ID: 1162154142

View in Genome Browser
Species Human (GRCh38)
Location 19:8665147-8665169
Sequence CTAGGTTCCCAGGACCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162154142_1162154148 3 Left 1162154142 19:8665147-8665169 CCCACTGGGTCCTGGGAACCTAG No data
Right 1162154148 19:8665173-8665195 GCGCTTCTGGCCTATCTGAGAGG No data
1162154142_1162154150 14 Left 1162154142 19:8665147-8665169 CCCACTGGGTCCTGGGAACCTAG No data
Right 1162154150 19:8665184-8665206 CTATCTGAGAGGAATCAATTTGG No data
1162154142_1162154146 -10 Left 1162154142 19:8665147-8665169 CCCACTGGGTCCTGGGAACCTAG No data
Right 1162154146 19:8665160-8665182 GGGAACCTAGAAGGCGCTTCTGG No data
1162154142_1162154152 18 Left 1162154142 19:8665147-8665169 CCCACTGGGTCCTGGGAACCTAG No data
Right 1162154152 19:8665188-8665210 CTGAGAGGAATCAATTTGGTGGG No data
1162154142_1162154153 29 Left 1162154142 19:8665147-8665169 CCCACTGGGTCCTGGGAACCTAG No data
Right 1162154153 19:8665199-8665221 CAATTTGGTGGGCTTCCTGTAGG No data
1162154142_1162154151 17 Left 1162154142 19:8665147-8665169 CCCACTGGGTCCTGGGAACCTAG No data
Right 1162154151 19:8665187-8665209 TCTGAGAGGAATCAATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162154142 Original CRISPR CTAGGTTCCCAGGACCCAGT GGG (reversed) Intergenic
No off target data available for this crispr