ID: 1162141153

View in Genome Browser
Species Human (GRCh38)
Location 19:8586292-8586314
Sequence ATACCTGGGCTGAGGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162141153_1162141157 0 Left 1162141153 19:8586292-8586314 CCAGAGAACCTCAGCCCAGGTAT 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1162141157 19:8586315-8586337 CTTGTGCCTTCCCCCACCCCCGG 0: 1
1: 0
2: 2
3: 48
4: 613
1162141153_1162141168 21 Left 1162141153 19:8586292-8586314 CCAGAGAACCTCAGCCCAGGTAT 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1162141168 19:8586336-8586358 GGCCTCACCGCCTGCACACTGGG 0: 1
1: 0
2: 0
3: 8
4: 112
1162141153_1162141167 20 Left 1162141153 19:8586292-8586314 CCAGAGAACCTCAGCCCAGGTAT 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1162141167 19:8586335-8586357 CGGCCTCACCGCCTGCACACTGG 0: 1
1: 0
2: 1
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162141153 Original CRISPR ATACCTGGGCTGAGGTTCTC TGG (reversed) Intronic
900764045 1:4492045-4492067 ATAGCTGGGCTGAGCTTCCTTGG + Intergenic
901563178 1:10089462-10089484 ATACCTGGGCTGCGGTACAGTGG - Intronic
903665695 1:25006245-25006267 CTTCCTGGGCTGAGTGTCTCAGG - Intergenic
903885439 1:26538316-26538338 ATCTCAGGGCTGAGGTTCTGGGG + Intronic
905474694 1:38217796-38217818 ATCACAGGGCTGAGGCTCTCAGG - Intergenic
905741307 1:40373848-40373870 TTGCCTGGGCTGAGGGTCTCTGG + Exonic
907679845 1:56552903-56552925 AGTCCTGGGCTGGGGGTCTCAGG + Intronic
909652837 1:77994940-77994962 ATACTTGGGCTGAGATTCACAGG + Intronic
911160179 1:94676153-94676175 AGACATGGGCTGAGGGTCCCGGG - Intergenic
916282963 1:163072880-163072902 CAACCTGGGATGAGGTACTCTGG + Intronic
918635134 1:186765677-186765699 ATACCTGGTCTGAATTTTTCAGG - Intergenic
919441959 1:197646200-197646222 ATTCCTGGGCTGGGTTTCTATGG + Intronic
921623683 1:217354492-217354514 ATTCCAGGGCTGAGATTCACAGG + Intergenic
924530221 1:244887449-244887471 ATGCATGGGCAAAGGTTCTCAGG + Intergenic
1065638444 10:27754456-27754478 CTGCCTGGCCTGAGGTTCCCTGG - Intergenic
1069410431 10:68147708-68147730 CTCCCTGGGGTCAGGTTCTCTGG + Intronic
1070758641 10:79009282-79009304 ATTCCTGGGCTGTGGCTCTCTGG - Intergenic
1071399330 10:85254455-85254477 ATGCCGTGTCTGAGGTTCTCAGG + Intergenic
1072701927 10:97648540-97648562 ATACCAGGGCTGAGGTCAACTGG - Intronic
1072703965 10:97666578-97666600 ATAATAGGGCTGAGGTTCCCAGG - Intronic
1074471692 10:113732929-113732951 TTACCTGGCCAGAGGTTTTCTGG - Intergenic
1074782339 10:116811055-116811077 CTACCTGGGATGAGGTGGTCAGG + Intergenic
1076830771 10:132993045-132993067 ATACCTGGGCGGAGACTCTCAGG + Intergenic
1077558153 11:3237246-3237268 ACACCTGGGCACATGTTCTCAGG - Intergenic
1081810284 11:45910485-45910507 CTACCCTGGCTGAGCTTCTCTGG - Intronic
1083307764 11:61769884-61769906 AGGCCTGGGCTGGGGGTCTCCGG + Intronic
1088745145 11:112798703-112798725 CTATCTGGGCTGTGGTCCTCTGG + Intergenic
1089242531 11:117094791-117094813 TTACTTAGCCTGAGGTTCTCTGG - Intronic
1089336285 11:117726004-117726026 TGACCTGGGCTGAGGATGTCAGG - Intronic
1091156791 11:133381990-133382012 AGAACTGGGCTGAGATGCTCCGG - Intronic
1091362297 11:134987202-134987224 AGCCCTGGGCTGAGATTCACGGG - Intergenic
