1: 0
2: 2
3: 30
4: 315
Right 1162138034 19:8568121-8568143 CACCTGTAAAATCACAGGCTGGG 0: 1
1: 0
2: 2
3: 39
4: 314
1162138023_1162138033 20 Left 1162138023 19:8568077-8568099 CCTGCCCCAGGCACTAGAGGCCC 0: 1
1: 0
2: 2
3: 30
4: 315
Right 1162138033 19:8568120-8568142 CCACCTGTAAAATCACAGGCTGG 0: 1
1: 0
2: 0
3: 21
4: 151
1162138023_1162138031 16 Left 1162138023 19:8568077-8568099 CCTGCCCCAGGCACTAGAGGCCC 0: 1
1: 0
2: 2
3: 30
4: 315
Right 1162138031 19:8568116-8568138 CCAGCCACCTGTAAAATCACAGG 0: 1
1: 0
2: 1
3: 15
4: 154
1162138023_1162138036 25 Left 1162138023 19:8568077-8568099 CCTGCCCCAGGCACTAGAGGCCC 0: 1
1: 0
2: 2
3: 30
4: 315
Right 1162138036 19:8568125-8568147 TGTAAAATCACAGGCTGGGCCGG 0: 1
1: 0
2: 7
3: 33
4: 297
1162138023_1162138037 26 Left 1162138023 19:8568077-8568099 CCTGCCCCAGGCACTAGAGGCCC 0: 1
1: 0
2: 2
3: 30
4: 315
Right 1162138037 19:8568126-8568148 GTAAAATCACAGGCTGGGCCGGG 0: 1
1: 0
2: 6
3: 70
4: 700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162138023 Original CRISPR GGGCCTCTAGTGCCTGGGGC AGG (reversed) Intronic
900096888 1:943385-943407 GGGGCCCCAGTTCCTGGGGCGGG + Intronic
900187321 1:1338481-1338503 GGGCGGATAGTGCCAGGGGCAGG - Intronic
900299757 1:1970666-1970688 GGGCCTCCAGCTCCTGGCGCCGG + Exonic
900329305 1:2126151-2126173 GGGTCTCTGGTGCCTGGTGCAGG - Intronic
900342435 1:2195267-2195289 GGGCCTCAGGGGCCTGGGCCAGG + Intronic
900593760 1:3471300-3471322 GGGCCTGTAGTGCCTGGCACAGG + Intronic
900882255 1:5390686-5390708 GGGCCTCAGGTGCTTGGGGTCGG - Intergenic
900987059 1:6079174-6079196 GGCACTCTAGGCCCTGGGGCTGG - Intronic
901151206 1:7103058-7103080 GCCCCTCTAGTGCATGGGGTGGG + Intronic
901790866 1:11653250-11653272 GGGCCTCGAGTGCCAGGCCCCGG - Intronic
902447232 1:16475138-16475160 GGGCCTCTAGAGGATGGGGTAGG - Intergenic
902507502 1:16947646-16947668 GGGCCTCTAGAGGATGGGGTAGG + Intronic
902764438 1:18605203-18605225 GGGTTTCTAGTGCCTGGGGCAGG + Intergenic
902776185 1:18676457-18676479 GGGCCTCTTGTGTCTCCGGCTGG - Intronic
903009646 1:20320553-20320575 GGGCCTCCCAGGCCTGGGGCTGG + Intronic
903263831 1:22144756-22144778 GGGCCCCTAGTGCCTGGCCTGGG + Intergenic
903330663 1:22595406-22595428 GGTCCCCGTGTGCCTGGGGCTGG + Intronic
903995097 1:27300651-27300673 TGGCCTCTACCTCCTGGGGCTGG - Intronic
904213147 1:28898793-28898815 GGGCATCTAGTGCAGGGGGTGGG - Intronic
904468909 1:30723757-30723779 GGGCCTCTGAAGCCTGGGCCAGG - Intergenic
904611964 1:31730955-31730977 GGACCACTCGGGCCTGGGGCTGG - Exonic
905033850 1:34904728-34904750 GGGCCTCCAGAGCCCGGGCCGGG + Exonic
905868829 1:41391501-41391523 GGGCCACCAGGGCCTGGAGCTGG - Intergenic
906475829 1:46168744-46168766 AGGCCTCCAGAGCCAGGGGCAGG - Intronic
914913055 1:151802080-151802102 GGGCCACTAGTGCCGGGAGACGG + Exonic
915720485 1:157981543-157981565 TGTCCTCTAGTGCCTGGACCTGG - Intergenic
916422356 1:164648846-164648868 GGGCCTCTAGCCCCAGGGGCAGG + Intronic
917926514 1:179793765-179793787 GGGCCTCCAGATCCTGTGGCAGG - Intronic
917969495 1:180197727-180197749 GGGTCTCTAGTGCCTTGCCCTGG + Exonic
918004038 1:180525098-180525120 GGGCTTCCTTTGCCTGGGGCTGG - Intergenic
919486978 1:198157500-198157522 GGGCCTCTAGAGCCGGGGCCAGG - Intronic
