ID: 1162155495

View in Genome Browser
Species Human (GRCh38)
Location 19:8675457-8675479
Sequence TGGGCTCCACCCTAGGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162155486_1162155495 12 Left 1162155486 19:8675422-8675444 CCTTGCTATATCTCTGGGACACT No data
Right 1162155495 19:8675457-8675479 TGGGCTCCACCCTAGGGGTTGGG No data
1162155485_1162155495 16 Left 1162155485 19:8675418-8675440 CCATCCTTGCTATATCTCTGGGA No data
Right 1162155495 19:8675457-8675479 TGGGCTCCACCCTAGGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162155495 Original CRISPR TGGGCTCCACCCTAGGGGTT GGG Intergenic
No off target data available for this crispr