ID: 1162143215

View in Genome Browser
Species Human (GRCh38)
Location 19:8596933-8596955
Sequence CTGAGAAAACAGATGGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162143215 Original CRISPR CTGAGAAAACAGATGGTCCA GGG (reversed) Intronic
900886340 1:5418139-5418161 AGAAGGAAACAGATGGTCCAGGG - Intergenic
901729137 1:11265915-11265937 CTGAGAAAATACATAGTCAAGGG - Intergenic
902760183 1:18575809-18575831 CTGAGCTGACAGCTGGTCCAGGG + Intergenic
902839111 1:19064294-19064316 CTGAGAAAAAGGCTGGCCCAGGG - Intergenic
903087780 1:20878700-20878722 AAGAGAAAACAGATGATACATGG + Intronic
903850427 1:26302521-26302543 CTGCAAACACAGATGGTCTACGG - Intronic
904654813 1:32036839-32036861 CTGAGAAATCATCTGGTCCACGG - Intronic
904817759 1:33218764-33218786 CTGAGAAACCAGATGGGTTAAGG - Intergenic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
907865863 1:58398483-58398505 ATGTGAAAACAGAGGGTCCTGGG - Intronic
909106584 1:71417666-71417688 CTGAGAAAACTGAGGTGCCAGGG - Intronic
913393891 1:118345082-118345104 ATGAGGAAACAAATGGGCCAAGG + Intergenic
915281064 1:154822390-154822412 CCGAGAAAACAGAGGCTCAAAGG - Intronic
916155367 1:161840121-161840143 ATGAGACAACAGATGGAACATGG - Intronic
917120621 1:171641857-171641879 CTGAGCAAACAAATGATCAAAGG - Intronic
918041763 1:180917956-180917978 CTGAGTAAATAGAGGGACCATGG - Intronic
919824211 1:201492341-201492363 CTGGGAGAACAGAAGGGCCAAGG - Intronic
919932946 1:202233389-202233411 CTGAGAAAACAGGGGGTCGCAGG - Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
923794470 1:237140771-237140793 CAGAGAAATCCTATGGTCCAAGG - Intronic
923821173 1:237443886-237443908 CTGTGAAACCAGCTGGTCCTAGG + Intronic
924212158 1:241781556-241781578 CTGATAAAAAAGAAGTTCCATGG + Intronic
924472370 1:244353801-244353823 CTGAGAAAACAGAAGCAACAGGG + Intronic
1063630990 10:7733625-7733647 CTGAGAAGTCAGAGGGGCCATGG - Intronic
1065966448 10:30774797-30774819 CTGGGACATCAGATGGCCCAGGG + Intergenic
1067064636 10:43096894-43096916 ATGGAAAAACACATGGTCCAAGG - Intronic
1069213966 10:65796621-65796643 CTAAGAACACAGATAGTCCTAGG + Intergenic
1069702893 10:70439538-70439560 ATGAGAAAACTGAAGGTCCAAGG + Intronic
1070378547 10:75858173-75858195 CTGAGTAGACAGAGGGGCCAGGG - Intronic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG + Intergenic
1078019010 11:7640038-7640060 CTTAGAAAACAGCTCGCCCAGGG - Intronic
1078642292 11:13108031-13108053 CTAAGAGAAGAGATGGGCCAAGG - Intergenic
1079323615 11:19472984-19473006 ATGAGAAGACAGAGGATCCATGG + Intronic
1079940602 11:26675540-26675562 GTGAGAAAAGAGAAGGTCAAAGG + Intronic
1080751210 11:35152105-35152127 CTGAGAATGCAGAGGCTCCAGGG - Intronic
1081566487 11:44264067-44264089 CTGAGAACACAGATGCCACAAGG - Exonic
1082921142 11:58495510-58495532 GTGAGAAAACAGATTGTTCCAGG + Intergenic
1084533400 11:69742700-69742722 CTGAAAAACCAGATGTTCCCAGG - Intergenic
1085087590 11:73681290-73681312 CTGAGAATACAGATGTAACAAGG + Intronic
1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG + Intronic
1087054357 11:93919111-93919133 ATGAGGAAACTGATGCTCCAAGG + Intergenic