919892064 1:201982808-201982830 GGGCCTCCAGGGCCCGGCGCAGG + Exonic
920165666 1:204033958-204033980 AGGCCTCTTGTGGCTGGGCCGGG + Intergenic
920387582 1:205579751-205579773 GGGCCCATAGTGACTGGGCCAGG - Exonic
920446986 1:206025037-206025059 GGGGCTTCAGTGCCTGGGGTGGG + Intergenic
920845410 1:209589301-209589323 GGGACACTAGTGCCTGGGATGGG - Intronic
922234946 1:223715576-223715598 GTGGCTCCAGTGCCTGGAGCGGG + Intronic
922603522 1:226874490-226874512 GTGGCCATAGTGCCTGGGGCTGG + Intronic
1062774525 10:134963-134985 GGGGCTCTAGCGGCTGGCGCCGG - Intronic
1065142907 10:22736787-22736809 GTGCCTCTAGTCCCTCGGGAGGG + Intergenic
1067055528 10:43047714-43047736 GGGCCCATGGTGCATGGGGCAGG + Intergenic
1067070884 10:43131032-43131054 GGGCCTCATGGGCCTGGGGCGGG - Intergenic
1067242769 10:44509999-44510021 TGGCCTCCAGGGCCTGGGGTGGG + Intergenic
1067286435 10:44911037-44911059 GGGCCTGTAGTGTCTGGCTCTGG - Intergenic
1067788787 10:49272241-49272263 GGGCCTCTAGTGCCTTCAGAGGG + Intergenic
1069717397 10:70529888-70529910 GGGCCGCTACTTCCTGGTGCGGG + Exonic
1070841597 10:79491453-79491475 GGGCCGCTTGTATCTGGGGCAGG - Intergenic
1071238145 10:83673563-83673585 TTGCTCCTAGTGCCTGGGGCAGG - Intergenic
1071433604 10:85626094-85626116 GTGCCTGTAGTGCCAGGTGCAGG + Intronic
1071485556 10:86099821-86099843 GGGCCACTGGTGGCTGGGGGTGG + Intronic
1072757340 10:98030102-98030124 GGGCCTCTGGGGCCTGGAGGGGG - Intronic
1074634264 10:115295642-115295664 GGGCCTCTCCTGCTTGGGGGAGG + Intronic
1075019856 10:118943938-118943960 GGGCTCCTGGGGCCTGGGGCTGG - Intergenic
1075870455 10:125769375-125769397 GGGCCTCGAATGCCAGGGTCGGG - Intronic
1075987077 10:126797351-126797373 TGGCCTCTAGTGGCTGGGAGTGG - Intergenic
1076125722 10:127972245-127972267 GGGCCCTTGGTGCCTGGGCCTGG - Intronic
1076523930 10:131098984-131099006 GGGCGTCTGGTGCCTTGGGGAGG + Intronic
1076868500 10:133181316-133181338 CAGCCTCTCGTGCCTGGGCCAGG - Intronic
1077062953 11:625752-625774 TGGCCTCTCATGGCTGGGGCTGG + Intronic
1077100574 11:820517-820539 TGGGCTCTGGTGCCTGGGTCAGG + Intronic
1077383319 11:2257492-2257514 GGGCCACTGCTGCCTGAGGCGGG - Intergenic
1077489215 11:2852796-2852818 TGGCCTCTAAGGCCTTGGGCTGG - Intergenic
1077896396 11:6456711-6456733 GGCCCACTAGCGCCTGGCGCAGG + Exonic
1078748532 11:14138467-14138489 GTGACACTAGTGGCTGGGGCTGG + Intronic
1078966583 11:16351561-16351583 GGGCCTCAAGTGCCAGGGTCAGG - Intronic
1079030487 11:16982695-16982717 GGGCCACCTGTGCCTGGGTCAGG - Intronic
1080895980 11:36449107-36449129 GGAGCTCTAGAGCCTGGGGCTGG + Intronic
1083609229 11:63997288-63997310 GGGCCCACAGGGCCTGGGGCGGG + Intronic
1083679023 11:64342843-64342865 GGGCCTCCAGAGGATGGGGCAGG + Intronic
1083737656 11:64690798-64690820 GGGCCTCCAGTGCTGAGGGCTGG - Intronic
1084096318 11:66913843-66913865 CCTCCTCCAGTGCCTGGGGCTGG - Intronic
1084172449 11:67407024-67407046 GGGCAGCCAGTGGCTGGGGCAGG + Intronic
1084894333 11:72254490-72254512 AGGCCTCCTCTGCCTGGGGCTGG + Intergenic
1085311229 11:75518080-75518102 TGGCCTCAGGTGGCTGGGGCAGG + Intronic
1088754900 11:112877772-112877794 GGGCCAGCAGGGCCTGGGGCTGG - Intergenic
1089529317 11:119116325-119116347 GGATCTCCAGTGCCTGGGCCAGG + Exonic
