ID: 1162156090

View in Genome Browser
Species Human (GRCh38)
Location 19:8678937-8678959
Sequence ACTGAAGACCAGACTGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162156085_1162156090 16 Left 1162156085 19:8678898-8678920 CCTGTCCTGGGGTAGGAATGGGT No data
Right 1162156090 19:8678937-8678959 ACTGAAGACCAGACTGAAGGAGG No data
1162156086_1162156090 11 Left 1162156086 19:8678903-8678925 CCTGGGGTAGGAATGGGTGTTTG No data
Right 1162156090 19:8678937-8678959 ACTGAAGACCAGACTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162156090 Original CRISPR ACTGAAGACCAGACTGAAGG AGG Intergenic
No off target data available for this crispr