1087347496 11:96990342-96990364 GTGAAAAAACAGATGGATCAGGG + Intergenic
1088392670 11:109332220-109332242 CTAAGAATGCAGATGATCCATGG + Intergenic
1089005905 11:115090613-115090635 CTGAGGACACAGCGGGTCCAGGG + Intergenic
1089325176 11:117652051-117652073 CTGAGAAGGAAGATGGTGCAAGG - Intronic
1091356187 11:134939645-134939667 CTGCCAAAACAAATGGTCAAAGG + Intergenic
1091364415 11:135005636-135005658 TGGAGAAAACAGTTGGCCCATGG - Intergenic
1091610886 12:2007766-2007788 CTAAGAAGACAGATGGGCAAAGG - Intronic
1092827339 12:12413494-12413516 CTGAGAAATCAGATGGTTGCCGG - Intronic
1093098027 12:14994344-14994366 CAGAGAGCACAGATAGTCCATGG + Intergenic
1093613058 12:21186078-21186100 CTGAGAATCCATCTGGTCCAGGG - Intronic
1094075371 12:26466754-26466776 CAGAGAAAACACAGGGTGCAGGG + Intronic
1095121613 12:38425744-38425766 CAGAGAAGACAGATGGTTCTTGG - Intergenic
1095700758 12:45188648-45188670 CAGAGAGAACAGAGGGTCAAGGG + Intergenic
1096753757 12:53781594-53781616 CTGACATCACAGATGGTGCAGGG + Intergenic
1096782930 12:54001196-54001218 TTCACAAAACAGAAGGTCCATGG + Intronic
1097728393 12:63100076-63100098 CTGAGAAAGCAGAAGGGCCTGGG - Intergenic
1098030517 12:66248900-66248922 CTGAGAAAATGGCTGGTCAAGGG + Exonic
1098698036 12:73584050-73584072 CTGACAAAACAGATGATTTATGG + Intergenic
1098805055 12:75012940-75012962 CGGAGAACACAGATAGTCCTTGG + Intergenic
1100657029 12:96658269-96658291 CTGAGAATACAGAAGTTCAAGGG + Exonic
1101389127 12:104284158-104284180 CTGAGAAAACAAATATTCCAGGG + Intronic
1102013273 12:109631963-109631985 ATGAGAAAACAGAGGCTCTAAGG - Intergenic
1102196012 12:111025643-111025665 CTGAGAATCCAGAAGTTCCAAGG + Intergenic
1102836676 12:116069026-116069048 CTGAGAAAACTCATGCCCCAAGG + Intronic
1105768803 13:23587743-23587765 AAGAGAAAACTGAAGGTCCAAGG - Intronic
1107001263 13:35547982-35548004 CTGAGAAAACTGCTGGTCACTGG + Intronic
1107502731 13:40997204-40997226 CTGTGAAAACAGATCATTCAGGG - Intronic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1110471282 13:75862803-75862825 CTGAGAAAACAAATGTTTCTGGG + Intergenic
1112138894 13:96615868-96615890 CTGGGAAAGCAGTTGCTCCATGG + Intronic
1114153053 14:20066614-20066636 CTGTGAAACCATCTGGTCCAGGG - Intergenic
1117281398 14:54244791-54244813 CTGAGAAAGTAGGTGTTCCAGGG - Intergenic
1121529029 14:94639772-94639794 TTGAAAAAACAAATGGTTCATGG - Intergenic
1121659360 14:95623502-95623524 CAGAAAAAGCAGATGGTGCAGGG + Intergenic
1121983105 14:98472037-98472059 CTGAAAAATCAGATTTTCCAAGG + Intergenic
1123632237 15:22269505-22269527 CTGAGAAAACAGCCTCTCCAAGG - Intergenic
1123931082 15:25171942-25171964 CAGAGAACACACATGGCCCAGGG + Intergenic
1124413008 15:29452198-29452220 CTGAGAAAGCAGATGGTTGTGGG - Intronic
1124825490 15:33090528-33090550 CTGAGAAAAATGAGAGTCCAGGG + Intronic
1125256224 15:37766566-37766588 CTGAGACTACAGATAGACCAAGG + Intergenic
1127266126 15:57363659-57363681 CTGAGAAGTCAGATGTTGCATGG - Intergenic
1128262233 15:66240495-66240517 ATTAGAAAACAGAGGTTCCAGGG - Intronic
1128704352 15:69827829-69827851 CTGGGAACACAAATGGACCAAGG - Intergenic
