ID: 1162145266

View in Genome Browser
Species Human (GRCh38)
Location 19:8609405-8609427
Sequence TCCCTTCAGGATCCCCGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162145266_1162145281 24 Left 1162145266 19:8609405-8609427 CCATCCCGGGGATCCTGAAGGGA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1162145281 19:8609452-8609474 TCCGGCCAGGCTGCGGGGACAGG 0: 1
1: 0
2: 1
3: 22
4: 217
1162145266_1162145274 11 Left 1162145266 19:8609405-8609427 CCATCCCGGGGATCCTGAAGGGA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1162145274 19:8609439-8609461 ACACCCAAACCTCTCCGGCCAGG 0: 1
1: 0
2: 1
3: 5
4: 121
1162145266_1162145283 25 Left 1162145266 19:8609405-8609427 CCATCCCGGGGATCCTGAAGGGA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1162145283 19:8609453-8609475 CCGGCCAGGCTGCGGGGACAGGG 0: 1
1: 0
2: 2
3: 24
4: 279
1162145266_1162145277 17 Left 1162145266 19:8609405-8609427 CCATCCCGGGGATCCTGAAGGGA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1162145277 19:8609445-8609467 AAACCTCTCCGGCCAGGCTGCGG 0: 1
1: 0
2: 2
3: 11
4: 114
1162145266_1162145279 19 Left 1162145266 19:8609405-8609427 CCATCCCGGGGATCCTGAAGGGA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1162145279 19:8609447-8609469 ACCTCTCCGGCCAGGCTGCGGGG 0: 1
1: 0
2: 3
3: 12
4: 148
1162145266_1162145278 18 Left 1162145266 19:8609405-8609427 CCATCCCGGGGATCCTGAAGGGA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1162145278 19:8609446-8609468 AACCTCTCCGGCCAGGCTGCGGG 0: 1
1: 0
2: 1
3: 13
4: 134
1162145266_1162145272 6 Left 1162145266 19:8609405-8609427 CCATCCCGGGGATCCTGAAGGGA 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1162145272 19:8609434-8609456 GCTCCACACCCAAACCTCTCCGG 0: 1
1: 0
2: 0
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162145266 Original CRISPR TCCCTTCAGGATCCCCGGGA TGG (reversed) Intronic
900163484 1:1235563-1235585 TCCCTTCAGGATCCCCCAGGAGG + Intergenic
900326761 1:2111928-2111950 TCCTTTCAGAAGACCCGGGAAGG + Intronic
900548797 1:3243317-3243339 TCCCATCCAGATCCCTGGGAGGG - Intronic
900994845 1:6115358-6115380 GCCCTGCAAGATCCCCTGGAAGG + Intronic
901537396 1:9891442-9891464 TCCCCTCAGAATCCCAGGGCTGG + Intronic
910366350 1:86469539-86469561 TCCTTTTAGGATCACAGGGAAGG - Intronic
912558061 1:110530447-110530469 CCCCTTCCGGTTCCCTGGGAGGG + Intergenic
914753789 1:150552081-150552103 TCCCTTTAGGATCCTCAGGGTGG - Intronic
917305423 1:173619114-173619136 TCCCTTCAGGAGCTCCTGCAAGG - Intronic
919748202 1:201021620-201021642 TCCCATGAGGCTCCCCGGGTGGG + Intronic
920358274 1:205392132-205392154 TCCCCTCAGGAGACCCTGGATGG - Intronic
921532992 1:216307847-216307869 GACCTTCAGGTTCCCCAGGAAGG + Intronic
923029244 1:230234250-230234272 TCCCTTCAGAAGCACAGGGAGGG - Intronic
924332443 1:242953571-242953593 TCCCTCCATGATCCACGGGTAGG + Intergenic
1062859464 10:799063-799085 TCCCTTAAGGATCTCCTGTAAGG - Intergenic
1063450638 10:6147799-6147821 CCCCATCAGGATCCCCTGTATGG - Intronic
1063486856 10:6428224-6428246 TTCCTTCATGAACCCCGGGATGG - Exonic
1063910699 10:10826979-10827001 TCCCTGAAAGATCCCAGGGAAGG - Intergenic
1067555731 10:47268724-47268746 TCTCTCCAGGTTCCCCAGGACGG - Intergenic
1067806070 10:49394701-49394723 TCCCCTCAGGATCCCCAGTCTGG - Intronic