1089627178 11:119758821-119758843 GGTCCACTGGTGCCTGGGGATGG - Intergenic
1091842992 12:3633787-3633809 GGGCCTCTGGTGGCAGGGGCAGG - Intronic
1092244443 12:6855767-6855789 GGGTCTCCAGTGCCTGTAGCAGG - Exonic
1092262437 12:6959831-6959853 GCTCCTGTGGTGCCTGGGGCTGG + Intronic
1094473284 12:30822888-30822910 GGGCCTGCAGTGCCAGGAGCAGG + Intergenic
1095465235 12:42483013-42483035 CGGCCTCTGGCTCCTGGGGCCGG - Intronic
1096654317 12:53079209-53079231 GGGGCTCTGGGGCCAGGGGCGGG - Intronic
1101272947 12:103167196-103167218 AGGTCTGTAGTACCTGGGGCTGG - Intronic
1102000605 12:109555699-109555721 GGCCCTCTTGAGCCTTGGGCAGG - Exonic
1102301191 12:111772783-111772805 GTGCCTCTAGTGGCTGACGCAGG - Intronic
1102468064 12:113142129-113142151 GTGCCTCTGGGGCCTGGGGTTGG - Intergenic
1102555196 12:113722267-113722289 AGGCCCCTGGAGCCTGGGGCTGG - Intergenic
1102807037 12:115791311-115791333 GGGCCGCCAGAGCCTGGGTCTGG + Intergenic
1103012466 12:117467617-117467639 GGTCATCTAGTGTATGGGGCTGG + Intronic
1103477908 12:121232259-121232281 GGGCCTCTCCTGGCTGAGGCGGG - Intronic
1103911613 12:124355262-124355284 AGGCCCTGAGTGCCTGGGGCAGG + Intronic
1104432273 12:128726128-128726150 GCGCCTCTAGAGGCTGGGACAGG + Intergenic
1104897227 12:132170415-132170437 GGGTCTGTACTGCCTGGTGCTGG + Intergenic
1105416565 13:20218411-20218433 GTGATTCTAGTGCCTGGGGCAGG + Intergenic
1113529613 13:111012807-111012829 GCACCACTAGTGACTGGGGCAGG - Intergenic
1114267370 14:21080878-21080900 GGGCCTCCCGTGCCTGGGCCAGG - Exonic
1114824378 14:26059065-26059087 GGGGCTCAAGTGACTGGAGCAGG + Intergenic
1118902217 14:69995949-69995971 GTGCCTGTAGTACCTGGTGCCGG + Intronic
1121046013 14:90788255-90788277 GCGACTCCAGTGCGTGGGGCCGG + Intronic
1121509657 14:94502884-94502906 GGGCCTGGGGTTCCTGGGGCAGG - Intronic
1122629704 14:103101959-103101981 GGGCCTGTTGTTCCTGGAGCAGG + Intronic
1122976289 14:105172213-105172235 GGGCCAGTAGAGCCTGGTGCTGG + Intergenic
1123053509 14:105559057-105559079 GGGCCTGCAGGGCCTGGGCCTGG + Intergenic
1123078086 14:105679471-105679493 GGGCCTGCAGGGCCTGGGCCTGG + Intergenic
1124640193 15:31392112-31392134 CGGCCGCGAGGGCCTGGGGCTGG - Intronic
1125296879 15:38212763-38212785 GGGCCTATGGGGCCTGTGGCAGG - Intergenic
1126733527 15:51708946-51708968 GAGCCTTTAATGACTGGGGCTGG - Intronic
1127512628 15:59657559-59657581 GGGCCTCCCGTCCCTCGGGCGGG - Intergenic
1128347362 15:66862942-66862964 AGGCCCCTTCTGCCTGGGGCTGG + Intergenic
1128497005 15:68204443-68204465 GGGCCTCTCCTGCCAGGTGCAGG + Intronic
1128824530 15:70699974-70699996 GGGACTTTAGTGCCTGGTACAGG - Intronic
1129742614 15:77997099-77997121 CGGCTGCCAGTGCCTGGGGCTGG - Exonic
1131511541 15:93051894-93051916 GGGCCTCGGGTGCCTGGGAATGG - Intronic
1132184537 15:99792038-99792060 TGGCCCCTAGTCACTGGGGCTGG - Intergenic
1132228038 15:100158602-100158624 GGGCTTGTATTGCCAGGGGCTGG - Intronic
1132570414 16:641747-641769 GGGCCTCCGGGGGCTGGGGCGGG + Intronic
1132809512 16:1790818-1790840 GGGCCTGGAGCGCCTGTGGCTGG - Exonic
1132832764 16:1937236-1937258 TGCCCTCCAGGGCCTGGGGCAGG + Intergenic
1133036549 16:3036844-3036866 GGGCCCCTCGAGCCTGGGGAGGG - Intronic
1133916411 16:10113183-10113205 GGGCCTCCTGTCCCTGGGGTGGG - Intronic
