ID: 1162162854

View in Genome Browser
Species Human (GRCh38)
Location 19:8731603-8731625
Sequence CAGCGCCATCTCGTAGGCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162162854_1162162858 -10 Left 1162162854 19:8731603-8731625 CCTGTGCCTACGAGATGGCGCTG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1162162858 19:8731616-8731638 GATGGCGCTGTCCACCTCAGGGG 0: 1
1: 0
2: 0
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162162854 Original CRISPR CAGCGCCATCTCGTAGGCAC AGG (reversed) Exonic
907777697 1:57534698-57534720 CAGAGCCTTCTCGTAGAGACTGG - Intronic
917591552 1:176481348-176481370 CAGAGCCATGTCGAAGGCCCCGG - Intronic
918146284 1:181758771-181758793 CAGGGCCAGCTCATAGGTACAGG - Exonic
920849710 1:209620356-209620378 CAGCGCCATCTGATAGGTCCAGG + Intronic
921089149 1:211826558-211826580 CAGCCCCATATAGTAGCCACTGG - Intronic
921185340 1:212665400-212665422 CAGCGCCATCTCGTGGCTGCTGG - Intergenic
1063434862 10:6021504-6021526 CAGCCCCAGCTCATATGCACAGG - Exonic
1078811455 11:14770673-14770695 CAGAGCCATTTTGTGGGCACTGG + Intronic
1079367234 11:19819995-19820017 CAGCTCCACCTTCTAGGCACAGG - Intronic
1083667830 11:64285233-64285255 CCGCGCCATCTCGGGGGCACTGG + Intronic
1085831843 11:79909818-79909840 CAGGGCTATATGGTAGGCACAGG + Intergenic
1089554918 11:119310975-119310997 CAGCCCCATCTTGTCGGCCCTGG - Intronic
1100709392 12:97239038-97239060 TACTGACATCTCGTAGGCACAGG + Intergenic
1102050039 12:109855658-109855680 GAGGGCCATCTCGTAGGCCTTGG + Exonic
1102812808 12:115839064-115839086 CAGGGCCATCTGGAGGGCACAGG + Intergenic
1104991396 12:132625693-132625715 CAGCGTCATCTCGATGGCAGAGG + Exonic
1113925577 13:113939780-113939802 CAGCGCCATCTCATGCTCACAGG + Intergenic
1115015630 14:28609411-28609433 GAGCGCCATCTCGTGGTGACAGG + Intergenic
1130064257 15:80591719-80591741 CACCGCCTTCTCGTAGGTACCGG + Intronic
1133210235 16:4259728-4259750 CAGCTCCATCTCCTAGGACCTGG - Intronic
1137057664 16:35753266-35753288 CAGGGCCACCGCGGAGGCACAGG - Intergenic
1138630465 16:58290673-58290695 TACCGCCATCACGGAGGCACTGG - Intronic
1142212732 16:88816174-88816196 CACTGCCATCTCCTGGGCACTGG - Intronic
1143085558 17:4413370-4413392 CAGCGCCACCTGGTGGCCACCGG + Intergenic
1144420339 17:15092000-15092022 CAGCTCCATCTTCTGGGCACAGG + Intergenic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148218646 17:45847664-45847686 CATCGCCATGTGGTGGGCACAGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1154279544 18:12990736-12990758 CACCGCCATCTGCTCGGCACAGG - Intergenic
1161294667 19:3513596-3513618 CTGTGCCAGCTGGTAGGCACGGG + Intronic
1162162854 19:8731603-8731625 CAGCGCCATCTCGTAGGCACAGG - Exonic
1165576157 19:36820812-36820834 CAGCCTCATCTCCTAGGCTCAGG - Intronic
1166291926 19:41869047-41869069 CAGCGCCACCCCGGAGGTACAGG - Exonic
936110902 2:109663906-109663928 CAGCGACATTTGGGAGGCACTGG - Intergenic
937300002 2:120833211-120833233 AAACACCATCTCGTAGGCCCTGG - Intronic
937694433 2:124792032-124792054 CAGAACCATCTTGTAGCCACTGG - Intronic
941812315 2:169767461-169767483 CAGCCCCATCTGGTGGACACAGG + Intronic
947568760 2:231214328-231214350 CAGCTCTATCTCCTAGGCCCAGG + Intronic
948384320 2:237572163-237572185 GAGCGCCATCTGGTGGCCACGGG + Intergenic
1178439107 21:32584226-32584248 CAGCCCCAGCTCCTGGGCACGGG + Exonic
1184859556 22:47165445-47165467 CATCGCCATCTCATAGACAGGGG + Intronic
953755302 3:45640962-45640984 CAGCGGCTTCTCTTAGACACTGG + Intronic
961176285 3:124837828-124837850 CAGCTCCATCTCCAGGGCACAGG + Intronic
967251044 3:187538878-187538900 CAGGGCTAACTCGTAGGCAGTGG - Intergenic
968662834 4:1805891-1805913 CCGGGCCACCTGGTAGGCACAGG - Exonic
969400494 4:6952303-6952325 CAGCGGCATCGCCTGGGCACTGG - Intronic
973603183 4:52561747-52561769 CAGGGCCCTCTATTAGGCACAGG - Intergenic
978132845 4:105220560-105220582 CTGCCCAATCTCCTAGGCACTGG - Intronic
985530772 5:432894-432916 CAGGGCCACCCCGGAGGCACAGG - Exonic
985567269 5:625579-625601 CAGAGCCATTTCGGAGACACTGG - Intronic
985579941 5:691320-691342 CAGCCCCATCTCCTAGTCCCAGG + Intronic
985594788 5:783379-783401 CAGCCCCATCTCCTAGTCCCAGG + Intergenic
1008136967 6:47788213-47788235 CAGCGCCATCGCGTGGCAACAGG - Intronic
1019038805 6:169085548-169085570 CAGCACCATTTCATACGCACAGG + Intergenic
1022208297 7:28183669-28183691 CTGCCCCATCTCGAGGGCACTGG - Intergenic
1035397431 7:158544278-158544300 CAGAGCCATCTCGTGGGCCGTGG - Intronic
1035693782 8:1577882-1577904 CAGTGGCACCTCGGAGGCACCGG - Intronic
1036517483 8:9458225-9458247 CAGCAGCATCTCCTAGGCAATGG + Intergenic
1046646860 8:116794752-116794774 CAGGGCCATGCCATAGGCACTGG + Intronic
1050418385 9:5437709-5437731 CAGCGCGATCTCCTGGGCTCCGG - Intronic
1055654527 9:78439638-78439660 CACCGCCATCTAGTGGACACCGG - Intergenic
1060299437 9:122366293-122366315 CAGCACCATCTGCTTGGCACAGG - Intergenic
1060793215 9:126499352-126499374 CTGCGCCCTCTGGTGGGCACAGG - Intronic
1060959299 9:127668089-127668111 CAGCGGCATCGGGGAGGCACGGG + Exonic
1061226491 9:129283745-129283767 CAGGGGCCTCTCGCAGGCACTGG - Intergenic