ID: 1162165827 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:8752206-8752228 |
| Sequence | GCATGAACCTGCCATGAGAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1162165827_1162165837 | 30 | Left | 1162165827 | 19:8752206-8752228 | CCAATCTCATGGCAGGTTCATGC | No data | ||
| Right | 1162165837 | 19:8752259-8752281 | CACCCACACATCCCACAGGCAGG | No data | ||||
| 1162165827_1162165836 | 26 | Left | 1162165827 | 19:8752206-8752228 | CCAATCTCATGGCAGGTTCATGC | No data | ||
| Right | 1162165836 | 19:8752255-8752277 | CACACACCCACACATCCCACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1162165827 | Original CRISPR | GCATGAACCTGCCATGAGAT TGG (reversed) | Intergenic | ||