1134567878 16:15266687-15266709 GGGCGTCTCGGGCCGGGGGCTGG - Intergenic
1134734557 16:16489666-16489688 GGGCGTCTCGGGCCGGGGGCTGG + Intergenic
1134932909 16:18222240-18222262 GGGCGTCTCGGGCCGGGGGCTGG - Intergenic
1136398761 16:30006665-30006687 GGGCCTCAGGTACCTGGGGGTGG + Exonic
1136568341 16:31082864-31082886 GGGCCTCCGGGGCCAGGGGCAGG + Intronic
1136712552 16:32252327-32252349 GTGCCTTTACTTCCTGGGGCTGG - Intergenic
1136755362 16:32677102-32677124 GTGCCTTTACTTCCTGGGGCTGG + Intergenic
1136812750 16:33193267-33193289 GTGCCTTTACTTCCTGGGGCTGG - Intergenic
1136819226 16:33303347-33303369 GTGCCTTTACTTCCTGGGGCTGG - Intronic
1136825789 16:33359882-33359904 GTGCCTTTACTTCCTGGGGCTGG - Intergenic
1136830855 16:33458653-33458675 GTGCCTTTACTTCCTGGGGCTGG - Intergenic
1137480612 16:48849081-48849103 GGGGCCCCAGTGCCAGGGGCTGG + Intergenic
1137486563 16:48896049-48896071 TGGCCTCTAAAGCCTGGGTCTGG - Intergenic
1137970334 16:52978361-52978383 GGGCCTGTTGTGGGTGGGGCGGG - Intergenic
1138226761 16:55302679-55302701 TGGCCTCTAGGGCCTGGGGTAGG - Intergenic
1139675331 16:68519573-68519595 GAGCCACTAGTGCATGGGGTGGG - Intergenic
1140869475 16:79093591-79093613 AGGCCTCCAGTGCCCGGTGCAGG + Intronic
1141848477 16:86627508-86627530 GTGCCTGGAGTGGCTGGGGCTGG + Intergenic
1142143489 16:88482997-88483019 GGGCCTCCTGTCCCAGGGGCAGG + Intronic
1202991327 16_KI270728v1_random:16237-16259 GTGCCTTTACTTCCTGGGGCTGG - Intergenic
1203057506 16_KI270728v1_random:937441-937463 GTGCCTTTACTTCCTGGGGCTGG + Intergenic
1143651562 17:8266844-8266866 TGGCCTCCATTGCCTGGAGCTGG + Exonic
1144782186 17:17813830-17813852 GGGCCCGTGGTGCCAGGGGCCGG + Intronic
1144855261 17:18264011-18264033 GGGCCTGTGGAGCCTGGTGCCGG + Exonic
1144905762 17:18638892-18638914 GGGCCTCTATGGCCTGAGGATGG - Intronic
1145988872 17:29066072-29066094 TGGCCTCTAGGGGCTGGGGAGGG + Intergenic
1146263469 17:31436391-31436413 TGCCCTCCAGTTCCTGGGGCAGG - Intronic
1147615049 17:41822663-41822685 GGGCCTGTGGAGCCTGGGGTTGG + Exonic
1147816071 17:43211804-43211826 GGGCCCTTAGGGGCTGGGGCGGG + Intergenic
1147947997 17:44091429-44091451 GGCCCTCCAGTCCCTGCGGCAGG - Exonic
1147969380 17:44211416-44211438 GGGCCTCCAGAGCCTGGGTGTGG + Intronic
1148698974 17:49576836-49576858 CTGCCGCGAGTGCCTGGGGCGGG - Intronic
1148724351 17:49777769-49777791 GGGCAACCAGTGCCTGGGCCTGG - Intronic
1148896240 17:50840770-50840792 GGGCCTCAAGTTCCTGGGCCAGG + Exonic
1149604661 17:57916330-57916352 GGGCCTGGAGGGCCTGGGGTGGG - Intronic
1151367792 17:73628566-73628588 GGGCCTTGAGTGTCTGGGGCTGG + Intronic
1151460287 17:74250160-74250182 GGGCCTCTAGAGCCAAGGGAGGG - Intronic
1151892972 17:76962044-76962066 GGGCTTCCAGAGCGTGGGGCAGG - Intergenic
1152258212 17:79252512-79252534 GGGCCTCTAGAGGCTGGAACAGG + Intronic
1152279851 17:79378924-79378946 GGGCCTCTGGGCCCTGGGGCTGG - Intronic
1152306241 17:79522356-79522378 GGGCCTCTAGCTCCTGAGGATGG - Intergenic
1152663070 17:81551947-81551969 GGGCCTCTACTGCCTGTCGCTGG - Exonic
1152796573 17:82310534-82310556 TGGCCTCTGGTCCCTGGGGTGGG + Intergenic
1154276019 18:12961113-12961135 GGCCCACTAGTGCCTGGGAGGGG + Intronic
1155063393 18:22247986-22248008 GGGCCTCCAGAGCCTGGGTTGGG + Intergenic