1094344997 12:29457970-29457992 ATATCTGGGCTTAGGCTCTAAGG + Intronic
1095811518 12:46376824-46376846 AAATCTGGGCTGAGCTTATCTGG - Intergenic
1097661456 12:62435588-62435610 ATACGGGGGCTGTGGTTCCCAGG - Intergenic
1098917458 12:76272321-76272343 CTACCTGTCCTGAGGTTCCCAGG - Intergenic
1102686572 12:114729415-114729437 AGAGCTGGTCTGAGTTTCTCTGG + Intergenic
1102929018 12:116848571-116848593 ATAGCTGGGCTGGGGTTGTTGGG - Intronic
1103659644 12:122503366-122503388 GTACCTGAGATGGGGTTCTCAGG - Intergenic
1104629730 12:130390497-130390519 AAACCTGGGCTGAGGGACCCCGG - Intergenic
1107066498 13:36219008-36219030 ATTCCTGGGCTCAGCCTCTCAGG - Intronic
1110661171 13:78060794-78060816 ATACCACAGCTGATGTTCTCTGG - Intergenic
1113950077 13:114066867-114066889 ATCCCTGGCCTGGGGTGCTCTGG + Intronic
1115641418 14:35337796-35337818 GTCCCTGGGCTGAGGGTCTGGGG + Intergenic
1117094285 14:52281874-52281896 ATACCTGGCCAGAGTTTCTAAGG - Intergenic
1117257538 14:53994066-53994088 CCACCTGGGCTGAAGTTGTCAGG + Intergenic
1117768510 14:59107986-59108008 ATACCACAGCTGATGTTCTCTGG + Intergenic
1121485420 14:94310784-94310806 TTACCTGGGCTGAGTGTCACAGG + Intronic
1124340513 15:28886723-28886745 AGATCTGGGCTTGGGTTCTCTGG - Intronic
1128613558 15:69092224-69092246 ATACCTGGGCTCAGGATTTCCGG - Intergenic
1128740761 15:70082351-70082373 AAAGCTGGGGTGGGGTTCTCAGG + Intronic
1129958531 15:79661888-79661910 ATACCTGCCCTGATGTTCTGTGG + Intergenic
1130367246 15:83251789-83251811 ATACCTGAGCTGAGGCTCAAGGG + Intergenic
1130769527 15:86910784-86910806 ACACCTGGGCTTAGGTGCTCAGG - Intronic
1133304054 16:4799035-4799057 ATGACTGGGTTGAGGTTTTCAGG + Intronic
1134472224 16:14535233-14535255 ACCCCTGGTCTGAGGTGCTCAGG + Intronic
1136277159 16:29185735-29185757 AAGCCTGGGCTCAGGTTCTTAGG - Intergenic
1137538457 16:49345180-49345202 ACTCCTGTGCTGAGGTTCACAGG + Intergenic
1138580977 16:57940230-57940252 ATACCTGATCTGAAGTGCTCTGG + Exonic
1141663181 16:85452708-85452730 GGACCTGTGCTGAGGGTCTCTGG - Intergenic
1142081537 16:88151780-88151802 AAGCCTGGGCTCAGGTTCTTGGG - Intergenic
1143339942 17:6203007-6203029 CTCCCTGGGGTGTGGTTCTCAGG + Intergenic
1144431327 17:15194600-15194622 ATAACTGGGTCCAGGTTCTCGGG + Intergenic
1144538937 17:16120010-16120032 ATATCAGGCCTGATGTTCTCAGG - Intronic
1144955238 17:19015725-19015747 ATTCCTTGGTTGAGGGTCTCAGG - Intronic
1147128968 17:38394655-38394677 ATCCCAGGCCTGAGGCTCTCGGG - Intronic
1154033263 18:10772665-10772687 ATCTCTGGGGTGAGGTTCTGGGG - Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1162141153 19:8586292-8586314 ATACCTGGGCTGAGGTTCTCTGG - Intronic
1163987892 19:20970326-20970348 ATACCTGGGCCCAAGCTCTCAGG + Intergenic
1164126829 19:22326105-22326127 ATACCTGGGCTTAGGGCCACGGG + Intergenic
1164172495 19:22737606-22737628 ATACCTGGGCTTAGGGCCACGGG - Intergenic
1164180941 19:22818132-22818154 ATACCTGGGCTTAATTTCACAGG + Intergenic
1164204457 19:23046402-23046424 ATACATGGGCTTAGGTCCACAGG - Intergenic
1164314318 19:24073382-24073404 ATACATGGACTTAGGTTCACAGG + Intronic
928793265 2:34984615-34984637 ACACAAGGGTTGAGGTTCTCTGG + Intergenic
932356067 2:71069120-71069142 AGATCTTGGCTGAGGTTATCCGG + Intronic
932383111 2:71304012-71304034 ATACCTAGGCTGGGGCTCTGAGG - Intronic