1129478174 15:75801805-75801827 ATGCGAAAACAGATGTTGCATGG + Intergenic
1131006986 15:88986369-88986391 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1131563141 15:93461758-93461780 TTGAGGAAAGAGATGGGCCAAGG + Intergenic
1131604370 15:93885547-93885569 CTAAAAATACAGATGGTCCCTGG - Intergenic
1133913428 16:10086662-10086684 TTAAGAAAACAGATTGTCCCAGG - Intronic
1137802426 16:51273497-51273519 CTGAGACAAGAGCTGGTGCAGGG - Intergenic
1138219769 16:55240682-55240704 CTGAGAAAACAGAAGGGACCTGG - Intergenic
1138425727 16:56931162-56931184 CTGAAAAAACAGATGTCCCAAGG + Intergenic
1141748701 16:85943881-85943903 CAGAGACCACATATGGTCCATGG + Intergenic
1143713033 17:8746585-8746607 CCGTGAAATCAGGTGGTCCAGGG + Intergenic
1147584106 17:41643179-41643201 CTGAGGTGACAGTTGGTCCAAGG + Intergenic
1150418487 17:65007061-65007083 CTCAAAAAGCAGATGGCCCAGGG - Intergenic
1151186413 17:72367464-72367486 GTGATAAAACAGTTTGTCCAGGG - Intergenic
1152376403 17:79920982-79921004 CTGAGAAAACAGAGGTGGCAAGG - Intergenic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1154005483 18:10523897-10523919 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1154498435 18:14979652-14979674 CTGCCAAAACAGATGGTCAAAGG - Intergenic
1154979470 18:21490659-21490681 CTCAGAAAACAGATGGCCATGGG - Intronic
1154981856 18:21508924-21508946 ATGAGAAAAAAGATGGTCTAAGG + Intronic
1155247063 18:23920537-23920559 GTCAGAAAACAGATGGTGGAAGG + Intronic
1155331340 18:24721646-24721668 TAGAAAAAACAGATGGGCCAAGG - Intergenic
1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG + Intergenic
1159655367 18:71025964-71025986 TTGTGAAAACAGATGGTTCAAGG + Intergenic
1159871705 18:73766179-73766201 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1164796458 19:31037473-31037495 CTATGAAAACAAAGGGTCCAGGG + Intergenic
1165321185 19:35086265-35086287 CTCATAAAACAGATGTTCTAGGG - Intergenic
1168182673 19:54672729-54672751 GTTAGAAAAGAGATGGTTCAGGG - Intronic
1168183128 19:54677184-54677206 GTTAGAAAAGAGATGGTTCAGGG - Intronic
925506580 2:4572396-4572418 CTGAGAAAGCAGATGCTTCCCGG - Intergenic
925670488 2:6305004-6305026 ATGAGAAAACAGAGACTCCAAGG + Intergenic
925672063 2:6321182-6321204 CTGTGAATGCATATGGTCCAGGG - Intergenic
927067279 2:19486115-19486137 CTGAGAAATCAGAGGTACCATGG + Intergenic
928326369 2:30322738-30322760 CTGAGAAGAGAGAAGGGCCAGGG - Intronic
929049670 2:37825408-37825430 GTTGAAAAACAGATGGTCCAGGG + Intergenic
930449679 2:51519403-51519425 CTGAGATCACAGATGGGCTAAGG + Intergenic
930993662 2:57689618-57689640 CTGGGAATCCATATGGTCCAGGG - Intergenic
931319579 2:61163139-61163161 CTTAGAAAACAGAAGGGACATGG + Exonic
931332175 2:61299050-61299072 GTGAGAAAACAGAGGTTTCATGG + Intronic
931898789 2:66764679-66764701 CTGAGAAAAGAGGTGCTCCTGGG - Intergenic
936478527 2:112863673-112863695 ATAAGAAAACAGATGGTGGATGG - Intergenic
936559566 2:113525143-113525165 CTGAGAAAGCAGATGCCCAAGGG + Intergenic
937115724 2:119403920-119403942 CTGAGAATGCAGATGAGCCATGG + Intergenic
937701677 2:124869153-124869175 CTGACAAAACATGTGGTCCTGGG - Intronic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
