ID: 1162153268

View in Genome Browser
Species Human (GRCh38)
Location 19:8660178-8660200
Sequence CTGTGTGACCCTAGGCAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162153263_1162153268 -3 Left 1162153263 19:8660158-8660180 CCAAACCCACCTGTGACTAGCTG No data
Right 1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG No data
1162153258_1162153268 21 Left 1162153258 19:8660134-8660156 CCCTGGGCTCCGGCTGCCCAGGC No data
Right 1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG No data
1162153260_1162153268 12 Left 1162153260 19:8660143-8660165 CCGGCTGCCCAGGCACCAAACCC No data
Right 1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG No data
1162153265_1162153268 -9 Left 1162153265 19:8660164-8660186 CCACCTGTGACTAGCTGTGTGAC No data
Right 1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG No data
1162153262_1162153268 4 Left 1162153262 19:8660151-8660173 CCAGGCACCAAACCCACCTGTGA No data
Right 1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG No data
1162153264_1162153268 -8 Left 1162153264 19:8660163-8660185 CCCACCTGTGACTAGCTGTGTGA No data
Right 1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG No data
1162153259_1162153268 20 Left 1162153259 19:8660135-8660157 CCTGGGCTCCGGCTGCCCAGGCA No data
Right 1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG No data
1162153261_1162153268 5 Left 1162153261 19:8660150-8660172 CCCAGGCACCAAACCCACCTGTG No data
Right 1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162153268 Original CRISPR CTGTGTGACCCTAGGCAAGT CGG Intergenic
No off target data available for this crispr