1155477722 18:26251048-26251070 TGGCCTCTAGTGCCTGAGGAAGG + Intronic
1155990959 18:32278945-32278967 GGGCCTCCCTTGCCTGAGGCTGG - Intronic
1158860476 18:61587170-61587192 GGGGCTCCAGTGCCTGGTGCAGG - Intergenic
1160381334 18:78458374-78458396 GTGACTCTAGTGGCAGGGGCGGG - Intergenic
1160562324 18:79766518-79766540 GGGCCTCTCGTGCTTGAGGGAGG + Intergenic
1161479544 19:4503662-4503684 GAGCCCCAGGTGCCTGGGGCAGG + Exonic
1161768823 19:6220663-6220685 GGTCTTCTGGTACCTGGGGCTGG - Intronic
1161771085 19:6231066-6231088 GGGCCTCAGAGGCCTGGGGCAGG - Intronic
1161952369 19:7474941-7474963 GGGCCTGTAGTGGCTGGGCACGG + Intergenic
1162020061 19:7864256-7864278 CGGCCTCTCCTGCCTGGCGCAGG + Intronic
1162091098 19:8280608-8280630 GCCCCTCAACTGCCTGGGGCCGG + Intronic
1162093332 19:8295446-8295468 GCCCCTCAACTGCCTGGGGCCGG + Intronic
1162138023 19:8568077-8568099 GGGCCTCTAGTGCCTGGGGCAGG - Intronic
1162935587 19:13979995-13980017 GGGGCTCTAGTGCCAGGCGGGGG + Intronic
1163234080 19:16020953-16020975 GGGTCTCCATTCCCTGGGGCCGG + Intergenic
1163322198 19:16581399-16581421 GGTGCTGGAGTGCCTGGGGCAGG - Intronic
1164680775 19:30132367-30132389 CGGGCTCCAGGGCCTGGGGCAGG - Intergenic
1164721048 19:30431769-30431791 GGGCCTCTGGTTCCCAGGGCAGG + Intronic
1165190175 19:34056575-34056597 GGGCGTCTACTCCCTGGGCCAGG - Intergenic
1165420945 19:35721591-35721613 GTGGCGGTAGTGCCTGGGGCAGG - Exonic
1165423019 19:35731786-35731808 GGGCCTGTTGTGACTGGGTCAGG + Intronic
1165772620 19:38387911-38387933 GGGCCTCGAGCTCCGGGGGCGGG - Intronic
1166660486 19:44643950-44643972 GCTCCTCCAGTGCCTGGGGTGGG - Exonic
1166856258 19:45783915-45783937 GGGGCTCTTGTGGCAGGGGCGGG + Exonic
1167378537 19:49125486-49125508 GGGTCCCTAGAGCCAGGGGCAGG - Intronic
1167568359 19:50271399-50271421 GGGCCTCTAGCTCCTGGGGTGGG - Exonic
1168115182 19:54218326-54218348 AGGCCTTTGGTGCCTGGGACGGG + Intronic
1168124457 19:54275915-54275937 AGGCCTTTGGTGCCTGGGACAGG + Intronic
1168177529 19:54635623-54635645 AGGCCTTTGGTGCCTGGGACAGG - Intronic
1168239575 19:55082356-55082378 GGGGCCCGAGGGCCTGGGGCGGG - Intronic
925156553 2:1652599-1652621 TGGCCTCTCGTGGCTGGGGGCGG - Intronic
925164305 2:1705949-1705971 GGGCCTGGAGTGCCTGGGGGAGG - Intronic
925175666 2:1782023-1782045 GGGCCTCTAGTTTCTAGGACCGG - Intergenic
927449408 2:23194153-23194175 GGGCCTCATGTGCCTTGGGAGGG - Intergenic
929613803 2:43292406-43292428 GGGCCTCTAGTGACTTGGGATGG + Intronic
931198147 2:60072709-60072731 GTGCCTTCAGTGCCTTGGGCTGG - Intergenic
932302435 2:70676725-70676747 GGGTCTTCTGTGCCTGGGGCTGG - Intronic
932447571 2:71790352-71790374 GGGTCTCTGGTCCCTGGGACAGG - Intergenic
934941701 2:98507637-98507659 CGGCCTCTGGTGGCTGGAGCTGG + Intronic
936283926 2:111166287-111166309 GGGCCTCCCGTGCCTGGCCCAGG - Exonic
937137731 2:119569243-119569265 GTGCCTGTAGTCCCTGAGGCAGG - Intronic
937225531 2:120366649-120366671 AGGCCTCTTGTCCTTGGGGCTGG + Intergenic
938063833 2:128270606-128270628 GGGCCTCGTGAGCCTGAGGCAGG - Intronic
938764050 2:134448768-134448790 GACCCTCTGGTGCCTGGGGTGGG - Exonic
942133957 2:172906992-172907014 GGGCTGCTCCTGCCTGGGGCAGG - Intronic