939851207 2:147307458-147307480 CTGAAAAAATGGAAGGTCCATGG - Intergenic
945136373 2:206632501-206632523 CTGAGAATAAAGAAGTTCCATGG + Intergenic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
949078980 2:242081389-242081411 CAGAGAAAACAGATCATCTATGG + Intergenic
1169627088 20:7583042-7583064 AAGAGAACACAGATAGTCCATGG - Intergenic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1171262697 20:23747842-23747864 CTGGGAGAACAGAAGGTCCCTGG - Exonic
1178436535 21:32564258-32564280 CTGGGAAACCAACTGGTCCAGGG + Intergenic
1178690831 21:34748210-34748232 CTGAGAGAACAGATGTGCCGGGG + Intergenic
1178781278 21:35605030-35605052 CTGAGGAAACAGATGGGATAAGG - Intronic
1178881319 21:36452481-36452503 CAGAGGAAACAGATGATTCAGGG - Intergenic
1179153866 21:38832685-38832707 TTGAGAAAACAGAAGCCCCAAGG - Intergenic
1180717471 22:17881555-17881577 CTGAGAAAACTGTTGCTCCCTGG - Intronic
1181432885 22:22893864-22893886 GAGAGAAAACAGATTTTCCAGGG - Intronic
1185032796 22:48453563-48453585 CTGAGAGAGCAGATGGGGCAAGG + Intergenic
1185238568 22:49728431-49728453 CAGAGGAAACAGATGTTACAGGG - Intergenic
950108921 3:10406065-10406087 CTGAGAAAGCAGTTGGGGCAGGG - Intronic
950132169 3:10554791-10554813 TTCAGAAAACAGAAGGCCCAGGG + Intronic
950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG + Intergenic
952101486 3:30018040-30018062 CTTGGAACACAGGTGGTCCAAGG - Intergenic
952842850 3:37662821-37662843 CTGTGTAGACAGTTGGTCCATGG + Intronic
953252403 3:41258173-41258195 CTGAGAAAATAGAAGGTTAAAGG - Intronic
954284224 3:49607342-49607364 CTGAGCCAACAGAGGGACCAGGG - Intronic
954705603 3:52479028-52479050 TTGGGAGAACAGAAGGTCCAAGG - Intronic
955732449 3:62000863-62000885 CTGGGAAAGCAGATGATCCAGGG - Intronic
955827872 3:62967313-62967335 GTGAGAAAACTGATGTTCTAAGG - Intergenic
956848699 3:73207900-73207922 CTGAGGAAAGAGATAGTCCCAGG - Intergenic
958097240 3:88962367-88962389 ATGAGAAAACATAGAGTCCATGG - Intergenic
959647494 3:108720374-108720396 CTGATAAAACAGATGATTCAAGG - Intergenic
959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG + Intergenic
960604428 3:119490193-119490215 CTGAGAAAATAAATGTTCAATGG - Intronic
960865203 3:122192833-122192855 CAGAGAAAAGAGGTGATCCATGG - Intronic
961871396 3:129991105-129991127 CTGATAAAACAGAGGCACCATGG + Intergenic
962879463 3:139562525-139562547 CTGAGTAAAGAGAGGCTCCAGGG + Intronic
963244846 3:143048211-143048233 CACAGAAAACAGATGATCAAGGG - Intronic
963575276 3:147053086-147053108 CTGAGAAAAGAAATTTTCCATGG - Intergenic
964564088 3:158030626-158030648 CTGAGGAAACAGAGGCTTCAAGG - Intergenic
966838386 3:184067675-184067697 CAGCTAAAACAGATGTTCCAGGG + Intergenic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
969202582 4:5617733-5617755 CAGAGAAAACAGAAGTTCGAAGG + Intronic
970250057 4:14104941-14104963 CTGATAAATGAGATGGTCAAGGG + Intergenic
970880230 4:20919768-20919790 ATGAGAAAGCAGCTGGTACATGG + Intronic
971695406 4:29895650-29895672 CTGAGAATAAAGATGGTTCGTGG - Intergenic