1068449499 10:57167056-57167078 TCCCTTAAGGATCTCCTGGAAGG - Intergenic
1069167502 10:65180808-65180830 TCCCTTCAGGACCCCTTGTAAGG + Intergenic
1072039180 10:91591062-91591084 TCACTGCAGTATCCCCAGGATGG + Intergenic
1072904713 10:99442211-99442233 CCCCATCAGGATCCCCCAGAAGG + Intergenic
1075519631 10:123136021-123136043 TCTCCTCCGGGTCCCCGGGAGGG - Exonic
1076408002 10:130226203-130226225 GCCTTCCAGGATCCCCGGGAGGG - Intergenic
1077302938 11:1855503-1855525 TCCCCTCAGACTGCCCGGGACGG + Intronic
1078690184 11:13571800-13571822 TCCCTTCAGGAGCTCTGGTAAGG - Intergenic
1078989388 11:16631247-16631269 TCCCTTAAGGATCTCCCGTAAGG + Intronic
1082084469 11:48038379-48038401 TCCCTTCAGCATCACTGGGGAGG + Intronic
1083195352 11:61082618-61082640 TCCCTTCAGGAATATCGGGAGGG + Intergenic
1083912537 11:65718686-65718708 CCCCATCAGGATCTCCAGGATGG - Exonic
1083989914 11:66240576-66240598 TCCCTTCAGGGTCTTCTGGAGGG + Intronic
1084822959 11:71706583-71706605 TCGCTCCAGGCTCCCCTGGAAGG + Intergenic
1085237101 11:75023664-75023686 TCCCTTCAGGCTCTGCTGGATGG + Intergenic
1085468998 11:76744818-76744840 TCCCTTCGGGATCCTCTTGAAGG - Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1095780257 12:46051026-46051048 TCCCTTCAGGATCTCTTGTAAGG - Intergenic
1098264400 12:68704198-68704220 TCCTTTCAGGATCCCAGGCCTGG - Intronic
1099890181 12:88580535-88580557 TCCCTTCCGGAGCCCGGGGTAGG + Intronic
1102347714 12:112170154-112170176 TCCCCTCAGGAGCTCAGGGAAGG - Intronic
1104156133 12:126134729-126134751 TCCCTTCAGGACCCCTTGTAAGG + Intergenic
1107289614 13:38838124-38838146 TTCCTTCAGGAGCTCCGGTAAGG + Intronic
1108757451 13:53521241-53521263 TCCCTTCAGGTCACCAGGGAAGG + Intergenic
1110568223 13:76977432-76977454 CCCCTACAGGATCCCAGGGTTGG - Intergenic
1113083013 13:106536341-106536363 TCCCTCCTGGCCCCCCGGGAAGG + Intergenic
1113801003 13:113086185-113086207 GGCCTTCAGGATGCCCAGGATGG - Exonic
1115946965 14:38672876-38672898 TTCCTTCAGGATCCCCTGTAAGG - Intergenic
1119325076 14:73755058-73755080 TTCCTTCAGGAGTCCTGGGAAGG - Intronic
1122340050 14:101022048-101022070 TCTCTTCAGGAACCACGGAATGG - Intergenic
1122906956 14:104806021-104806043 TCCCTGGAGGCTCCCCAGGAAGG + Intergenic
1123173488 14:106396603-106396625 TCCCTGCAGGAACCCTGGGGTGG - Intergenic
1124883787 15:33665325-33665347 TCCTTGCAGGAACCCTGGGAGGG - Intronic
1126525102 15:49645064-49645086 TGCCTTCTGAATCCCTGGGAGGG - Exonic
1127343014 15:58066233-58066255 TCCTTTCCGGAGACCCGGGAGGG + Exonic
1132205363 15:99982787-99982809 TCACTTCAGGTTTCCCGGCAAGG - Intronic
1132615655 16:840147-840169 TCCCTCCAGGGCCCCAGGGAAGG + Intergenic
1133544692 16:6794433-6794455 TCCCTTCAGGATGCAGGGGGAGG + Intronic
1133723109 16:8513392-8513414 TCTTATCAGGATCCCAGGGAGGG - Intergenic
1136363523 16:29797254-29797276 TCCCTACAGTATCCCAGAGAGGG - Intronic
1136409253 16:30066674-30066696 TCCCCTCAAGATCCCAGGGCTGG - Intronic
1137610089 16:49812101-49812123 TCCCTGCAGGATCCCTAGGAAGG - Intronic
1140477801 16:75247659-75247681 TCCCTTCAGGCAACCAGGGAAGG - Intronic
1144313394 17:14035536-14035558 CTCCTTCAGGGTCCCCAGGAAGG - Intergenic
1144788937 17:17846950-17846972 TCCCTGCAGGCTCCCTGGGCAGG - Exonic
1147496277 17:40919193-40919215 TCACATCAGGATCACCTGGAGGG - Intergenic
