ID: 1162165833 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:8752243-8752265 |
Sequence | GTGGGTGTGTGTTGGAGAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1162165833_1162165837 | -7 | Left | 1162165833 | 19:8752243-8752265 | CCCTCTCTCCAACACACACCCAC | No data | ||
Right | 1162165837 | 19:8752259-8752281 | CACCCACACATCCCACAGGCAGG | No data | ||||
1162165833_1162165842 | 5 | Left | 1162165833 | 19:8752243-8752265 | CCCTCTCTCCAACACACACCCAC | No data | ||
Right | 1162165842 | 19:8752271-8752293 | CCACAGGCAGGTCACCCCGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1162165833 | Original CRISPR | GTGGGTGTGTGTTGGAGAGA GGG (reversed) | Intergenic | ||