933617154 2:84494178-84494200 AGTCCTGGGCTGAGGTTTTTTGG - Intergenic
937467463 2:122147228-122147250 ATGCCTGGGATGAGGTTTTGAGG + Intergenic
940820279 2:158346390-158346412 ATTCCTGGGGTGAGGTTACCCGG - Intronic
943162473 2:184271679-184271701 ATAGCTGGGCTGAGGCTCGTGGG + Intergenic
943321117 2:186444259-186444281 ATTCCAGTGCTGAGGTTCACTGG - Intergenic
944889570 2:204103193-204103215 ACTCCAGGGCTGGGGTTCTCTGG + Intergenic
946189755 2:218002096-218002118 AGACCTGGGCTGAGGCTCCTGGG - Intronic
947419668 2:229930793-229930815 TGAGCTGGGCTGAGGTTCTCAGG - Intronic
948947627 2:241229097-241229119 ACACCTGTGCTGAGGCGCTCTGG + Exonic
1169335472 20:4752226-4752248 ACACCTGTGCTGAGGCTCGCTGG + Intergenic
1172520727 20:35563850-35563872 ATACCTGGGGGCAGGGTCTCCGG + Intergenic
1176094049 20:63331510-63331532 AGACCTGGGCAGAGGTGCTGAGG - Intronic
1179768803 21:43597215-43597237 ATACCTGAGCTCTGGCTCTCTGG - Intronic
1180059400 21:45376772-45376794 GAACCTGGGCTGAGTTTCTGTGG + Intergenic
1180744441 22:18078109-18078131 ATACCTGGCCCTAGCTTCTCCGG - Intronic
1181737374 22:24892390-24892412 TTACCTGGGCTGTGTTACTCAGG + Intronic
1183281746 22:36936024-36936046 ATACCTGGGCTGAGCTTTGAGGG + Intronic
1183588390 22:38766351-38766373 ATAGCTTGGCTGAGGAGCTCCGG + Intronic
1183619642 22:38965002-38965024 ATACCAGGGCTGCAGTCCTCAGG - Intronic
1184817422 22:46882535-46882557 ACACCTGGGCTGAGGTACCAGGG + Intronic
950154171 3:10709281-10709303 ATCCCTGGGGTGATGTCCTCTGG - Intergenic
953462249 3:43090766-43090788 AGATCTGAGCTGAGGATCTCAGG - Intronic
953556884 3:43953025-43953047 ATACCTGGGCTGAGGCAGTGGGG + Intergenic
954266174 3:49471926-49471948 ATTCCTGAGCTGTGGTTTTCAGG + Intronic
962310869 3:134326023-134326045 ACACCTGGCCTCAGGTTCCCAGG + Intergenic
962367546 3:134796208-134796230 ATACCACGGCAGAGCTTCTCCGG - Intronic
963975956 3:151480850-151480872 ATACCTTGGCTGTGGTGCTGGGG - Intergenic
967618271 3:191600212-191600234 ATACATGGGCAGAAGTTATCTGG + Intergenic
969568333 4:7993158-7993180 CCAGCTGGGCTGAGGTTCTGTGG - Intronic
971089272 4:23321447-23321469 ATACTAGGGCTGAAATTCTCAGG - Intergenic
973665808 4:53158083-53158105 TAACCTGGGCTAAGGTTCTGAGG - Intronic
973915408 4:55629323-55629345 ATTCCTGGGCTGAAGTGGTCGGG + Intronic
975369578 4:73568869-73568891 AACCATGGGCTGAAGTTCTCTGG - Intergenic
976445714 4:85128196-85128218 ATAGCAGGGCTGAGGGACTCAGG + Intergenic
977203098 4:94139985-94140007 ACACAAGGGCTGAGGTTCTTTGG - Intergenic
981614451 4:146632624-146632646 ATTCCTGGGCTGAGAACCTCAGG + Intergenic
981807715 4:148735921-148735943 ATACCTGGGGGGAGGATGTCCGG - Intergenic
983841722 4:172465036-172465058 TTTCCTCGGCTGAGGTTCTTTGG + Intronic
984700118 4:182813844-182813866 ATCCCTGGTCAGGGGTTCTCTGG + Intergenic
990256665 5:53977536-53977558 ATACCTGGTCTGAGTTTTTATGG + Intronic
993854555 5:93057138-93057160 ATACCTGGCCTGAAAATCTCAGG - Intergenic
995585661 5:113645665-113645687 ATACCTGGGCACAGGAACTCTGG - Intergenic
997046005 5:130318124-130318146 ACACTTGGGCTGAGCTTGTCAGG + Intergenic
1000920314 5:167129934-167129956 GTACCAGGGCTGAGGTTCTGAGG + Intergenic
1004360387 6:14965785-14965807 ATACCTGTCCTGAGATTTTCTGG - Intergenic