1149683035 17:58518719-58518741 TCTGTTCTGGGTCCCCGGGAAGG - Intergenic
1151363075 17:73600226-73600248 TCCCTCCAGGAGCCCATGGATGG + Intronic
1151548282 17:74806700-74806722 TCCCATCAGGTTCCCCAGGAGGG + Intronic
1151758709 17:76088910-76088932 CCCCCTCAGGATGCCCTGGATGG - Exonic
1152753560 17:82077647-82077669 TGCCTTCCGGAACCCCGGGCTGG + Intergenic
1152797290 17:82314630-82314652 GCCCTTCAGGAGCCTCAGGATGG - Intergenic
1152890209 17:82876379-82876401 TCTCTCCAGGTTCCCGGGGATGG + Intronic
1154066516 18:11111571-11111593 TCCCTACAGGGTCCCAGGCAGGG - Intronic
1157003718 18:43557743-43557765 TCCCTTCAGGATCTCTTGCAGGG + Intergenic
1160620392 18:80166730-80166752 TCCCCTGAAGTTCCCCGGGAAGG - Intronic
1161316652 19:3620475-3620497 TCCCTTCAGGGTGGCCGAGAGGG - Intronic
1161495638 19:4584423-4584445 GGCCTTCAGGGTCCCCGGGATGG + Intergenic
1161874630 19:6898467-6898489 TGCCCTCAGGTTCCCAGGGATGG + Intronic
1162145266 19:8609405-8609427 TCCCTTCAGGATCCCCGGGATGG - Intronic
1165316643 19:35060222-35060244 TCCCCTCAAGCTCCCCAGGATGG + Intronic
1167416289 19:49374834-49374856 TCCCACCAGGATGCCCTGGAGGG + Exonic
1167432315 19:49461697-49461719 GACATTCAGGATTCCCGGGAAGG - Exonic
1168681727 19:58320700-58320722 TCCCTTCAGGGTCACCGGGGCGG + Intergenic
926136996 2:10343404-10343426 TCCCTCCAGGACTCCCGGGTGGG + Intronic
930424131 2:51192421-51192443 TCCCTTCAGGAGCCCTTGAAAGG + Intergenic
931275483 2:60740330-60740352 ACCCTTCAAAATCCCAGGGAGGG - Intergenic
932239020 2:70142628-70142650 TCCCCTCCCGATCCCCGGGCGGG + Intergenic
932721036 2:74139153-74139175 TCCCTGCGGGATTCCCTGGAGGG - Intronic
938210047 2:129459565-129459587 TCCCTCCAGGTCCCCAGGGAAGG - Intergenic
942396091 2:175551205-175551227 CACCTTCAGTATCCCCAGGATGG + Intergenic
945280621 2:208032125-208032147 CCCCTTCAGCATCCCTGGCAGGG + Intergenic
946325228 2:218981591-218981613 TCCCATCGGCATCCCGGGGAGGG - Exonic
1170689109 20:18596113-18596135 TCCCTTCAGGACACACTGGAGGG - Exonic
1171419433 20:25008042-25008064 TCCACTGTGGATCCCCGGGAGGG - Intronic
1172283931 20:33727870-33727892 GCCCTTCAAGATTCCCAGGAAGG + Intergenic
1175108729 20:56631196-56631218 TCCCTCCAGGATCGCCACGACGG + Exonic
1179365383 21:40754329-40754351 TACCTTCAGAATCCCCCAGAAGG + Intronic
1183152639 22:36049940-36049962 TACCTTGAGGATCCCCTGAAAGG - Intergenic
1184405500 22:44298441-44298463 GCCCATCAGCATCCCCTGGAGGG - Intronic
949173672 3:1033295-1033317 TCCCTTCAGGAGCTCTTGGAAGG + Intergenic
953756779 3:45653391-45653413 ACCCTTCAGGTTCCCTGGTAAGG - Intronic
956722698 3:72132718-72132740 TCCCTTCTGGAGGCTCGGGAGGG + Intergenic
960058409 3:113293852-113293874 GTGCTTCAGAATCCCCGGGAAGG + Intronic
960938557 3:122918710-122918732 TCCCCTCAGGCTGCCAGGGAAGG - Intronic
964416678 3:156455055-156455077 TCTCTTCAGGGACCCAGGGAAGG - Intronic
965104669 3:164341316-164341338 TCGCTCCAGGCTCCCCCGGAAGG - Intergenic
965360672 3:167735021-167735043 TCGCCTCAGGATCCCCCGCATGG - Intergenic
968051570 3:195658275-195658297 CCCCTTCCCGATCCCCGGGCAGG - Intergenic
968104246 3:195990058-195990080 CCCCTTCCCGATCCCCGGGCAGG + Intergenic
968302547 3:197627648-197627670 CCCCTTCCCGATCCCCGGGCAGG + Intergenic
968731298 4:2270539-2270561 TCCCTGCAGGGACCCCGGGCCGG - Exonic