971982675 4:33773901-33773923 ATGTGAAAATAGATGGTTCATGG - Intergenic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
973330367 4:48906237-48906259 CTGAGGAAACAGAGGGTCCCCGG - Intronic
974599380 4:64057106-64057128 CTGTGAAACCATCTGGTCCAGGG + Intergenic
974718973 4:65711842-65711864 CTGAGAACTCAGATAATCCAAGG + Intergenic
974883260 4:67785334-67785356 ATGAGAAGACAGAGGGTCAAAGG - Intergenic
976530946 4:86151232-86151254 CTGAGAAAACAGATGGACTCAGG - Intronic
976648776 4:87413045-87413067 CTGTGAAGACAGATGTTACATGG + Intergenic
976729385 4:88246637-88246659 TTGAAAAAATAGATGTTCCAGGG - Intergenic
976770664 4:88649058-88649080 CTGAAAAAACAGATCATGCAGGG - Intronic
978486987 4:109265948-109265970 CTGAGAAAAGAGAAGGGCTATGG - Intronic
981048870 4:140291738-140291760 CTGAGAAATCAGATGGATCCTGG - Intronic
981147582 4:141343229-141343251 CAGGGAACACAGATGCTCCAGGG - Intergenic
981171060 4:141623742-141623764 CTGAGAAAAAAAAAGATCCAAGG + Intergenic
983793871 4:171834823-171834845 CAGAGAAAACTGATGAACCAGGG + Intronic
986308856 5:6536334-6536356 CAGGGAAAACAGCAGGTCCAGGG - Intergenic
986699314 5:10390411-10390433 TTGAGAGAGCAGATAGTCCATGG + Exonic
987544473 5:19295138-19295160 ATGAGGAAACAGCTGGTACATGG - Intergenic
987669978 5:20994149-20994171 CTGTGAATACATCTGGTCCAGGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988363647 5:30267851-30267873 TTTAGAAAACAGAGGGTCCCAGG + Intergenic
989243284 5:39224344-39224366 CTGTGAAAACAGATGGGGGAGGG + Intronic
989293777 5:39799680-39799702 CTGAGAAATCAGAATGTCTATGG - Intergenic
989295217 5:39817631-39817653 CTGAGAAAACAGGTAGTAAAAGG + Intergenic
990614573 5:57494556-57494578 CTGAGGAAACAGAGCCTCCATGG + Intergenic
991402909 5:66272894-66272916 CTGAGAAAACAGAGGCTCAGAGG + Intergenic
994608579 5:102005502-102005524 CTGAGACAACAGTTTGTCTATGG - Intergenic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
994872865 5:105376103-105376125 CTGAGAACCCACCTGGTCCAGGG + Intergenic
994902648 5:105795623-105795645 CTCAGAAAACATGTGGTGCATGG - Intergenic
994921248 5:106046835-106046857 CTCAGAAAACAGAAGCACCAAGG + Intergenic
994988452 5:106967802-106967824 CTCAGAAAACAGATGGAATATGG + Intergenic
997241507 5:132311620-132311642 CTGAGAAATCATGTGGTCCCTGG - Intronic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
998302438 5:141037081-141037103 ATGAGAAAAAATATGGTACATGG - Intergenic
998906323 5:146909028-146909050 AAGAGAAAGCAGATGGTCCATGG + Intronic
1000353988 5:160375618-160375640 CTGAGAAATAATTTGGTCCAAGG + Intergenic
1001480562 5:172086464-172086486 CTGAGAGCACAGGTGGACCAGGG - Intronic
1004174408 6:13327138-13327160 CTGATAAAATAGATGGCACAAGG + Intronic
1005167436 6:22940561-22940583 CTTAAAAAACAGAGGCTCCATGG - Intergenic
1005831643 6:29675867-29675889 CAGGGAAACCAGATGTTCCAGGG + Intronic
1006295800 6:33169503-33169525 CGGAGGACACAGATGGCCCAGGG + Intronic
1006556738 6:34873338-34873360 CTGGGAAAGCAGATGTGCCAGGG - Exonic
1006820677 6:36891892-36891914 TTCAGAAAACAGAACGTCCAGGG + Intronic
1006828731 6:36955983-36956005 CTGAGAGAACAGATGCACCTTGG + Intronic