1004495807 6:16161394-16161416 GTACTTGGTCTGAGGTTGTCCGG - Intergenic
1004654367 6:17644584-17644606 ACACCTGAGCTGAGTTACTCAGG - Intronic
1008489245 6:52068233-52068255 AGCCCTGGGCTGAGCTCCTCAGG - Intronic
1009766026 6:68076753-68076775 ATACCTGGGCACAGGATCACTGG + Intergenic
1010655812 6:78509325-78509347 ATAACTGCTCTGAAGTTCTCGGG + Intergenic
1016412902 6:143802300-143802322 AGAGCTGGGCTGAGGTTATGGGG - Intronic
1017194424 6:151684627-151684649 ATTCCTGGGCTGAGATATTCTGG - Intronic
1017405665 6:154115866-154115888 ATATCTGGACTGAGTTTCTTTGG + Intronic
1018635788 6:165858279-165858301 AGACCTGGGCTGAGGGCCTGAGG - Intronic
1019712276 7:2523212-2523234 ATTCCTGGGCTGAGATTCTGGGG + Intronic
1019805014 7:3117345-3117367 CTCCCTGGGCTGAGGTTCACTGG + Intergenic
1021621324 7:22553327-22553349 ATACCTGGGTAGAGGCTCTGCGG - Intronic
1023834605 7:44060803-44060825 ATGCCCGTGATGAGGTTCTCGGG - Exonic
1023864783 7:44233508-44233530 AAGCCTGGCCTGGGGTTCTCAGG + Intronic
1025784339 7:64630875-64630897 ATACCTGGGCTTAGGGCCACAGG + Intergenic
1032461218 7:132113038-132113060 ATCCCAGGGCAGAGGTCCTCAGG + Intergenic
1033021106 7:137725094-137725116 ATACCTGGGATGAGTTCCTCAGG - Intronic
1034268678 7:149792998-149793020 ATTCCTGGGCTGAGGCTTGCGGG + Intergenic
1034500452 7:151447430-151447452 ACACCTGAGCTGAGCTTCCCAGG + Intergenic
1034683160 7:152946825-152946847 ATACCATAGCTGATGTTCTCTGG - Intergenic
1035389065 7:158493126-158493148 ATAGCAGGGCTGTGGTGCTCAGG + Intronic
1041042365 8:53860532-53860554 ATTCCTGGTCTGAGGTTCCTGGG - Intronic
1041143336 8:54845299-54845321 ATACCTGATCAGTGGTTCTCTGG + Intergenic
1043808446 8:84703345-84703367 ATATCAGGGCTGAGTTTCTTAGG - Intronic
1048354038 8:133639065-133639087 ATTCCTGGGAAGAGGGTCTCAGG - Intergenic
1052032213 9:23641491-23641513 ATACCTGAGCAGAGCTTCTTGGG - Intergenic
1052446195 9:28564919-28564941 ATACCTGCCCTGAGGTTCTATGG + Intronic
1055014856 9:71605313-71605335 AAAGCTGGGCCTAGGTTCTCTGG - Intergenic
1059395399 9:114031296-114031318 ATGCCTGGGCTGAGAGTCCCAGG - Intronic
1059653186 9:116334309-116334331 ATGCCTGGGCTGTGCTTCTCTGG + Intronic
1060044467 9:120328756-120328778 ATAGCTGGACTGAGCTACTCTGG + Intergenic
1060050205 9:120373265-120373287 ATACAGGGGGTGAGGTTCACTGG - Intergenic
1061441881 9:130610478-130610500 TTAGCTGGGCTGAGGCTCTCTGG - Intronic
1061850521 9:133412295-133412317 ATACCCTGCTTGAGGTTCTCAGG + Exonic
1062176908 9:135168463-135168485 TTCCCTGGGCTGAGGGTGTCGGG - Intergenic
1062570346 9:137182120-137182142 ACACCTGGGCTTAGGTCTTCTGG - Intronic
1189293216 X:39900700-39900722 ATGCCTGGGCTGAGATGTTCCGG - Intergenic
1189308251 X:40003407-40003429 ATACCAGGACTGCTGTTCTCAGG - Intergenic
1192074760 X:67982281-67982303 GCACCTGGGCTGAGGTCCTGTGG - Intergenic
1195329316 X:103784216-103784238 ATACCAGGTCTGGGGATCTCAGG + Intronic
1196377151 X:115045963-115045985 AAACCTGAGCTGAGATTCTCAGG + Intergenic
1197647902 X:129037482-129037504 ACACCAGGGCTGATGTTCTGAGG + Intergenic
1199247585 X:145625001-145625023 CAACCTGGGCTAAGGTACTCTGG + Intergenic
1199729323 X:150615515-150615537 AGACCTGGGCTGAAGTTTGCTGG + Intronic
1200930920 Y:8696320-8696342 ATACCTCCGCTGAGGTGCTTCGG - Intergenic