ID: 1162153286

View in Genome Browser
Species Human (GRCh38)
Location 19:8660312-8660334
Sequence AACAGCACCTGACACACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162153286_1162153294 20 Left 1162153286 19:8660312-8660334 CCTACTGTGTGTCAGGTGCTGTT No data
Right 1162153294 19:8660355-8660377 GGGGGAATGGTCCCTGTTCTCGG No data
1162153286_1162153292 2 Left 1162153286 19:8660312-8660334 CCTACTGTGTGTCAGGTGCTGTT No data
Right 1162153292 19:8660337-8660359 GGGCACTGTAGACACAGAGGGGG No data
1162153286_1162153296 22 Left 1162153286 19:8660312-8660334 CCTACTGTGTGTCAGGTGCTGTT No data
Right 1162153296 19:8660357-8660379 GGGAATGGTCCCTGTTCTCGGGG No data
1162153286_1162153298 27 Left 1162153286 19:8660312-8660334 CCTACTGTGTGTCAGGTGCTGTT No data
Right 1162153298 19:8660362-8660384 TGGTCCCTGTTCTCGGGGGCTGG No data
1162153286_1162153290 0 Left 1162153286 19:8660312-8660334 CCTACTGTGTGTCAGGTGCTGTT No data
Right 1162153290 19:8660335-8660357 TTGGGCACTGTAGACACAGAGGG No data
1162153286_1162153289 -1 Left 1162153286 19:8660312-8660334 CCTACTGTGTGTCAGGTGCTGTT No data
Right 1162153289 19:8660334-8660356 TTTGGGCACTGTAGACACAGAGG No data
1162153286_1162153291 1 Left 1162153286 19:8660312-8660334 CCTACTGTGTGTCAGGTGCTGTT No data
Right 1162153291 19:8660336-8660358 TGGGCACTGTAGACACAGAGGGG No data
1162153286_1162153295 21 Left 1162153286 19:8660312-8660334 CCTACTGTGTGTCAGGTGCTGTT No data
Right 1162153295 19:8660356-8660378 GGGGAATGGTCCCTGTTCTCGGG No data
1162153286_1162153297 23 Left 1162153286 19:8660312-8660334 CCTACTGTGTGTCAGGTGCTGTT No data
Right 1162153297 19:8660358-8660380 GGAATGGTCCCTGTTCTCGGGGG No data
1162153286_1162153293 7 Left 1162153286 19:8660312-8660334 CCTACTGTGTGTCAGGTGCTGTT No data
Right 1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162153286 Original CRISPR AACAGCACCTGACACACAGT AGG (reversed) Intergenic
No off target data available for this crispr