943369607 2:187001541-187001563 GGGCCTCTTGTCCCTGTGGTGGG + Intergenic
946370326 2:219277837-219277859 CGGCCTCTAGTGTCTGGAGGAGG - Intronic
947741342 2:232486392-232486414 GGCCCTCAAGTACCTGGGCCCGG - Exonic
948233613 2:236370491-236370513 AGACCTCCAGGGCCTGGGGCTGG - Intronic
948909204 2:240994559-240994581 GGCCCTCAGGTGCCTGGGTCCGG + Intergenic
949043494 2:241859717-241859739 GGGGGTCCAGTGCCTGGGCCTGG + Intergenic
1168773877 20:432837-432859 CTTCCTCTAGTGCTTGGGGCTGG + Intergenic
1168959373 20:1858116-1858138 AGGCCTCAAATGCCTGGGGGTGG - Intergenic
1170567578 20:17615693-17615715 GAGCCTTGAGGGCCTGGGGCTGG - Intronic
1171449711 20:25226868-25226890 GGGCCCCTGGGGGCTGGGGCTGG + Intergenic
1171971929 20:31570042-31570064 GGACCTCTAGAGGCTGGGGTGGG + Exonic
1172208489 20:33181381-33181403 GGGCCTTTATTGCCAGGGGCAGG - Exonic
1172314599 20:33943971-33943993 GGGCCCCTGAGGCCTGGGGCAGG - Intergenic
1172635004 20:36404431-36404453 GGTGGTCTAGTGCCTGGGGATGG - Intronic
1173847029 20:46194613-46194635 GTGCCTCAAGTGCCTAGCGCAGG - Intronic
1174296640 20:49550039-49550061 GTGCCTCTTGTGCCTCGGGAGGG - Intronic
1175134879 20:56815748-56815770 GGGGCTTTTGTTCCTGGGGCTGG + Intergenic
1175263135 20:57687263-57687285 GGGGCACCTGTGCCTGGGGCTGG + Intronic
1175718270 20:61269777-61269799 GAGCCTCTGGAGCCTGGGGTTGG - Intronic
1175959103 20:62626097-62626119 GGCCCTGCAGTGCCTGGGGCGGG + Intergenic
1175972186 20:62692177-62692199 GGGCCTCTGGTTGCTGGGGGGGG + Intergenic
1177320413 21:19513160-19513182 GGGCTACTAGTGACAGGGGCAGG - Intergenic
1179434185 21:41348969-41348991 GGGCCTCTCCTTCCTTGGGCAGG + Intronic
1179439124 21:41380828-41380850 GAGGCTCCAGTGCCTGGGGCAGG - Intronic
1179727471 21:43348436-43348458 GGGCCTCTTGCCTCTGGGGCTGG + Intergenic
1179798414 21:43799001-43799023 GGTCCGCTAGTGCCTGCTGCTGG + Intronic
1180144528 21:45911959-45911981 GGGCCTCCAGGGCCTGAGACTGG - Intronic
1182485707 22:30637248-30637270 GGGCCTCCAGAGCCTGAGTCTGG - Intronic
1182781799 22:32874227-32874249 GGGTCTCTCGTGCCTGGGTAAGG + Intronic
1184331959 22:43833108-43833130 GGGCTTCTGGTGGCAGGGGCAGG - Intronic
1184362031 22:44024501-44024523 GGGGCTCTAGGGCCGAGGGCGGG - Intronic
1184582009 22:45424299-45424321 GGGCCTCCAGTTCTTGGGTCGGG + Intronic
1185157298 22:49201761-49201783 GGGGCTGGAGTGGCTGGGGCAGG - Intergenic
1185345628 22:50309381-50309403 TGGCCTGGAGTGCGTGGGGCGGG + Exonic
1185388793 22:50548186-50548208 GGGCCTGTCTTGCCTGGGGAAGG - Exonic
950119835 3:10474494-10474516 TGACCTCTAATGGCTGGGGCTGG - Intronic
950851452 3:16065751-16065773 GGGAGTCTTGTGCCTGGGGGAGG + Intergenic
953754229 3:45632787-45632809 GGGCCTCTAGTATTTGGGACGGG - Intronic
953914004 3:46906506-46906528 GGGCCCCAAGTGCCTGGAGTGGG + Intergenic
954302364 3:49706686-49706708 GGCCCTCTAGTGCCTGGAGCAGG - Intronic
960158745 3:114325975-114325997 TTCCCTCTAGTGCCTGGGGTTGG + Intergenic
960484533 3:118235317-118235339 GGGCCACTATTGCCCAGGGCTGG + Intergenic
960501799 3:118446761-118446783 GTGACTGTAGTGCCAGGGGCAGG - Intergenic
963105685 3:141645227-141645249 GGGCCACTCCTCCCTGGGGCCGG - Intergenic
963385347 3:144585668-144585690 GGCGCTATAGTGCCTTGGGCAGG + Intergenic
963781751 3:149493594-149493616 GGTCCTCTAGTGCCAGGCTCTGG - Intronic