1006877179 6:37307846-37307868 CTGAGATCACAGATGGTTCCTGG + Intronic
1007095861 6:39212606-39212628 CTGAGAGCACAGTGGGTCCAAGG + Intronic
1007914536 6:45548957-45548979 CTGAGAGGACATATGGCCCACGG + Exonic
1008395530 6:51002474-51002496 TGGAGAAAACAGAAGGTCTAAGG - Intergenic
1008549626 6:52615239-52615261 CTGTGAAAAAATATGGTGCATGG + Intergenic
1008673709 6:53797470-53797492 GTGAGACAACAGATAGCCCAAGG - Intronic
1011015066 6:82745340-82745362 ATGAGAAAACTGAAGGTCAAAGG - Intergenic
1011471453 6:87711965-87711987 CTGAGAACACACCTGGGCCATGG - Intergenic
1012104418 6:95136749-95136771 CTGTGATAACAGAATGTCCAAGG - Intergenic
1012747035 6:103104692-103104714 CTGAGAAAACAACTGGAACATGG - Intergenic
1013947018 6:115733607-115733629 CTGCAATAACAGATGGCCCAAGG - Intergenic
1015592941 6:134839834-134839856 CTGAGACAACAGCTGGGGCATGG + Intergenic
1015674003 6:135724506-135724528 CTGAGAAAATAGATGTTAAAGGG - Intergenic
1016372103 6:143385890-143385912 CTGAAAAAACAGCTGTTCTATGG + Intergenic
1016570868 6:145511146-145511168 CTGTGAAACCATTTGGTCCAGGG - Intronic
1016941274 6:149484651-149484673 GTGAGAAATCAGATTGTTCAGGG + Intronic
1017810061 6:157978079-157978101 CCGAGAAAGCAGAGGGGCCAAGG - Intergenic
1018929460 6:168231014-168231036 ATGAGAAAACGGAAGGTCCCAGG - Intergenic
1018999347 6:168735702-168735724 AGGAGAAAACAGAAGTTCCAAGG + Intergenic
1023490053 7:40730024-40730046 CTGCTAATACAGAGGGTCCAGGG + Intronic
1023635422 7:42204660-42204682 TTCAGAAAATAGATGGTCCAGGG + Intronic
1024499295 7:50085887-50085909 CTGAGAATACAGATTGTTCTGGG - Intronic
1024526690 7:50355265-50355287 CTGTGAGAGCAGATGGTCCTGGG + Intronic
1024756155 7:52534674-52534696 CTTAGATAACTGATGGTGCAAGG + Intergenic
1025634685 7:63312376-63312398 CTGTGAAAACATCTGGTCCTGGG - Intergenic
1025648011 7:63435794-63435816 CTGTGAAAACATCTGGTCCTGGG + Intergenic
1025741319 7:64198663-64198685 CTGTGAAAACATATGGTCCTGGG + Intronic
1027362964 7:77428406-77428428 CTGAGAGACAAGATGCTCCAGGG - Intergenic
1028772097 7:94637735-94637757 CAGAGAGAACAGAGGTTCCAGGG + Intronic
1029611254 7:101627725-101627747 TAGAGAAAACAGTTGGCCCAGGG - Intronic
1030114865 7:106055430-106055452 CTGAGAAGAGAGATCGTTCAAGG + Intergenic
1031419802 7:121537856-121537878 CTGTGAATACATATGGTGCATGG + Intergenic
1031989107 7:128184627-128184649 CTGAGAAAAATGGTGGACCAGGG + Intergenic
1032933997 7:136708115-136708137 ATGAGAAAACAGTGGGTGCAAGG + Intergenic
1033132867 7:138760069-138760091 CAAAGAAAACAGAAGGTCAAAGG - Intronic
1033892785 7:146035961-146035983 CTGAGCTAACAGAGGGTCAAGGG - Intergenic
1034492509 7:151401365-151401387 CTGAGGAAACAGAGGGTTTAGGG - Intronic
1035120421 7:156562040-156562062 CAGAGAAAGCAGCTGGTTCAGGG + Intergenic
1035391186 7:158506152-158506174 CAGAGAAAGCAGAGGCTCCATGG + Intronic
1035537242 8:401396-401418 CAGAGAAAACAGATCATCTATGG + Intergenic
1035973560 8:4281314-4281336 CTGCGAGAACAGGTGGTCCCAGG + Intronic
1036378754 8:8222615-8222637 CTGACAAAACAGATGGTTTCAGG + Intergenic
1036717465 8:11139564-11139586 CTCGGAAAACAGATGCTCCAGGG + Intronic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1037686511 8:21144127-21144149 ATGACAAAACAGATGTGCCAGGG - Intergenic
