ID: 1162164766

View in Genome Browser
Species Human (GRCh38)
Location 19:8744791-8744813
Sequence CACCCACACATCCCACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162164756_1162164766 30 Left 1162164756 19:8744738-8744760 CCAATCTCATGGCAGGTTCATGC No data
Right 1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG No data
1162164757_1162164766 6 Left 1162164757 19:8744762-8744784 CCCTTTTCCCTTCCCCTCTCTCC No data
Right 1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG No data
1162164761_1162164766 -6 Left 1162164761 19:8744774-8744796 CCCCTCTCTCCAACACACACCCA No data
Right 1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG No data
1162164763_1162164766 -8 Left 1162164763 19:8744776-8744798 CCTCTCTCCAACACACACCCACA No data
Right 1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG No data
1162164758_1162164766 5 Left 1162164758 19:8744763-8744785 CCTTTTCCCTTCCCCTCTCTCCA No data
Right 1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG No data
1162164759_1162164766 -1 Left 1162164759 19:8744769-8744791 CCCTTCCCCTCTCTCCAACACAC No data
Right 1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG No data
1162164760_1162164766 -2 Left 1162164760 19:8744770-8744792 CCTTCCCCTCTCTCCAACACACA No data
Right 1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG No data
1162164762_1162164766 -7 Left 1162164762 19:8744775-8744797 CCCTCTCTCCAACACACACCCAC No data
Right 1162164766 19:8744791-8744813 CACCCACACATCCCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162164766 Original CRISPR CACCCACACATCCCACAGGC AGG Intergenic
No off target data available for this crispr