966415970 3:179689828-179689850 GGGTCTCTAGTGCTTGGCCCTGG - Intronic
968604385 4:1525267-1525289 GGGAATCTGGTGCCGGGGGCAGG - Intergenic
968878664 4:3287555-3287577 GGGCCGCCAGGGCCAGGGGCTGG - Intergenic
968879697 4:3292783-3292805 GGGCCTCCACGGCCGGGGGCGGG - Intergenic
968910084 4:3473093-3473115 GGGGCTCCAGGGCCTGGGACAGG + Intronic
968913254 4:3486257-3486279 GGGGCTCTGGTGCCTGGGCACGG + Intronic
969340840 4:6539952-6539974 GGTCCTCACGGGCCTGGGGCAGG - Intronic
969501876 4:7558464-7558486 GGGCCCCAATTGCCTGGGGCAGG - Intronic
969606692 4:8205464-8205486 AGGCCTCTTGGGGCTGGGGCTGG + Intronic
972684792 4:41341718-41341740 GGGCATCCAGTGTCTGGTGCAGG - Intergenic
985552680 5:541428-541450 GGGGCTCTCATGCCTGGGGCTGG + Intergenic
987052707 5:14161412-14161434 GGGCCTCAAGAGGCTGGGACAGG - Intronic
989165686 5:38431633-38431655 GGGCCTGTGGTGCATGGGGGAGG + Intronic
990595302 5:57307184-57307206 GGGACTCCAGTGCTTGGGGTTGG - Intergenic
992105393 5:73446666-73446688 GAGCCTCTAGTGCCTGGACAGGG + Exonic
992870439 5:81000016-81000038 GGGGCTGGAGTGGCTGGGGCTGG + Intronic
997264531 5:132487359-132487381 GGGACTCTAGTGCTTCTGGCTGG - Intronic
997623769 5:135318145-135318167 GCCCCTCTAGTCCCTGAGGCTGG - Intronic
998252123 5:140560514-140560536 GGCCCTCTAGTGACTAGGCCTGG - Intronic
999076261 5:148798615-148798637 GGGCCTCCAGTGTCGGGGCCTGG + Intergenic
999863001 5:155668532-155668554 GGAGCTCACGTGCCTGGGGCAGG - Intergenic
1001147824 5:169200178-169200200 GGGCCACTAGGGCCTGGGCATGG + Intronic
1001387640 5:171353187-171353209 GGCCCTCTGGGGCCTGGGCCAGG - Intergenic
1001544026 5:172558848-172558870 AGGCCTCCAGGGGCTGGGGCGGG + Intergenic
1001699146 5:173694214-173694236 AGGCCACCAGTGCCTGGTGCAGG - Intergenic
1002433907 5:179219945-179219967 GGGCCTTCAGAGGCTGGGGCGGG + Intronic
1005960343 6:30689098-30689120 GGGCCTCCTGGGCCTGGGGAAGG - Intronic
1006093671 6:31642914-31642936 GGGCCTGCAGGGCCAGGGGCTGG - Exonic
1006474643 6:34246251-34246273 GTGCCCCTAAAGCCTGGGGCAGG + Intergenic
1006899227 6:37489494-37489516 GGGCCTCTGGAGCCAGGGCCAGG + Intronic
1007254712 6:40520685-40520707 GGGCCTCTGGAGGCTGGTGCAGG + Intronic
1009450247 6:63791627-63791649 TGGCATTTAGTGCCTGTGGCAGG + Intronic
1010107071 6:72182616-72182638 GCGCCGCTCGTGCCTGGCGCGGG - Exonic
1010141885 6:72622143-72622165 GGGCCGCCAGCGCCTGCGGCGGG - Exonic
1011010248 6:82695468-82695490 GGGCTTCTCGTGGCAGGGGCAGG - Intergenic
1013233095 6:108174713-108174735 GGGGCTCCAGGGCCTGCGGCCGG + Intronic
1017345754 6:153379051-153379073 GGGCATCTGTTGCCTGGTGCAGG - Intergenic
1017892775 6:158652933-158652955 GGGCATCTAGGGCCTTGGACAGG + Intronic
1018496194 6:164347807-164347829 GGGGCACTAGTCCCTGGGGCAGG - Intergenic
1019280932 7:199783-199805 GGGCATGCAGTGCCTTGGGCTGG + Intronic
1019989439 7:4681881-4681903 GGGCCTGGAGTGTCTGGGGCGGG + Intergenic
1023843643 7:44109567-44109589 GGGCCCCTAGTGGCTGGGCGTGG + Intronic
1023850298 7:44146333-44146355 GGGAAACTAGGGCCTGGGGCGGG - Intronic
1024747187 7:52421567-52421589 GTGCCTGTTCTGCCTGGGGCTGG - Intergenic
1025028164 7:55535069-55535091 TGGCCTCTAGTGCCAGGGCCTGG + Intronic
1025078621 7:55964257-55964279 GGGAATCCAGGGCCTGGGGCGGG - Intronic
