ID: 1162153293

View in Genome Browser
Species Human (GRCh38)
Location 19:8660342-8660364
Sequence CTGTAGACACAGAGGGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162153286_1162153293 7 Left 1162153286 19:8660312-8660334 CCTACTGTGTGTCAGGTGCTGTT No data
Right 1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162153293 Original CRISPR CTGTAGACACAGAGGGGGAA TGG Intergenic
No off target data available for this crispr