ID: 1162165828

View in Genome Browser
Species Human (GRCh38)
Location 19:8752230-8752252
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162165828_1162165836 2 Left 1162165828 19:8752230-8752252 CCCTTTTCCCTTCCCCTCTCTCC No data
Right 1162165836 19:8752255-8752277 CACACACCCACACATCCCACAGG No data
1162165828_1162165842 18 Left 1162165828 19:8752230-8752252 CCCTTTTCCCTTCCCCTCTCTCC No data
Right 1162165842 19:8752271-8752293 CCACAGGCAGGTCACCCCGCAGG No data
1162165828_1162165837 6 Left 1162165828 19:8752230-8752252 CCCTTTTCCCTTCCCCTCTCTCC No data
Right 1162165837 19:8752259-8752281 CACCCACACATCCCACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162165828 Original CRISPR GGAGAGAGGGGAAGGGAAAA GGG (reversed) Intergenic