1026233904 7:68509546-68509568 GTGACTCCAGTGGCTGGGGCTGG - Intergenic
1026529740 7:71186429-71186451 GGGCCTCTGCCTCCTGGGGCAGG + Intronic
1026944731 7:74308263-74308285 GAGCCTCCAGTGCCAGGGACAGG + Intronic
1026982754 7:74536283-74536305 GGGCCTCCGGGGCCAGGGGCGGG - Intronic
1027185468 7:75968326-75968348 GGGCCACCAGTGCCTAGGCCTGG - Intronic
1032402436 7:131633199-131633221 GGGCCCCTTGGGCCAGGGGCTGG + Intergenic
1033223717 7:139544858-139544880 GGACCTCTGGGGCCCGGGGCGGG - Exonic
1034188259 7:149195628-149195650 GGGCATCCAGGGCCTGGGGCTGG + Exonic
1035203717 7:157281621-157281643 CTGCCTCTGGTGCCTCGGGCAGG - Intergenic
1035238926 7:157517545-157517567 GGTCAGCCAGTGCCTGGGGCAGG + Intergenic
1036017317 8:4799485-4799507 GCTACTCTAGAGCCTGGGGCAGG + Intronic
1038191457 8:25324797-25324819 GGGCCTGTTGTGGCGGGGGCGGG - Intronic
1038331339 8:26611844-26611866 GGGACTCAGGCGCCTGGGGCTGG + Intronic
1041719764 8:60965316-60965338 GGGCCTCTGGGGGCTGAGGCAGG + Intergenic
1041775006 8:61514099-61514121 GGGCCTCCAGTGGCTGAGGCAGG - Intronic
1042521110 8:69711536-69711558 GGGCCTCGGGTGCCTGGGCTTGG - Intronic
1045312008 8:101010957-101010979 GTGCCTCTAGTGTCTTGTGCTGG - Intergenic
1045365216 8:101469887-101469909 TGGCCTGTAGTGCCTGGGAAGGG - Intergenic
1047528254 8:125652278-125652300 GGGCCTCTAGGACCTGAGGACGG + Intergenic
1049357396 8:142195574-142195596 GGGCGTCCAGGGCTTGGGGCCGG + Intergenic
1049424124 8:142530501-142530523 GGACCCCTAGTGCCTGGCTCAGG - Intronic
1049749461 8:144276457-144276479 GGGCCTCTGGGGGCTGTGGCTGG + Intronic
1050022279 9:1296639-1296661 GTGCCTCTAGGGCCTGTGGGTGG + Intergenic
1050116804 9:2271686-2271708 GGGCCTTGAGTGGCTGGGGGTGG + Intergenic
1053749202 9:41235792-41235814 GGGGCTCTAGTGCCAGGGCGGGG - Intergenic
1054254639 9:62800645-62800667 GGGGCTCTAGTGCCAGGGCGGGG - Intergenic
1054336661 9:63814957-63814979 GGGGCTCTAGTGCCAGGGCGGGG + Intergenic
1057024589 9:91725438-91725460 GGGCAGCTGGTGCCTGGGCCTGG - Intronic
1057277237 9:93682372-93682394 GGTTATTTAGTGCCTGGGGCTGG + Intergenic
1057806153 9:98221192-98221214 CGGCCTCCAGTGCCTTGTGCAGG + Exonic
1059404550 9:114091959-114091981 GGGCCTCCAGTCTCTGGGCCAGG + Exonic
1061285607 9:129620653-129620675 GGGGCACTATGGCCTGGGGCTGG - Exonic
1061922355 9:133789047-133789069 GGGGCTTTTGTGCCTGTGGCGGG - Intronic
1061985808 9:134129569-134129591 CGGCCTTCAGTGCCTCGGGCTGG + Intergenic
1062431383 9:136528297-136528319 GGGTCTCTGGTTCCTGTGGCGGG - Intronic
1186381956 X:9070135-9070157 GGACCTCTGGGGTCTGGGGCTGG - Intronic
1187503990 X:19864057-19864079 GGGCTGCTAGAGCCTGGGGATGG - Intronic
1189348520 X:40260316-40260338 GGCACTCTAGTGGCGGGGGCAGG + Intergenic
1190248476 X:48705929-48705951 GAGCCTCCAGTGCCTTGGGACGG - Intronic
1192432859 X:71124462-71124484 GAGCCTCTTTTGCCTGGGGGAGG + Intronic
1192473721 X:71420905-71420927 CGCCATCTTGTGCCTGGGGCCGG - Intronic
1195618579 X:106931686-106931708 GGCCCTCTAGATCCAGGGGCTGG - Intronic
1199671653 X:150152729-150152751 GGGCCCCAAGTGCCTGCTGCAGG + Intergenic
1200068841 X:153518003-153518025 GGGGCTCAGGTGCCTCGGGCGGG - Intronic
1200103699 X:153701038-153701060 GGACCTCTGGGGCATGGGGCTGG - Intronic