969745622 4:9068991-9069013 TCGCTCCGGGCTCCCCGGGAAGG + Intergenic
979628443 4:122872852-122872874 TCCTTTCAGGAGCTCCGGTAAGG - Intronic
980539899 4:134179364-134179386 TCCCTTCAGGATCTCTTGTAAGG - Intergenic
984280394 4:177663310-177663332 TCCTCTCAGGGTCCCTGGGAAGG - Intergenic
984836981 4:184031598-184031620 TCCCTTCTGAATCCCCTAGAAGG - Intergenic
985647713 5:1092959-1092981 CCCCTTGAGCATCCTCGGGAGGG - Intronic
985892499 5:2726546-2726568 TCCCCTCAGAACCCCCTGGAGGG + Intergenic
985933542 5:3078024-3078046 ACCCTCCAGGAACCACGGGAGGG + Intergenic
990725750 5:58752953-58752975 TTCTTTCAGGATCCCAGGCAGGG + Intronic
993218041 5:85050533-85050555 TCCCTTAAGGATCTCCTGTAAGG - Intergenic
998052875 5:139051015-139051037 TCCCTGCAGGATCCCACGTACGG - Exonic
998159412 5:139804706-139804728 TCCCTTCTGCATACCCAGGATGG + Intronic
1001114530 5:168928450-168928472 TCCCTTGAGGATCTCTGGCAAGG + Intronic
1002419487 5:179138181-179138203 TCCCCACAGGAACCCCAGGAGGG - Intronic
1005671150 6:28107579-28107601 TCTCTTCAGGAGCCCATGGAAGG - Intergenic
1006261726 6:32879783-32879805 GTCCTTCAGGATCCCCTTGAGGG + Intergenic
1008184976 6:48377586-48377608 TCCCATGAGAATCCCCAGGATGG + Intergenic
1010500428 6:76593475-76593497 GACCTTCAGGTTCCCCGGTAAGG - Intergenic
1010972929 6:82282552-82282574 TCCCTTCAGGAGCTCCTGTAAGG + Intergenic
1011010186 6:82694974-82694996 TCCCTTCAGGACCTCTTGGAGGG + Intergenic
1013971578 6:116026405-116026427 ACCCTTCAGGATCTCCGGCTAGG + Intronic
1016826043 6:148389633-148389655 TCCCATCAGAATCCCTGGGAGGG + Intronic
1019075957 6:169388286-169388308 TCCCATCAGGATCACAGGAATGG - Intergenic
1019123587 6:169824623-169824645 GACCTTCAGGTTCCCCAGGAAGG + Intergenic
1019518291 7:1449118-1449140 TCCCTTCTGGCCCCCGGGGAGGG - Intronic
1019587419 7:1813082-1813104 CCCCTGCCGGCTCCCCGGGAGGG - Intergenic
1023990523 7:45125775-45125797 TCCCTTGAGGAGCCTGGGGATGG - Intergenic
1026206691 7:68263871-68263893 CCGCTAGAGGATCCCCGGGAGGG + Intergenic
1028562639 7:92192550-92192572 TCCCTTGAGGATCTCTGGTAAGG + Intergenic
1035774152 8:2174393-2174415 TCCCTCCAAGACACCCGGGAGGG + Intergenic
1036654037 8:10664064-10664086 TCTCTCCAGGGACCCCGGGATGG + Intronic
1037812336 8:22094536-22094558 TCCCTCCAGGGTCCCTGGGCTGG - Intronic
1040602439 8:48897747-48897769 TCCCTCCAGAATCACTGGGATGG + Intergenic
1047125822 8:121959360-121959382 TCCCATTAGGATCAACGGGATGG + Intergenic
1049227942 8:141466602-141466624 TGCCTTCAGGCTCCCAGGGCAGG - Intergenic
1049377689 8:142296798-142296820 TCCCCACAGGCTCCCCAGGACGG + Intronic
1049661069 8:143819997-143820019 TCCCCTCAGGATCCCCGAGATGG + Intronic
1051369256 9:16344302-16344324 TCCTTTCAGGCTCCTCGGGGTGG + Intergenic
1058840019 9:108897209-108897231 TCCCGTCAGGATCCCTGGACAGG + Exonic
1061176257 9:128999204-128999226 TCCCTCCAGGATCTCCGTCAAGG - Exonic
1186739735 X:12505089-12505111 TCCATTCAGTATCACAGGGATGG + Intronic
1190889948 X:54559081-54559103 TCGCATCAGGATTCCCTGGAGGG + Intronic
1193854423 X:86581204-86581226 TCCCTTCAGGATCTCTTAGAAGG - Intronic
1194026781 X:88763007-88763029 TCCCTTCAGGACCACCTGTAAGG + Intergenic
1199706966 X:150435879-150435901 TCCCTTCAGGATCTCTTGTAAGG + Intronic
1201175597 Y:11306949-11306971 TCCCTGCAGAAGCCCGGGGACGG + Intergenic