1038720939 8:30034786-30034808 GTTAGAAAAGAGATGGTTCAGGG + Intergenic
1041487435 8:58394527-58394549 CTGAGAAAAGACTAGGTCCAAGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043696018 8:83218613-83218635 CTGAGAATTCATATGGTCCAGGG + Intergenic
1044898452 8:96918542-96918564 CTGAGTAAACAGAGGGTCCTGGG - Intronic
1045017657 8:98012862-98012884 ATGAGAAAACTGATGGTCAGAGG - Intronic
1046376480 8:113388440-113388462 GTGACAAATCAGATGGTCAAAGG - Intronic
1047408715 8:124606704-124606726 CTGATAAAACAGATGTTCGGGGG - Intronic
1047469447 8:125154797-125154819 CTGAGAAAACAGTTTTTCCGTGG - Intronic
1047759419 8:127943093-127943115 CTGAGTCACGAGATGGTCCATGG - Intergenic
1048572641 8:135668114-135668136 CTGAGAAAACAGAGGCTCAGAGG - Intergenic
1049893299 9:91080-91102 CTGAGAAAGCAGATGCCCAAGGG - Intergenic
1051062758 9:13064099-13064121 CTGAGTGAACAGATGGTGTAGGG + Intergenic
1051436150 9:17034626-17034648 CTGAGAAAACAAATGATACTAGG + Intergenic
1051681048 9:19608583-19608605 CTGAGAAAACTGCGGTTCCAAGG - Intronic
1052108455 9:24548908-24548930 CTGAGAAATCAGATCTACCATGG - Intergenic
1053101484 9:35375452-35375474 CTAAGAAAACAGAAGGTACTAGG - Intronic
1053734512 9:41091138-41091160 CTGAGAAAGCAGATGCCCAAGGG - Intergenic
1054693870 9:68340281-68340303 CTGAGAAAGCAGATGCCCAAGGG + Intronic
1056233595 9:84570619-84570641 CTGAGCAAACAGATGGCCAGAGG - Intergenic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1057159272 9:92875060-92875082 CTGAGAAAACAGATGGGTAGAGG + Intronic
1058634573 9:107024023-107024045 TTGTGTAGACAGATGGTCCATGG - Intergenic
1058916483 9:109571511-109571533 CTGTGAAACCATCTGGTCCAGGG - Intergenic
1062170987 9:135134466-135134488 CTGCGCAAACAGATGGTCTGGGG - Intergenic
1062198887 9:135290282-135290304 CTGTGGAAACAGAAGGTCCTTGG - Intergenic
1185705389 X:2262870-2262892 TCGACAAAACAGATGGGCCAAGG + Intronic
1187141692 X:16600157-16600179 ATAAGAAAACAGATATTCCAAGG + Intronic
1189369578 X:40417090-40417112 CTGAGCAAACAGAGGTTCCCTGG + Intergenic
1189523555 X:41796225-41796247 ATGAGGAAACAGATGTTCTAAGG - Intronic
1189993637 X:46618172-46618194 CTGACAAAAAAGAAAGTCCAGGG + Intronic
1190525253 X:51323041-51323063 CGGAGAACACAGTTGATCCATGG + Intergenic
1190544266 X:51508892-51508914 CAGAGAACACAGTTGATCCACGG - Intergenic
1190914140 X:54797841-54797863 AAGAGAAAACAGAGGTTCCAAGG - Intronic
1192442457 X:71184827-71184849 GAGAGCAGACAGATGGTCCAGGG + Intergenic
1193191281 X:78573761-78573783 CTGTCAAAACAGGTGGTACATGG - Intergenic
1194245265 X:91503311-91503333 CTGTGAATACATCTGGTCCAGGG - Intergenic
1196862289 X:120039673-120039695 CTGAGGAAAGAGATGGTCGTTGG + Intergenic
1196880813 X:120196671-120196693 CTGAGGAAAGAGATGGTCGTTGG - Intergenic
1197044073 X:121975304-121975326 CAGAGTAAACTGATGGTCCTTGG + Intergenic
1197922293 X:131608329-131608351 CAGAGATAAAAGATGGTCGAAGG - Intergenic
1200564237 Y:4744622-4744644 CTGTGAATACATCTGGTCCAGGG - Intergenic
1201384100 Y:13419443-13419465 CTGCCAGAACAGATGCTCCATGG + Intronic