ID: 1162156466

View in Genome Browser
Species Human (GRCh38)
Location 19:8681423-8681445
Sequence AAGGGTAATCAGATGCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162156460_1162156466 11 Left 1162156460 19:8681389-8681411 CCACTAAATAATTATTTTTGACA No data
Right 1162156466 19:8681423-8681445 AAGGGTAATCAGATGCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162156466 Original CRISPR AAGGGTAATCAGATGCATGT GGG Intergenic
No off target data available for this crispr